e8200  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    pMAL Protein Fusion and Purification System
    Description:
    pMAL Protein Fusion and Purification System
    Catalog Number:
    e8200s
    Price:
    677
    Category:
    E coli Protein Expression Kits
    Buy from Supplier


    Structured Review

    New England Biolabs e8200
    pMAL Protein Fusion and Purification System
    pMAL Protein Fusion and Purification System
    https://www.bioz.com/result/e8200/product/New England Biolabs
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    e8200 - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Endotoxin Assay:

    Article Title: Complement Dependent and Independent Interaction Between Bovine Conglutinin and Mycobacterium bovis BCG: Implications in Bovine Tuberculosis
    Article Snippet: The levels of endotoxin in the purified protein was measured using chromogenic Limulus Amebocyte Lysate (LAL) endotoxin assay kit (GenScript), and found to be < 5 pg/μg of rfBC. .. Commercially available recombinant maltose-binding protein (MBP) (NEB; E8200S) was used a negative control protein.

    Clone Assay:

    Article Title: A juvenile mouse pheromone inhibits sexual behavior through the vomeronasal system
    Article Snippet: Recombinant proteins A gene encoding the secreted form of ESP22 (Ala23-End) was cloned into pMAL-c5x bacterial expression vector (New England Biolabs) using SacI and BamHI restriction sites. .. ESP22 was expressed and purified as a fusion protein with maltose-binding protein (MBP) in BL21(DE3) cells following manufacturer’s protocols (pMAL Protein Fusion & Purification System, New England Biolabs).

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: The following primers were used for cloning the 6 zinc finger domain of CLAMP: Forward primer 5’-TACGATCATATGTCCGGTAGCGTTAAACAGAGTGTTACCGT-3’ and reverse primer 5’-TACGATCCTGCAGGCTATTACAGACCGCCAATAATAACTTCTT-3’ TTACAGACCGCCAATAATAACTTCTT 5’. .. The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used.

    Amplification:

    Article Title: Affinities between the Binding Partners of the HIV-1 Integrase Dimer-Lens Epithelium-derived Growth Factor (IN Dimer-LEDGF) Complex
    Article Snippet: .. The DNA segment corresponding to IBD-(347–471) was amplified by PCR using pLEDGF-6His as template and subcloned into the NcoI- and HindIII-cloning sites of the pMAL vector (catalogue number E8200S, New England Biolabs, Beverly, MA) that encodes an rTEV protease recognition site at the C terminus of MBP. .. The two PCR primers are as follows: NcoIBD5p , 5′- CCATGGGCTCAATGGATTCTCGAC -3′, and Hind3-IBD3p , 5′- AAGCTT TTATTCCTTCTCTAGCTTTTTG-3′.

    Article Title: Molecular Cloning and Characterization of the Salmonella enterica Serovar Paratyphi B rma Gene, Which Confers Multiple Drug Resistance in Escherichia coli
    Article Snippet: The pMAL protein fusion system (New England BioLabs) was used for expression of the MalE-Rma fusion protein. .. The structural gene of rma was amplified by PCR with Pfu polymerase (Promega) and two oligonucleotide primers whose sequences were specific for regions flanking rma .

    TA Cloning:

    Article Title: Characterization of Mannitol-2-Dehydrogenase in Saccharina japonica: Evidence for a New Polyol-Specific Long-Chain Dehydrogenases/Reductase
    Article Snippet: Recombinant Expression and Purification of SjM2DH pMAL Protein Fusion & Purification System (NEB #E8200S) was applied to perform the prokaryotic expression of SjM2DH in E. coli . .. The target ORF was then subcloned into TA cloning vector pMD 19-T vector and the reconstructed plasmid DNA was extracted with ZYMO Zyppy Plasmid Miniprep Kit.

    Construct:

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: Additionally, for optimal expression amino acids after the zinc fingers that had low-predicted structure (a.a. 528–561) were not include in these constructs. .. The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used.

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: Recombinant LcnB and LcnB∗ Overexpression in E. coli ER2523 and Purification Plasmid constructs with appropriate fragment orientation, designated as pMAL-cX5I (carrying complete coding sequence for LcnB) and pMAL-cX5II (truncated for six amino acids at N terminus) were transformed into E. coli ER2523 competent cells (New England Biolabs). .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom).

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: Expression constructs were produced by inserting relevant full-length coding sequences into a Gateway pDEST-14 expression vector. .. MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions.

    Incubation:

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions. .. For the in vitro binding assay, 35 S-labeled probe proteins were incubated with immobilized MBP-Mage proteins in 500 µl of buffer (20 mM Tris, 100 mM NaCl, 0.5 mM EDTA, 10% glycerol, and 1% Tween-20, pH 7.6) containing 0.25% bovine serum albumin (BSA) and protease inhibitor cocktail overnight at 4°C with end-over-end mixing.

    Activity Assay:

    Article Title: A Gene Encoding an Acyl Hydrolase Is Involved in Leaf Senescence in Arabidopsis
    Article Snippet: .. To determine if SAG101 possessed acyl hydrolase activity, we overexpressed it as a maltose binding protein (MBP)::SAG101 fusion protein ( ) in the proteinase-deficient E. coli strain ER2508 using the pMAL protein fusion system (New England Biolabs, Beverly, MA). .. More than 75% of the SAG101 recombinant proteins were insoluble.

    Expressing:

    Article Title: A juvenile mouse pheromone inhibits sexual behavior through the vomeronasal system
    Article Snippet: Recombinant proteins A gene encoding the secreted form of ESP22 (Ala23-End) was cloned into pMAL-c5x bacterial expression vector (New England Biolabs) using SacI and BamHI restriction sites. .. ESP22 was expressed and purified as a fusion protein with maltose-binding protein (MBP) in BL21(DE3) cells following manufacturer’s protocols (pMAL Protein Fusion & Purification System, New England Biolabs).

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: .. Recombinant Protein Expression Both MBP and MBP+hBT recombinant protein were produced according to the instruction of pMAL Protein Fusion & Purification System (New England BioLabs). ..

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: Paragraph title: Protein expression from E.coli for EMSAs ... The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used.

    Article Title: IPD3 and IPD3L Function Redundantly in Rhizobial and Mycorrhizal Symbioses
    Article Snippet: Expression products were affinity purified via nickel-agarose (Qiagen) under denaturing conditions using 8 M urea. .. Purification of MBP-DMI3, HIS-IPD3, and HIS-IPD3L was performed according to the protocols of E8200 (New England Biolab) and of BioSprint96 (Qiagen).

    Article Title: DELLA proteins are common components of symbiotic rhizobial and mycorrhizal signalling pathways
    Article Snippet: Expression products were affinity purified via nickel-agarose (Qiagen) under the denaturing conditions by using 8 M urea. .. Purification of MBP-CCaMK, HIS-IPD3, HIS-MtDELLA1, HIS-MtDELLA2 and HIS-MtDELLA3 was performed according to the protocol of E8200 (New England Biolabs) and of BioSprint96 (Qiagen), respectively.

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom). .. Purified recombinant LcnB and LcnB∗ bacteriocins were stored at -20°C in CM buffer (20 mmol/L Tris–HCl pH 7.4, 200 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT) containing 50% glycerol.

    Article Title: Characterization of Mannitol-2-Dehydrogenase in Saccharina japonica: Evidence for a New Polyol-Specific Long-Chain Dehydrogenases/Reductase
    Article Snippet: .. Recombinant Expression and Purification of SjM2DH pMAL Protein Fusion & Purification System (NEB #E8200S) was applied to perform the prokaryotic expression of SjM2DH in E. coli . .. The restriction sites of SjM2DH sequence were analyzed with the on-line tool WatCut ( http://watcut.uwaterloo.ca/watcut/watcut/template.php ).

    Article Title: Complement Dependent and Independent Interaction Between Bovine Conglutinin and Mycobacterium bovis BCG: Implications in Bovine Tuberculosis
    Article Snippet: Paragraph title: Expression and Purification of a Truncated Form of Recombinant Bovine Conglutinin (rfBC) ... Commercially available recombinant maltose-binding protein (MBP) (NEB; E8200S) was used a negative control protein.

    Article Title: Affinities between the Binding Partners of the HIV-1 Integrase Dimer-Lens Epithelium-derived Growth Factor (IN Dimer-LEDGF) Complex
    Article Snippet: Paragraph title: Construction of MBP-IBD Expression Vectors ... The DNA segment corresponding to IBD-(347–471) was amplified by PCR using pLEDGF-6His as template and subcloned into the NcoI- and HindIII-cloning sites of the pMAL vector (catalogue number E8200S, New England Biolabs, Beverly, MA) that encodes an rTEV protease recognition site at the C terminus of MBP.

    Article Title: Molecular Cloning and Characterization of the Salmonella enterica Serovar Paratyphi B rma Gene, Which Confers Multiple Drug Resistance in Escherichia coli
    Article Snippet: .. The pMAL protein fusion system (New England BioLabs) was used for expression of the MalE-Rma fusion protein. .. The structural gene of rma was amplified by PCR with Pfu polymerase (Promega) and two oligonucleotide primers whose sequences were specific for regions flanking rma .

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: Expression constructs were produced by inserting relevant full-length coding sequences into a Gateway pDEST-14 expression vector. .. MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions.

    Modification:

    Article Title: Molecular Cloning and Characterization of the Salmonella enterica Serovar Paratyphi B rma Gene, Which Confers Multiple Drug Resistance in Escherichia coli
    Article Snippet: The pMAL protein fusion system (New England BioLabs) was used for expression of the MalE-Rma fusion protein. .. The purified PCR product was ligated to Xmn I-digested vector pMAL-c2X so that the first methionine codon was fused in frame to the C terminus of a modified MalE without the signal peptide.

    Transformation Assay:

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: Recombinant LcnB and LcnB∗ Overexpression in E. coli ER2523 and Purification Plasmid constructs with appropriate fragment orientation, designated as pMAL-cX5I (carrying complete coding sequence for LcnB) and pMAL-cX5II (truncated for six amino acids at N terminus) were transformed into E. coli ER2523 competent cells (New England Biolabs). .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom).

    Over Expression:

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: Paragraph title: Recombinant LcnB and LcnB∗ Overexpression in E. coli ER2523 and Purification ... Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom).

    Flow Cytometry:

    Article Title: Site-specific three-color labeling of α-synuclein via conjugation to uniquely reactive cysteines during assembly by native chemical ligation
    Article Snippet: The general protocol for the pMAL Protein Fusion & Purification System (NEB) was followed. .. The supernatant (~50mL) was loaded onto an amylose resin (NEB, 15mL bed volume) on a self-packed gravity column with flow rate ~5ml/min.

    Serial Dilution:

    Article Title: Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy
    Article Snippet: MBP-IN was purified with pMAL protein fusion purification system (NEB, Ipswich, MA, USA). .. Purity and concentration of HIS-IN and MBP-IN fusion proteins were quantified by serial dilution and PAGE analysis using a BSA standard.

    Zinc-Fingers:

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: Additionally, for optimal expression amino acids after the zinc fingers that had low-predicted structure (a.a. 528–561) were not include in these constructs. .. The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used.

    Sequencing:

    Article Title: A juvenile mouse pheromone inhibits sexual behavior through the vomeronasal system
    Article Snippet: ESP22 was expressed and purified as a fusion protein with maltose-binding protein (MBP) in BL21(DE3) cells following manufacturer’s protocols (pMAL Protein Fusion & Purification System, New England Biolabs). .. The ESP6 coding sequence was subcloned into the expression vector pET-28a (Novagen) and purified as described previously .

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: Recombinant LcnB and LcnB∗ Overexpression in E. coli ER2523 and Purification Plasmid constructs with appropriate fragment orientation, designated as pMAL-cX5I (carrying complete coding sequence for LcnB) and pMAL-cX5II (truncated for six amino acids at N terminus) were transformed into E. coli ER2523 competent cells (New England Biolabs). .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom).

    Article Title: Characterization of Mannitol-2-Dehydrogenase in Saccharina japonica: Evidence for a New Polyol-Specific Long-Chain Dehydrogenases/Reductase
    Article Snippet: Recombinant Expression and Purification of SjM2DH pMAL Protein Fusion & Purification System (NEB #E8200S) was applied to perform the prokaryotic expression of SjM2DH in E. coli . .. The restriction sites of SjM2DH sequence were analyzed with the on-line tool WatCut ( http://watcut.uwaterloo.ca/watcut/watcut/template.php ).

    Sonication:

    Article Title: Site-specific three-color labeling of α-synuclein via conjugation to uniquely reactive cysteines during assembly by native chemical ligation
    Article Snippet: The general protocol for the pMAL Protein Fusion & Purification System (NEB) was followed. .. Briefly, cells were lysed with sonication (Fisher Scientific Sonic Dismembrator Model 500) in lysis buffer (20mM Tris-Cl, 200mM NaCl, 1mM EDTA, 1mM DTT, pH 7.4).

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used. .. Cells were lysed by sonication on ice in a buffer containing 20mM Tris pH 7.5, 90 μM ZnCl2 , 1 mM MgCl2 and 90mM KCl.

    Affinity Purification:

    Article Title: IPD3 and IPD3L Function Redundantly in Rhizobial and Mycorrhizal Symbioses
    Article Snippet: Expression products were affinity purified via nickel-agarose (Qiagen) under denaturing conditions using 8 M urea. .. Purification of MBP-DMI3, HIS-IPD3, and HIS-IPD3L was performed according to the protocols of E8200 (New England Biolab) and of BioSprint96 (Qiagen).

    Article Title: DELLA proteins are common components of symbiotic rhizobial and mycorrhizal signalling pathways
    Article Snippet: Expression products were affinity purified via nickel-agarose (Qiagen) under the denaturing conditions by using 8 M urea. .. Purification of MBP-CCaMK, HIS-IPD3, HIS-MtDELLA1, HIS-MtDELLA2 and HIS-MtDELLA3 was performed according to the protocol of E8200 (New England Biolabs) and of BioSprint96 (Qiagen), respectively.

    Binding Assay:

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: Protein expression from E.coli for EMSAs The pMAL-c5X Vector containing the MBP (Maltose Binding Tag) was used to express MBP fusion CLAMP 6 zinc finger protein using the Nde1 and Sbf1 restriction enzyme sites. .. The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used.

    Article Title: Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy
    Article Snippet: Induction and lysis of maltose binding protein (MBP)-IN followed a similar protocol. .. MBP-IN was purified with pMAL protein fusion purification system (NEB, Ipswich, MA, USA).

    Article Title: Affinities between the Binding Partners of the HIV-1 Integrase Dimer-Lens Epithelium-derived Growth Factor (IN Dimer-LEDGF) Complex
    Article Snippet: Plasmid pMAL-IBD-(347–471)-WT contains the maltose-binding protein fused to the N terminus of the wild-type LEDGF integrase binding domain IBD-(347–471). .. The DNA segment corresponding to IBD-(347–471) was amplified by PCR using pLEDGF-6His as template and subcloned into the NcoI- and HindIII-cloning sites of the pMAL vector (catalogue number E8200S, New England Biolabs, Beverly, MA) that encodes an rTEV protease recognition site at the C terminus of MBP.

    Article Title: A Gene Encoding an Acyl Hydrolase Is Involved in Leaf Senescence in Arabidopsis
    Article Snippet: .. To determine if SAG101 possessed acyl hydrolase activity, we overexpressed it as a maltose binding protein (MBP)::SAG101 fusion protein ( ) in the proteinase-deficient E. coli strain ER2508 using the pMAL protein fusion system (New England Biolabs, Beverly, MA). .. More than 75% of the SAG101 recombinant proteins were insoluble.

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: In vitro Pulldown Assays pMBP-Mage was previously described and the control pMBP construct was supplied with a Maltose binding protein (MBP) purification kit (New England Biolabs, Ipswich, MA). .. MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions.

    Molecular Weight:

    Article Title: Complement Dependent and Independent Interaction Between Bovine Conglutinin and Mycobacterium bovis BCG: Implications in Bovine Tuberculosis
    Article Snippet: This preparation consists of amino acid residues 197–351 of the mature protein and has an expected monomer molecular weight of about 23 kDa ( ). .. Commercially available recombinant maltose-binding protein (MBP) (NEB; E8200S) was used a negative control protein.

    Mutagenesis:

    Article Title: Affinities between the Binding Partners of the HIV-1 Integrase Dimer-Lens Epithelium-derived Growth Factor (IN Dimer-LEDGF) Complex
    Article Snippet: The DNA segment corresponding to IBD-(347–471) was amplified by PCR using pLEDGF-6His as template and subcloned into the NcoI- and HindIII-cloning sites of the pMAL vector (catalogue number E8200S, New England Biolabs, Beverly, MA) that encodes an rTEV protease recognition site at the C terminus of MBP. .. Plasmid pMAL-IBD-(347–471)-2Mut, containing MBP-IBD-(347–471) with the double mutation I365A/D366N, was made by site-directed mutagenesis of pMAL-IBD-(347–471)-WT using the QuikChange® site-directed mutagenesis kit (catalogue number 200519, Stratagene, La Jolla, CA).

    Labeling:

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions. .. 35 S labeled probe proteins were expressed from Gateway pDest14 vectors using the TNT-coupled in vitro transcription-translation system (Promega, Madison, WI).

    Purification:

    Article Title: A juvenile mouse pheromone inhibits sexual behavior through the vomeronasal system
    Article Snippet: .. ESP22 was expressed and purified as a fusion protein with maltose-binding protein (MBP) in BL21(DE3) cells following manufacturer’s protocols (pMAL Protein Fusion & Purification System, New England Biolabs). .. Protein was eluted from an amylose affinity resin using maltose and concentrated using a centrifugal filter unit (Millipore).

    Article Title: Site-specific three-color labeling of α-synuclein via conjugation to uniquely reactive cysteines during assembly by native chemical ligation
    Article Snippet: .. The general protocol for the pMAL Protein Fusion & Purification System (NEB) was followed. .. Briefly, cells were lysed with sonication (Fisher Scientific Sonic Dismembrator Model 500) in lysis buffer (20mM Tris-Cl, 200mM NaCl, 1mM EDTA, 1mM DTT, pH 7.4).

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: .. Recombinant Protein Expression Both MBP and MBP+hBT recombinant protein were produced according to the instruction of pMAL Protein Fusion & Purification System (New England BioLabs). ..

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: .. The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used. .. CLAMP protein was overexpressed in strain E . coli Star (Invitrogen) in LB media containing 50 μg/ml ampicillin and 90 μM ZnCl2 .

    Article Title: IPD3 and IPD3L Function Redundantly in Rhizobial and Mycorrhizal Symbioses
    Article Snippet: .. Purification of MBP-DMI3, HIS-IPD3, and HIS-IPD3L was performed according to the protocols of E8200 (New England Biolab) and of BioSprint96 (Qiagen). .. IPD3 was phosphorylated in vitro by DMI3 as described (Jin et al., ).

    Article Title: DELLA proteins are common components of symbiotic rhizobial and mycorrhizal signalling pathways
    Article Snippet: .. Purification of MBP-CCaMK, HIS-IPD3, HIS-MtDELLA1, HIS-MtDELLA2 and HIS-MtDELLA3 was performed according to the protocol of E8200 (New England Biolabs) and of BioSprint96 (Qiagen), respectively. .. IPD3 was phosphorylated in vitro by CCaMK as described .

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom). .. Purified recombinant LcnB and LcnB∗ bacteriocins were stored at -20°C in CM buffer (20 mmol/L Tris–HCl pH 7.4, 200 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT) containing 50% glycerol.

    Article Title: Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy
    Article Snippet: .. MBP-IN was purified with pMAL protein fusion purification system (NEB, Ipswich, MA, USA). ..

    Article Title: Characterization of Mannitol-2-Dehydrogenase in Saccharina japonica: Evidence for a New Polyol-Specific Long-Chain Dehydrogenases/Reductase
    Article Snippet: .. Recombinant Expression and Purification of SjM2DH pMAL Protein Fusion & Purification System (NEB #E8200S) was applied to perform the prokaryotic expression of SjM2DH in E. coli . .. The restriction sites of SjM2DH sequence were analyzed with the on-line tool WatCut ( http://watcut.uwaterloo.ca/watcut/watcut/template.php ).

    Article Title: Complement Dependent and Independent Interaction Between Bovine Conglutinin and Mycobacterium bovis BCG: Implications in Bovine Tuberculosis
    Article Snippet: Paragraph title: Expression and Purification of a Truncated Form of Recombinant Bovine Conglutinin (rfBC) ... Commercially available recombinant maltose-binding protein (MBP) (NEB; E8200S) was used a negative control protein.

    Article Title: A Gene Encoding an Acyl Hydrolase Is Involved in Leaf Senescence in Arabidopsis
    Article Snippet: To determine if SAG101 possessed acyl hydrolase activity, we overexpressed it as a maltose binding protein (MBP)::SAG101 fusion protein ( ) in the proteinase-deficient E. coli strain ER2508 using the pMAL protein fusion system (New England Biolabs, Beverly, MA). .. The fusion protein was purified by amylose column chromatography.

    Article Title: Molecular Cloning and Characterization of the Salmonella enterica Serovar Paratyphi B rma Gene, Which Confers Multiple Drug Resistance in Escherichia coli
    Article Snippet: Paragraph title: Expression and purification of MalE-Rma fusion protein. ... The pMAL protein fusion system (New England BioLabs) was used for expression of the MalE-Rma fusion protein.

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: In vitro Pulldown Assays pMBP-Mage was previously described and the control pMBP construct was supplied with a Maltose binding protein (MBP) purification kit (New England Biolabs, Ipswich, MA). .. MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions.

    Polymerase Chain Reaction:

    Article Title: Affinities between the Binding Partners of the HIV-1 Integrase Dimer-Lens Epithelium-derived Growth Factor (IN Dimer-LEDGF) Complex
    Article Snippet: .. The DNA segment corresponding to IBD-(347–471) was amplified by PCR using pLEDGF-6His as template and subcloned into the NcoI- and HindIII-cloning sites of the pMAL vector (catalogue number E8200S, New England Biolabs, Beverly, MA) that encodes an rTEV protease recognition site at the C terminus of MBP. .. The two PCR primers are as follows: NcoIBD5p , 5′- CCATGGGCTCAATGGATTCTCGAC -3′, and Hind3-IBD3p , 5′- AAGCTT TTATTCCTTCTCTAGCTTTTTG-3′.

    Article Title: Molecular Cloning and Characterization of the Salmonella enterica Serovar Paratyphi B rma Gene, Which Confers Multiple Drug Resistance in Escherichia coli
    Article Snippet: The pMAL protein fusion system (New England BioLabs) was used for expression of the MalE-Rma fusion protein. .. The structural gene of rma was amplified by PCR with Pfu polymerase (Promega) and two oligonucleotide primers whose sequences were specific for regions flanking rma .

    Positron Emission Tomography:

    Article Title: A juvenile mouse pheromone inhibits sexual behavior through the vomeronasal system
    Article Snippet: ESP22 was expressed and purified as a fusion protein with maltose-binding protein (MBP) in BL21(DE3) cells following manufacturer’s protocols (pMAL Protein Fusion & Purification System, New England Biolabs). .. The ESP6 coding sequence was subcloned into the expression vector pET-28a (Novagen) and purified as described previously .

    Polyacrylamide Gel Electrophoresis:

    Article Title: Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy
    Article Snippet: MBP-IN was purified with pMAL protein fusion purification system (NEB, Ipswich, MA, USA). .. Purity and concentration of HIS-IN and MBP-IN fusion proteins were quantified by serial dilution and PAGE analysis using a BSA standard.

    Lysis:

    Article Title: Site-specific three-color labeling of α-synuclein via conjugation to uniquely reactive cysteines during assembly by native chemical ligation
    Article Snippet: The general protocol for the pMAL Protein Fusion & Purification System (NEB) was followed. .. Briefly, cells were lysed with sonication (Fisher Scientific Sonic Dismembrator Model 500) in lysis buffer (20mM Tris-Cl, 200mM NaCl, 1mM EDTA, 1mM DTT, pH 7.4).

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom). .. Purified recombinant LcnB and LcnB∗ bacteriocins were stored at -20°C in CM buffer (20 mmol/L Tris–HCl pH 7.4, 200 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT) containing 50% glycerol.

    Article Title: Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy
    Article Snippet: Induction and lysis of maltose binding protein (MBP)-IN followed a similar protocol. .. MBP-IN was purified with pMAL protein fusion purification system (NEB, Ipswich, MA, USA).

    Liquid Chromatography:

    Article Title: IPD3 and IPD3L Function Redundantly in Rhizobial and Mycorrhizal Symbioses
    Article Snippet: Purification of MBP-DMI3, HIS-IPD3, and HIS-IPD3L was performed according to the protocols of E8200 (New England Biolab) and of BioSprint96 (Qiagen). .. Mass spectrometric analysis, in-gel digestion of phosphorylated IPD3, liquid chromatography (LC)-MS data acquisition and database searches were performed by Shanghai Applied Protein Technology Co. Ltd ( http://www.aptbiotech.com ).

    Plasmid Preparation:

    Article Title: A juvenile mouse pheromone inhibits sexual behavior through the vomeronasal system
    Article Snippet: Recombinant proteins A gene encoding the secreted form of ESP22 (Ala23-End) was cloned into pMAL-c5x bacterial expression vector (New England Biolabs) using SacI and BamHI restriction sites. .. ESP22 was expressed and purified as a fusion protein with maltose-binding protein (MBP) in BL21(DE3) cells following manufacturer’s protocols (pMAL Protein Fusion & Purification System, New England Biolabs).

    Article Title: Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation
    Article Snippet: Protein expression from E.coli for EMSAs The pMAL-c5X Vector containing the MBP (Maltose Binding Tag) was used to express MBP fusion CLAMP 6 zinc finger protein using the Nde1 and Sbf1 restriction enzyme sites. .. The pMAL protein fusion and purification system from NEB (Catalog # E8200S) was used.

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: Recombinant LcnB and LcnB∗ Overexpression in E. coli ER2523 and Purification Plasmid constructs with appropriate fragment orientation, designated as pMAL-cX5I (carrying complete coding sequence for LcnB) and pMAL-cX5II (truncated for six amino acids at N terminus) were transformed into E. coli ER2523 competent cells (New England Biolabs). .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom).

    Article Title: Characterization of Mannitol-2-Dehydrogenase in Saccharina japonica: Evidence for a New Polyol-Specific Long-Chain Dehydrogenases/Reductase
    Article Snippet: Recombinant Expression and Purification of SjM2DH pMAL Protein Fusion & Purification System (NEB #E8200S) was applied to perform the prokaryotic expression of SjM2DH in E. coli . .. The target ORF was then subcloned into TA cloning vector pMD 19-T vector and the reconstructed plasmid DNA was extracted with ZYMO Zyppy Plasmid Miniprep Kit.

    Article Title: Affinities between the Binding Partners of the HIV-1 Integrase Dimer-Lens Epithelium-derived Growth Factor (IN Dimer-LEDGF) Complex
    Article Snippet: .. The DNA segment corresponding to IBD-(347–471) was amplified by PCR using pLEDGF-6His as template and subcloned into the NcoI- and HindIII-cloning sites of the pMAL vector (catalogue number E8200S, New England Biolabs, Beverly, MA) that encodes an rTEV protease recognition site at the C terminus of MBP. .. The two PCR primers are as follows: NcoIBD5p , 5′- CCATGGGCTCAATGGATTCTCGAC -3′, and Hind3-IBD3p , 5′- AAGCTT TTATTCCTTCTCTAGCTTTTTG-3′.

    Article Title: Molecular Cloning and Characterization of the Salmonella enterica Serovar Paratyphi B rma Gene, Which Confers Multiple Drug Resistance in Escherichia coli
    Article Snippet: The pMAL protein fusion system (New England BioLabs) was used for expression of the MalE-Rma fusion protein. .. The purified PCR product was ligated to Xmn I-digested vector pMAL-c2X so that the first methionine codon was fused in frame to the C terminus of a modified MalE without the signal peptide.

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: Expression constructs were produced by inserting relevant full-length coding sequences into a Gateway pDEST-14 expression vector. .. MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions.

    Negative Control:

    Article Title: Complement Dependent and Independent Interaction Between Bovine Conglutinin and Mycobacterium bovis BCG: Implications in Bovine Tuberculosis
    Article Snippet: .. Commercially available recombinant maltose-binding protein (MBP) (NEB; E8200S) was used a negative control protein. .. Western Blotting Following 12% v/v SDS-PAGE, the gel was equilibrated in blotting buffer (12 mM Tris, 96 mM glycine, 20% methanol, pH 8.3) and transferred, using a Mini Trans-Blot Cell (Bio-Rad), onto a PVDF membrane (Thermo Fisher Scientific).

    Affinity Chromatography:

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom). .. Purified recombinant LcnB and LcnB∗ bacteriocins were stored at -20°C in CM buffer (20 mmol/L Tris–HCl pH 7.4, 200 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT) containing 50% glycerol.

    In Vitro:

    Article Title: IPD3 and IPD3L Function Redundantly in Rhizobial and Mycorrhizal Symbioses
    Article Snippet: Paragraph title: In vitro phosphorylation and mass spectrometric analysis ... Purification of MBP-DMI3, HIS-IPD3, and HIS-IPD3L was performed according to the protocols of E8200 (New England Biolab) and of BioSprint96 (Qiagen).

    Article Title: DELLA proteins are common components of symbiotic rhizobial and mycorrhizal signalling pathways
    Article Snippet: Paragraph title: In vitro phosphorylation ... Purification of MBP-CCaMK, HIS-IPD3, HIS-MtDELLA1, HIS-MtDELLA2 and HIS-MtDELLA3 was performed according to the protocol of E8200 (New England Biolabs) and of BioSprint96 (Qiagen), respectively.

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: Paragraph title: In vitro Pulldown Assays ... MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions.

    Column Chromatography:

    Article Title: A Gene Encoding an Acyl Hydrolase Is Involved in Leaf Senescence in Arabidopsis
    Article Snippet: To determine if SAG101 possessed acyl hydrolase activity, we overexpressed it as a maltose binding protein (MBP)::SAG101 fusion protein ( ) in the proteinase-deficient E. coli strain ER2508 using the pMAL protein fusion system (New England Biolabs, Beverly, MA). .. The fusion protein was purified by amylose column chromatography.

    Produced:

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: .. Recombinant Protein Expression Both MBP and MBP+hBT recombinant protein were produced according to the instruction of pMAL Protein Fusion & Purification System (New England BioLabs). ..

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: Expression constructs were produced by inserting relevant full-length coding sequences into a Gateway pDEST-14 expression vector. .. MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions.

    Concentration Assay:

    Article Title: Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy
    Article Snippet: MBP-IN was purified with pMAL protein fusion purification system (NEB, Ipswich, MA, USA). .. Purity and concentration of HIS-IN and MBP-IN fusion proteins were quantified by serial dilution and PAGE analysis using a BSA standard.

    Liquid Chromatography with Mass Spectroscopy:

    Article Title: IPD3 and IPD3L Function Redundantly in Rhizobial and Mycorrhizal Symbioses
    Article Snippet: Purification of MBP-DMI3, HIS-IPD3, and HIS-IPD3L was performed according to the protocols of E8200 (New England Biolab) and of BioSprint96 (Qiagen). .. Mass spectrometric analysis, in-gel digestion of phosphorylated IPD3, liquid chromatography (LC)-MS data acquisition and database searches were performed by Shanghai Applied Protein Technology Co. Ltd ( http://www.aptbiotech.com ).

    Protease Inhibitor:

    Article Title: The Smc5/Smc6/MAGE Complex Confers Resistance to Caffeine and Genotoxic Stress in Drosophila melanogaster
    Article Snippet: MBP fused Mage (MBP-Mage) was expressed in Escherichia coli (ER2523, New England Biolabs) and immobilized onto amylose resin (E8200S) according to the manufacturer’s directions. .. For the in vitro binding assay, 35 S-labeled probe proteins were incubated with immobilized MBP-Mage proteins in 500 µl of buffer (20 mM Tris, 100 mM NaCl, 0.5 mM EDTA, 10% glycerol, and 1% Tween-20, pH 7.6) containing 0.25% bovine serum albumin (BSA) and protease inhibitor cocktail overnight at 4°C with end-over-end mixing.

    Recombinant:

    Article Title: A juvenile mouse pheromone inhibits sexual behavior through the vomeronasal system
    Article Snippet: Paragraph title: Recombinant proteins ... ESP22 was expressed and purified as a fusion protein with maltose-binding protein (MBP) in BL21(DE3) cells following manufacturer’s protocols (pMAL Protein Fusion & Purification System, New England Biolabs).

    Article Title: Resolving Discrepant Findings on ANGPTL8 in β-Cell Proliferation: A Collaborative Approach to Resolving the Betatrophin Controversy
    Article Snippet: .. Recombinant Protein Expression Both MBP and MBP+hBT recombinant protein were produced according to the instruction of pMAL Protein Fusion & Purification System (New England BioLabs). ..

    Article Title: Lactococcin B Is Inactivated by Intrinsic Proteinase PrtP Digestion in Lactococcus lactis subsp. lactis BGMN1-501
    Article Snippet: .. Expression of recombinant peptides was carried out at 22°C by induction with 0.1 mmol/L isopropyl β-D-1-thiogalactopyranoside (IPTG) for 2 h. Purification (cell lysis, affinity chromatography, cleavage of fusion protein with Xa protease) was performed according to manufacturer’s instructions (pMAL Protein Fusion & Purification System; New England Biolabs, Ltd., United Kingdom). .. Purified recombinant LcnB and LcnB∗ bacteriocins were stored at -20°C in CM buffer (20 mmol/L Tris–HCl pH 7.4, 200 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L DTT) containing 50% glycerol.

    Article Title: Characterization of Mannitol-2-Dehydrogenase in Saccharina japonica: Evidence for a New Polyol-Specific Long-Chain Dehydrogenases/Reductase
    Article Snippet: .. Recombinant Expression and Purification of SjM2DH pMAL Protein Fusion & Purification System (NEB #E8200S) was applied to perform the prokaryotic expression of SjM2DH in E. coli . .. The restriction sites of SjM2DH sequence were analyzed with the on-line tool WatCut ( http://watcut.uwaterloo.ca/watcut/watcut/template.php ).

    Article Title: A Gene Encoding an Acyl Hydrolase Is Involved in Leaf Senescence in Arabidopsis
    Article Snippet: To determine if SAG101 possessed acyl hydrolase activity, we overexpressed it as a maltose binding protein (MBP)::SAG101 fusion protein ( ) in the proteinase-deficient E. coli strain ER2508 using the pMAL protein fusion system (New England Biolabs, Beverly, MA). .. More than 75% of the SAG101 recombinant proteins were insoluble.

    Chick Chorioallantoic Membrane Assay:

    Article Title: IPD3 and IPD3L Function Redundantly in Rhizobial and Mycorrhizal Symbioses
    Article Snippet: Purification of MBP-DMI3, HIS-IPD3, and HIS-IPD3L was performed according to the protocols of E8200 (New England Biolab) and of BioSprint96 (Qiagen). .. Each reaction was carried out with 1 mg MBP-DMI3 protein, 0.2 mM CaCl2 , 0.5 mM bovine CaM, 2 mg 6XHIS-IPD3 as substrate.

    Article Title: DELLA proteins are common components of symbiotic rhizobial and mycorrhizal signalling pathways
    Article Snippet: Purification of MBP-CCaMK, HIS-IPD3, HIS-MtDELLA1, HIS-MtDELLA2 and HIS-MtDELLA3 was performed according to the protocol of E8200 (New England Biolabs) and of BioSprint96 (Qiagen), respectively. .. Each reaction was carried out by using 1 μg MBP-CCaMK protein, 0.2 mM CaCl2 , 0.5 μM Bovine CaM, 2 μg full length and 6 × HIS-IPD3 as substrate.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs pmal protein fusion
    Pmal Protein Fusion, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmal protein fusion/product/New England Biolabs
    Average 95 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    pmal protein fusion - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results