illumina compatible adaptors  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    NEBNext Multiplex Oligos for Illumina Index Primers Set 1
    Description:
    NEBNext Multiplex Oligos for Illumina Index Primers Set 1 96 rxns
    Catalog Number:
    e7335l
    Price:
    385
    Size:
    96 rxns
    Category:
    Probes and Primers
    Buy from Supplier


    Structured Review

    New England Biolabs illumina compatible adaptors
    NEBNext Multiplex Oligos for Illumina Index Primers Set 1
    NEBNext Multiplex Oligos for Illumina Index Primers Set 1 96 rxns
    https://www.bioz.com/result/illumina compatible adaptors/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    illumina compatible adaptors - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step. .. Ten PCR reactions (98 °C for 45 seconds (s); followed by 10 cycles of 98 °C for 15 s, 65 °C for 30 s, 72 °C for 10 s) with 1 µl adaptor ligated DNA as template were performed, using KAPA Hifi Hot Start Ready Mix (KAPA Biosystems; cat. no. KK2602) and primers (fw: TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT and rev: GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), which add a specific 15-nt extension to both adapters for directional cloning using recombination (Clontech In-Fusion HD; cat. no. 639650).

    Amplification:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step. .. Ten PCR reactions (98 °C for 45 seconds (s); followed by 10 cycles of 98 °C for 15 s, 65 °C for 30 s, 72 °C for 10 s) with 1 µl adaptor ligated DNA as template were performed, using KAPA Hifi Hot Start Ready Mix (KAPA Biosystems; cat. no. KK2602) and primers (fw: TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT and rev: GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), which add a specific 15-nt extension to both adapters for directional cloning using recombination (Clontech In-Fusion HD; cat. no. 639650).

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added. .. Following a 72h hybridisation step a streptavidin bead pull down (Invitrogen M270) was performed followed by multiple bead washes (Nimblegen SeqCap EZ) and PCR amplification of the captured material (Kappa / Nimblegen SeqCap EZ accessory kit v2).

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing. .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Article Title: Transcription-induced formation of extrachromosomal DNA during yeast ageing
    Article Snippet: After addition of 1.25 μl 1:25 diluted NEBNext adaptor (E7335), 0.5 μl ligation enhancer and 15 μl NEBNext Ultra II ligation mix (E7103) samples were incubated 15 minutes at 20°C, then 1.5 μl USER enzyme (E7335) was added and incubated 15 minutes at 37°C. .. A total of 1.25 μl library was amplified with 0.4 μl each NEBNext index and universal primers (E7335) and 5μl NEBNext Ultra II PCR mix (E7103) in 10 μl total volume using recommended cycling conditions with 8 cycles for total samples, 16 cycles for 48 hour aged samples and 18 cycles for 24 hour samples.

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.). .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Expressing:

    Article Title: The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation
    Article Snippet: High-throughput sequencing The poly(A)-containing mRNAs were enriched using Dynabeads (61006; Invitrogen), and RNA-Seq libraries were prepared using NEBNext mRNA Library Prep kits (E6110, E7335; NEB). .. Data normalization and differential gene expression analysis were performed using the DESeq2 package in R. Gene ontology enrichment and principal component analysis (PCA) were performed using DAVID ( https://david.ncifcrf.gov/ ) and R, respectively.

    Picogreen Assay:

    Article Title: GATA2/3-TFAP2A/C transcription factor network couples human pluripotent stem cell differentiation to trophectoderm with repression of pluripotency
    Article Snippet: Purified DNA fragments were prepared for sequencing using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (E6200L; New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (E7335S; New England Biolabs) according to manufacturer’s instructions using 15 cycles of enrichment PCR. .. Library size was determined using the High Sensitivity DNA Analysis kit on a 2100 Bioanalyzer instrument, and concentration was measured with Quant-iT PicoGreen dsDNA Assay kit (P7589; Life Technologies).

    Construct:

    Article Title: Analysis of the microbiome: Advantages of whole genome shotgun versus 16S amplicon sequencing
    Article Snippet: .. In total, 11 libraries were constructed with unique indexes using the NEBNext Multiplex Oligos for Illumina Set 1 (Catalogue # E7335L, NewEngland BioLabs Inc). .. For sequencing on a HiSeq 2000 the library was prepared using the same fecal metagenomic DNA using the described procedures.

    Incubation:

    Article Title: Transcription-induced formation of extrachromosomal DNA during yeast ageing
    Article Snippet: .. After addition of 1.25 μl 1:25 diluted NEBNext adaptor (E7335), 0.5 μl ligation enhancer and 15 μl NEBNext Ultra II ligation mix (E7103) samples were incubated 15 minutes at 20°C, then 1.5 μl USER enzyme (E7335) was added and incubated 15 minutes at 37°C. .. Samples were cleaned with 44 μl AMPure beads, eluted with 30 μl 0.1x TE, then cleaned again with 27 μl AMPure beads and eluted with 22.5 μl 0.1x TE.

    Mass Spectrometry:

    Article Title: High-Throughput Genotyping of CRISPR/Cas Edited Cells in 96-Well Plates
    Article Snippet: .. Reagents and Materials Fetal bovine serum, FBS (Thermo Fisher, Paisley, UK; Cat. no.: 10270-106) Dimethyl sulphoxide, DMSO (VWR, Lutterworth, UK; Cat. no.: 23500.260) 96-well V-bottomed plates (Sigma-Aldrich, Dorset, UK; Cat. no.: CLS3894) Parafilm (VWR, Lutterworth, UK; Cat. no.: PM-996) 96-well PCR plate (Thermo Fisher; Cat. no.: AB1400L) Tris, 1 M, pH 8.0 (Thermo Fisher; Cat. no.: AM9855G) Ethylenediaminetetraacetic acid (EDTA), 0.5 mM, pH 8.0 (Thermo Fisher; Cat. no.: 15575-038) Tween 20, 50% (Thermo Fisher; Cat. no.: 003005) PCR grade water (Thermo Fisher; Cat. no.: AM9932) DNA low bind tubes (Eppendorf, Arlington, UK; Cat. no.: Z666548) Proteinase K (Thermo Fisher; Cat. no.: EO0491) Platinum PCR master mix (Thermo Fisher; Cat. no.: 12532016) Locus specific primers, 10 µM mix, see (Sigma, St Louis, MO, USA or Integrated DNA Technologies (IDT), Skokie, Illinois, USA) Agarose (Roche, Burgess Hill, UK; Cat. no.: 11388983001) 10× Tris acetate-EDTA, TAE (Sigma-Aldrich; Cat. no.: 11666690001) 100 bp ladder (New England Biolabs, Hitchin, UK; Cat. no.: N0551G) Exonuclease I, Escherichia coli (New England Biolabs; Cat. no: M0293L) Shrimp alkaline phospatase, rSAP (New England Biolabs, Hitchin, UK; Cat. no.: M0371L) Custom iR5 and iC7 barcoded primers, (Sigma or IDT) Agencourt Ampure XP SPRI Beads (Beckman Coulter, High Wycombe, UK; Cat. no.: A63881) 100% Ethanol (VWR, Lutterworth, UK; Cat. no.: 20821.330) Qubit BR DNA assay kit (Thermo Fisher; Cat. no.: Q32850) NEB Ultra II (New England Biolabs; Cat. no.: 7645S/L) PCR Tube (Appleton Woods, Birmingham, UK; Cat. no.: TA571) NEB Next Multiplex Oligos for Illumina primer set 1 (New England Biolabs; Cat. no.: E7500S/L) NEB Next Multiplex Oligos for Illumina primer set 2 (New England Biolabs; Cat. no.: E7335S/L) Herculase II Fusion polymerase kit (Agilent, Cheadle, UK; Cat. no.: 600677) Tris-EDTA, TE (Sigma-Aldrich; Cat. no.: 99302) D1000 reagents (Agilent; Cat. no.: 50675583) D1000 loading tips (Agilent; Cat. no.: 50675153) D1000 screen tape (Agilent; Cat. no.: 50675582) KAPA Library Quantification Complete Kit (Roche; Cat. no.: KK4824) MiSeq Reagent Nano Kit, v2 500-Cycles (Illumina, Cambridge, UK; Cat. no.: MS-103-1003) PhiX Control v3 (Illumina; Cat. no.: FC-110-3001) .. Equipment 8- or 12-channel pipette (Labgene Scientific, Châtel-Saint-Denis, Switzerland: Cat. no.: 5121, 5125) Centrifuge with buckets for plates (Eppendorf; Cat. no.: 5810R) Thermocycler with 96-well plate capacity (Bio-Rad, Watford, UK; Cat. no.: T100) Electrophoresis gel tank and power pack Magnetic rack (DynaMag-2; Thermo Fisher; Cat. no.: 13221) Minifuge (Starlab, Milton Keynes, UK; Cat. no.: N2631-0007) Qubit fluorometer (Thermo Fisher; Cat. no.: Q33226) Agilent 2200 TapeStation (Agilent; Cat. no.: G2964AA) Real-time quantitative polymerase chain reaction (qPCR) thermocycler (Thermo Fisher StepOnePlus; Thermo Fisher; Cat. no.: 4376598) MiSeq (Illumina; Cat. no.: SY-410-1003) Microcentrifuge (Eppendorf; Cat. no.: 5424R)

    Genome Wide:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: Genomic DNA (genome-wide libraries) or BAC DNA (focused libraries; ) was isolated as described previously , . .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step.

    Hybridization:

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added. .. The first hybridisation reaction was scaled up relative to the number of samples included in the reaction to maintain library complexity (Nimblegen Roch SeqCap EZ).

    Article Title: The prostate cancer risk variant rs55958994 regulates multiple gene expression through extreme long-range chromatin interaction to control tumor progression
    Article Snippet: The precapture DNA libraries were prepared using the NEBNext DNA Library Kit according to the manufacturer’s instructions (E6040, E7335, and E7500; New England BioLabs). .. The biotinylated probes and streptavidin beads (Invitrogen) were used to enrich the bait and its linked chromatin loci by two rounds of hybridization-capture approach.

    Ligation:

    Article Title: Whole Genome Next Generation Sequencing Mutation Identification in Pseudomonas aeruginosa
    Article Snippet: However, one potential problem that we encountered is worth noting: Users of NEB kit (E7645) have to choose the correct primer set ( e.g. , E7335) and mix the primers correctly to successfully amplify the adaptor-ligated fragments (Step 27 in this protocol and Section 4.1 in the NEB online protocol for E7645). .. In addition, ligation adaptors and USER enzymes are provided in the E7335 kit (and/or other primer sets) but not the E7645 kit.

    Article Title: Transcription-induced formation of extrachromosomal DNA during yeast ageing
    Article Snippet: .. After addition of 1.25 μl 1:25 diluted NEBNext adaptor (E7335), 0.5 μl ligation enhancer and 15 μl NEBNext Ultra II ligation mix (E7103) samples were incubated 15 minutes at 20°C, then 1.5 μl USER enzyme (E7335) was added and incubated 15 minutes at 37°C. .. Samples were cleaned with 44 μl AMPure beads, eluted with 30 μl 0.1x TE, then cleaned again with 27 μl AMPure beads and eluted with 22.5 μl 0.1x TE.

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: Subsequent adaptor ligation of the dA-tailed DNA was performed with 1.5 μM NEBNext adaptor primers, Quick Ligation reaction buffer, and Quick T4 DNA ligase. .. AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.).

    Capture-C:

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: Paragraph title: Analysis of Chromatin Landscape by NG Capture-C ... Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added.

    Article Title: The prostate cancer risk variant rs55958994 regulates multiple gene expression through extreme long-range chromatin interaction to control tumor progression
    Article Snippet: Capture chromosome conformation capture Capture-C was performed, as previously described ( ). .. The precapture DNA libraries were prepared using the NEBNext DNA Library Kit according to the manufacturer’s instructions (E6040, E7335, and E7500; New England BioLabs).

    Sequencing:

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: .. Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added. .. Samples were indexed, allowing multiple samples to be pooled prior to oligonucleotide capture using biotinylated DNA oligonucleotides designed for the Hba-a1 & 2, Hbb-b1 & 2 and Slc25A37 promoters (Sigma).

    Article Title: N6-Methyladenosine Landscape of Glioma Stem-Like Cells: METTL3 Is Essential for the Expression of Actively Transcribed Genes and Sustenance of the Oncogenic Signaling
    Article Snippet: Paragraph title: 2.5. m6 A RNA Immunoprecipitation Sequencing ... Index primers of NEBNext Multiplex oligonucleotides for Illumina (Index Primers Set 1) were used (E7335S, NEB).

    Article Title: Histone acetylation orchestrates wound-induced transcriptional activation and cellular reprogramming in Arabidopsis
    Article Snippet: Paragraph title: ChIP sequencing and data analysis ... Libraries were prepared using the KAPA Hyper Prep Kit for Illumina (KK8502, KAPA Biosystems) and Illumina compatible adaptors (E7335, E7500, E7710, E7730, NEB).

    Article Title: The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation
    Article Snippet: .. High-throughput sequencing The poly(A)-containing mRNAs were enriched using Dynabeads (61006; Invitrogen), and RNA-Seq libraries were prepared using NEBNext mRNA Library Prep kits (E6110, E7335; NEB). .. Sequencing was performed at MGH next generation sequencing core.

    Article Title: The prostate cancer risk variant rs55958994 regulates multiple gene expression through extreme long-range chromatin interaction to control tumor progression
    Article Snippet: Two biotinylated DNA oligonucleotides were designed for both ends of the region containing the rs55958994 SNP, with the following sequence. (5′ to 3′): Biotin-gatctaggcagcacaaggagcaaaaaaacagcaccccaaagcctttcctgaaattccagtcccctccaccccacctttctggttccct. .. The precapture DNA libraries were prepared using the NEBNext DNA Library Kit according to the manufacturer’s instructions (E6040, E7335, and E7500; New England BioLabs).

    Article Title: Analysis of the microbiome: Advantages of whole genome shotgun versus 16S amplicon sequencing
    Article Snippet: One microgram fragmented metagenomic DNA was end-repaired and 3′-adenylated, ligated with Illumina adapters, and PCR enriched with Illumina sequencing indexes (barcodes) using the NEBNext Ultra DNA library prep kit for Illumina (Catalogue # E7370L,New England BioLabs Inc). .. In total, 11 libraries were constructed with unique indexes using the NEBNext Multiplex Oligos for Illumina Set 1 (Catalogue # E7335L, NewEngland BioLabs Inc).

    Article Title: GATA2/3-TFAP2A/C transcription factor network couples human pluripotent stem cell differentiation to trophectoderm with repression of pluripotency
    Article Snippet: .. Purified DNA fragments were prepared for sequencing using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (E6200L; New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (E7335S; New England Biolabs) according to manufacturer’s instructions using 15 cycles of enrichment PCR. .. Library size was determined using the High Sensitivity DNA Analysis kit on a 2100 Bioanalyzer instrument, and concentration was measured with Quant-iT PicoGreen dsDNA Assay kit (P7589; Life Technologies).

    Sonication:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: The DNA was sheared by sonication (Covaris S220) and DNA fragments (100- to 250-bp length) were size-selected using a 1% agarose gel. .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step.

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: .. Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added. .. Samples were indexed, allowing multiple samples to be pooled prior to oligonucleotide capture using biotinylated DNA oligonucleotides designed for the Hba-a1 & 2, Hbb-b1 & 2 and Slc25A37 promoters (Sigma).

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: Chromatin immunoprecipitation-sequencing (ChIP-seq) Non-stimulated (NS) and PMA stimulated (ST) MCF-7 cells were fixed with paraformaldehyde (1%) for 10 min at room temperature and lysed with the Upstate ChIP kit and sonication according to the manufacturer's instructions. .. The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing.

    Article Title: The prostate cancer risk variant rs55958994 regulates multiple gene expression through extreme long-range chromatin interaction to control tumor progression
    Article Snippet: The purified 3C library DNA was then sheared to 200- to 300-bp fragments using sonication. .. The precapture DNA libraries were prepared using the NEBNext DNA Library Kit according to the manufacturer’s instructions (E6040, E7335, and E7500; New England BioLabs).

    Hi-C:

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: 3C libraries were made using standard methods similar to the protocol for in situ Hi-C. .. Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added.

    ChIP-sequencing:

    Article Title: Histone acetylation orchestrates wound-induced transcriptional activation and cellular reprogramming in Arabidopsis
    Article Snippet: The isolated DNA was quantified with the Qubit dsDNA High Sensitivity Assay kit (Thermo Fisher Scientific), and 1–5 ng of DNA was used to make each ChIP-seq library. .. Libraries were prepared using the KAPA Hyper Prep Kit for Illumina (KK8502, KAPA Biosystems) and Illumina compatible adaptors (E7335, E7500, E7710, E7730, NEB).

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: Paragraph title: Chromatin immunoprecipitation-sequencing (ChIP-seq) ... The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing.

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: Paragraph title: ChIP-seq. ... AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.).

    Article Title: GATA2/3-TFAP2A/C transcription factor network couples human pluripotent stem cell differentiation to trophectoderm with repression of pluripotency
    Article Snippet: .. Purified DNA fragments were prepared for sequencing using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (E6200L; New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (E7335S; New England Biolabs) according to manufacturer’s instructions using 15 cycles of enrichment PCR. .. Library size was determined using the High Sensitivity DNA Analysis kit on a 2100 Bioanalyzer instrument, and concentration was measured with Quant-iT PicoGreen dsDNA Assay kit (P7589; Life Technologies).

    Multiplexing:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step. .. Ten PCR reactions (98 °C for 45 seconds (s); followed by 10 cycles of 98 °C for 15 s, 65 °C for 30 s, 72 °C for 10 s) with 1 µl adaptor ligated DNA as template were performed, using KAPA Hifi Hot Start Ready Mix (KAPA Biosystems; cat. no. KK2602) and primers (fw: TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT and rev: GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), which add a specific 15-nt extension to both adapters for directional cloning using recombination (Clontech In-Fusion HD; cat. no. 639650).

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: .. The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing. .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: .. AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.). .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    RNA Sequencing Assay:

    Article Title: The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation
    Article Snippet: .. High-throughput sequencing The poly(A)-containing mRNAs were enriched using Dynabeads (61006; Invitrogen), and RNA-Seq libraries were prepared using NEBNext mRNA Library Prep kits (E6110, E7335; NEB). .. Sequencing was performed at MGH next generation sequencing core.

    Article Title: Multisystem Analysis of Mycobacterium tuberculosis Reveals Kinase-Dependent Remodeling of the Pathogen-Environment Interface
    Article Snippet: Paragraph title: RNA extraction, RNA-Seq, and transcriptomic analysis. ... The cDNA library was prepared using a NEBNext Ultra Directional RNA Library Prep kit for Illumina (New England Biolabs catalog no. E7420S), NEBNext multiplex oligonucleotides for Illumina (index primers set 1) (New England Biolabs catalog no. E7335S), and NEBNext multiplex oligonucleotides for Illumina (index primers set 2) (New England Biolabs catalog no. E7500S) according to the manufacturer’s instructions.

    BAC Assay:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: Genomic DNA (genome-wide libraries) or BAC DNA (focused libraries; ) was isolated as described previously , . .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step.

    Sensitive Assay:

    Article Title: Histone acetylation orchestrates wound-induced transcriptional activation and cellular reprogramming in Arabidopsis
    Article Snippet: The isolated DNA was quantified with the Qubit dsDNA High Sensitivity Assay kit (Thermo Fisher Scientific), and 1–5 ng of DNA was used to make each ChIP-seq library. .. Libraries were prepared using the KAPA Hyper Prep Kit for Illumina (KK8502, KAPA Biosystems) and Illumina compatible adaptors (E7335, E7500, E7710, E7730, NEB).

    Magnetic Beads:

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: Lysates were immunoprecipitated with anti-PKC-θ (5 μg, sc-212, Santa Cruz) and Protein A magnetic beads (Millipore). .. The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing.

    Isolation:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: Genomic DNA (genome-wide libraries) or BAC DNA (focused libraries; ) was isolated as described previously , . .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step.

    Article Title: Histone acetylation orchestrates wound-induced transcriptional activation and cellular reprogramming in Arabidopsis
    Article Snippet: The isolated DNA was quantified with the Qubit dsDNA High Sensitivity Assay kit (Thermo Fisher Scientific), and 1–5 ng of DNA was used to make each ChIP-seq library. .. Libraries were prepared using the KAPA Hyper Prep Kit for Illumina (KK8502, KAPA Biosystems) and Illumina compatible adaptors (E7335, E7500, E7710, E7730, NEB).

    Article Title: Characterization of innate immunity genes in the parasitic nematode Brugia malayi
    Article Snippet: .. B. malayi mRNA was isolated using theNEBNext Poly(A) mRNA Magnetic Isolation Module (Cat. #E7490, New England Biolabs) and transcriptomic libraries were prepared using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Cat. #E7530, New England Biolabs) and the NEBNext® Multiplex Oligos for Illumina (Index Primers 1–12) (Cat. # E7335, New England Biolabs) following the kit protocol. .. Library quality and concentration was assessed using a DNA high sensitivity chip on a Bioanalyzer 2100.

    Multiplex Assay:

    Article Title: High-Throughput Genotyping of CRISPR/Cas Edited Cells in 96-Well Plates
    Article Snippet: .. Reagents and Materials Fetal bovine serum, FBS (Thermo Fisher, Paisley, UK; Cat. no.: 10270-106) Dimethyl sulphoxide, DMSO (VWR, Lutterworth, UK; Cat. no.: 23500.260) 96-well V-bottomed plates (Sigma-Aldrich, Dorset, UK; Cat. no.: CLS3894) Parafilm (VWR, Lutterworth, UK; Cat. no.: PM-996) 96-well PCR plate (Thermo Fisher; Cat. no.: AB1400L) Tris, 1 M, pH 8.0 (Thermo Fisher; Cat. no.: AM9855G) Ethylenediaminetetraacetic acid (EDTA), 0.5 mM, pH 8.0 (Thermo Fisher; Cat. no.: 15575-038) Tween 20, 50% (Thermo Fisher; Cat. no.: 003005) PCR grade water (Thermo Fisher; Cat. no.: AM9932) DNA low bind tubes (Eppendorf, Arlington, UK; Cat. no.: Z666548) Proteinase K (Thermo Fisher; Cat. no.: EO0491) Platinum PCR master mix (Thermo Fisher; Cat. no.: 12532016) Locus specific primers, 10 µM mix, see (Sigma, St Louis, MO, USA or Integrated DNA Technologies (IDT), Skokie, Illinois, USA) Agarose (Roche, Burgess Hill, UK; Cat. no.: 11388983001) 10× Tris acetate-EDTA, TAE (Sigma-Aldrich; Cat. no.: 11666690001) 100 bp ladder (New England Biolabs, Hitchin, UK; Cat. no.: N0551G) Exonuclease I, Escherichia coli (New England Biolabs; Cat. no: M0293L) Shrimp alkaline phospatase, rSAP (New England Biolabs, Hitchin, UK; Cat. no.: M0371L) Custom iR5 and iC7 barcoded primers, (Sigma or IDT) Agencourt Ampure XP SPRI Beads (Beckman Coulter, High Wycombe, UK; Cat. no.: A63881) 100% Ethanol (VWR, Lutterworth, UK; Cat. no.: 20821.330) Qubit BR DNA assay kit (Thermo Fisher; Cat. no.: Q32850) NEB Ultra II (New England Biolabs; Cat. no.: 7645S/L) PCR Tube (Appleton Woods, Birmingham, UK; Cat. no.: TA571) NEB Next Multiplex Oligos for Illumina primer set 1 (New England Biolabs; Cat. no.: E7500S/L) NEB Next Multiplex Oligos for Illumina primer set 2 (New England Biolabs; Cat. no.: E7335S/L) Herculase II Fusion polymerase kit (Agilent, Cheadle, UK; Cat. no.: 600677) Tris-EDTA, TE (Sigma-Aldrich; Cat. no.: 99302) D1000 reagents (Agilent; Cat. no.: 50675583) D1000 loading tips (Agilent; Cat. no.: 50675153) D1000 screen tape (Agilent; Cat. no.: 50675582) KAPA Library Quantification Complete Kit (Roche; Cat. no.: KK4824) MiSeq Reagent Nano Kit, v2 500-Cycles (Illumina, Cambridge, UK; Cat. no.: MS-103-1003) PhiX Control v3 (Illumina; Cat. no.: FC-110-3001) .. Equipment 8- or 12-channel pipette (Labgene Scientific, Châtel-Saint-Denis, Switzerland: Cat. no.: 5121, 5125) Centrifuge with buckets for plates (Eppendorf; Cat. no.: 5810R) Thermocycler with 96-well plate capacity (Bio-Rad, Watford, UK; Cat. no.: T100) Electrophoresis gel tank and power pack Magnetic rack (DynaMag-2; Thermo Fisher; Cat. no.: 13221) Minifuge (Starlab, Milton Keynes, UK; Cat. no.: N2631-0007) Qubit fluorometer (Thermo Fisher; Cat. no.: Q33226) Agilent 2200 TapeStation (Agilent; Cat. no.: G2964AA) Real-time quantitative polymerase chain reaction (qPCR) thermocycler (Thermo Fisher StepOnePlus; Thermo Fisher; Cat. no.: 4376598) MiSeq (Illumina; Cat. no.: SY-410-1003) Microcentrifuge (Eppendorf; Cat. no.: 5424R)

    Article Title: N6-Methyladenosine Landscape of Glioma Stem-Like Cells: METTL3 Is Essential for the Expression of Actively Transcribed Genes and Sustenance of the Oncogenic Signaling
    Article Snippet: .. Index primers of NEBNext Multiplex oligonucleotides for Illumina (Index Primers Set 1) were used (E7335S, NEB). .. The final PCR enrichment of adaptor-ligated libraries was performed in 12 cycles.

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: .. The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing. .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: .. AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.). .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Article Title: Multisystem Analysis of Mycobacterium tuberculosis Reveals Kinase-Dependent Remodeling of the Pathogen-Environment Interface
    Article Snippet: .. The cDNA library was prepared using a NEBNext Ultra Directional RNA Library Prep kit for Illumina (New England Biolabs catalog no. E7420S), NEBNext multiplex oligonucleotides for Illumina (index primers set 1) (New England Biolabs catalog no. E7335S), and NEBNext multiplex oligonucleotides for Illumina (index primers set 2) (New England Biolabs catalog no. E7500S) according to the manufacturer’s instructions. .. The quantity and the quality of cDNA library were determined by Bioanalyzer analysis.

    Article Title: Characterization of innate immunity genes in the parasitic nematode Brugia malayi
    Article Snippet: .. B. malayi mRNA was isolated using theNEBNext Poly(A) mRNA Magnetic Isolation Module (Cat. #E7490, New England Biolabs) and transcriptomic libraries were prepared using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Cat. #E7530, New England Biolabs) and the NEBNext® Multiplex Oligos for Illumina (Index Primers 1–12) (Cat. # E7335, New England Biolabs) following the kit protocol. .. Library quality and concentration was assessed using a DNA high sensitivity chip on a Bioanalyzer 2100.

    Article Title: Analysis of the microbiome: Advantages of whole genome shotgun versus 16S amplicon sequencing
    Article Snippet: .. In total, 11 libraries were constructed with unique indexes using the NEBNext Multiplex Oligos for Illumina Set 1 (Catalogue # E7335L, NewEngland BioLabs Inc). .. For sequencing on a HiSeq 2000 the library was prepared using the same fecal metagenomic DNA using the described procedures.

    Article Title: GATA2/3-TFAP2A/C transcription factor network couples human pluripotent stem cell differentiation to trophectoderm with repression of pluripotency
    Article Snippet: .. Purified DNA fragments were prepared for sequencing using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (E6200L; New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (E7335S; New England Biolabs) according to manufacturer’s instructions using 15 cycles of enrichment PCR. .. Library size was determined using the High Sensitivity DNA Analysis kit on a 2100 Bioanalyzer instrument, and concentration was measured with Quant-iT PicoGreen dsDNA Assay kit (P7589; Life Technologies).

    Purification:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step. .. Each five PCR reactions were pooled, purified, and size selected with Agencourt AMPureXP DNA beads (ratio beads/PCR 1.25; cat. no. ), followed by column purification (QIAquick PCR purification kit; cat. no.

    Article Title: N6-Methyladenosine Landscape of Glioma Stem-Like Cells: METTL3 Is Essential for the Expression of Actively Transcribed Genes and Sustenance of the Oncogenic Signaling
    Article Snippet: The fragmentation step was omitted and the fragments were purified using QIAQuick column (#28104, Qiagen, Hilden, Germany) after second-strand synthesis. .. Index primers of NEBNext Multiplex oligonucleotides for Illumina (Index Primers Set 1) were used (E7335S, NEB).

    Article Title: Transcription-induced formation of extrachromosomal DNA during yeast ageing
    Article Snippet: Exonuclease treated and total DNA samples were incubated at 37°C for 45 minutes with 2 μl NEBNext DNA fragmentase (M0348) and 2 μl fragmentase buffer; then 5 μl 0.5 M EDTA was added followed by 25 μl water, and samples were purified using 50 μl AMPure beads (A63881 Beckman Coulter, UK) and eluted with 25.5 μl 0.1x TE. .. After addition of 1.25 μl 1:25 diluted NEBNext adaptor (E7335), 0.5 μl ligation enhancer and 15 μl NEBNext Ultra II ligation mix (E7103) samples were incubated 15 minutes at 20°C, then 1.5 μl USER enzyme (E7335) was added and incubated 15 minutes at 37°C.

    Article Title: The prostate cancer risk variant rs55958994 regulates multiple gene expression through extreme long-range chromatin interaction to control tumor progression
    Article Snippet: The purified 3C library DNA was then sheared to 200- to 300-bp fragments using sonication. .. The precapture DNA libraries were prepared using the NEBNext DNA Library Kit according to the manufacturer’s instructions (E6040, E7335, and E7500; New England BioLabs).

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: .. AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.). .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Article Title: Characterization of innate immunity genes in the parasitic nematode Brugia malayi
    Article Snippet: Extracted RNA was then treated with DNase I (Cat. #AM1907, Ambion) and purified using RNA Clean & Concentrator™ -5 according to the manufacturer’s protocol (Cat. #R1013, Zymo Research). .. B. malayi mRNA was isolated using theNEBNext Poly(A) mRNA Magnetic Isolation Module (Cat. #E7490, New England Biolabs) and transcriptomic libraries were prepared using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Cat. #E7530, New England Biolabs) and the NEBNext® Multiplex Oligos for Illumina (Index Primers 1–12) (Cat. # E7335, New England Biolabs) following the kit protocol.

    Article Title: Analysis of the microbiome: Advantages of whole genome shotgun versus 16S amplicon sequencing
    Article Snippet: The sheared DNA was processed with a QIAquick PCR purification kit (Qiagen) and eluted in nuclease free water. .. In total, 11 libraries were constructed with unique indexes using the NEBNext Multiplex Oligos for Illumina Set 1 (Catalogue # E7335L, NewEngland BioLabs Inc).

    Article Title: GATA2/3-TFAP2A/C transcription factor network couples human pluripotent stem cell differentiation to trophectoderm with repression of pluripotency
    Article Snippet: .. Purified DNA fragments were prepared for sequencing using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (E6200L; New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (E7335S; New England Biolabs) according to manufacturer’s instructions using 15 cycles of enrichment PCR. .. Library size was determined using the High Sensitivity DNA Analysis kit on a 2100 Bioanalyzer instrument, and concentration was measured with Quant-iT PicoGreen dsDNA Assay kit (P7589; Life Technologies).

    Polymerase Chain Reaction:

    Article Title: High-Throughput Genotyping of CRISPR/Cas Edited Cells in 96-Well Plates
    Article Snippet: .. Reagents and Materials Fetal bovine serum, FBS (Thermo Fisher, Paisley, UK; Cat. no.: 10270-106) Dimethyl sulphoxide, DMSO (VWR, Lutterworth, UK; Cat. no.: 23500.260) 96-well V-bottomed plates (Sigma-Aldrich, Dorset, UK; Cat. no.: CLS3894) Parafilm (VWR, Lutterworth, UK; Cat. no.: PM-996) 96-well PCR plate (Thermo Fisher; Cat. no.: AB1400L) Tris, 1 M, pH 8.0 (Thermo Fisher; Cat. no.: AM9855G) Ethylenediaminetetraacetic acid (EDTA), 0.5 mM, pH 8.0 (Thermo Fisher; Cat. no.: 15575-038) Tween 20, 50% (Thermo Fisher; Cat. no.: 003005) PCR grade water (Thermo Fisher; Cat. no.: AM9932) DNA low bind tubes (Eppendorf, Arlington, UK; Cat. no.: Z666548) Proteinase K (Thermo Fisher; Cat. no.: EO0491) Platinum PCR master mix (Thermo Fisher; Cat. no.: 12532016) Locus specific primers, 10 µM mix, see (Sigma, St Louis, MO, USA or Integrated DNA Technologies (IDT), Skokie, Illinois, USA) Agarose (Roche, Burgess Hill, UK; Cat. no.: 11388983001) 10× Tris acetate-EDTA, TAE (Sigma-Aldrich; Cat. no.: 11666690001) 100 bp ladder (New England Biolabs, Hitchin, UK; Cat. no.: N0551G) Exonuclease I, Escherichia coli (New England Biolabs; Cat. no: M0293L) Shrimp alkaline phospatase, rSAP (New England Biolabs, Hitchin, UK; Cat. no.: M0371L) Custom iR5 and iC7 barcoded primers, (Sigma or IDT) Agencourt Ampure XP SPRI Beads (Beckman Coulter, High Wycombe, UK; Cat. no.: A63881) 100% Ethanol (VWR, Lutterworth, UK; Cat. no.: 20821.330) Qubit BR DNA assay kit (Thermo Fisher; Cat. no.: Q32850) NEB Ultra II (New England Biolabs; Cat. no.: 7645S/L) PCR Tube (Appleton Woods, Birmingham, UK; Cat. no.: TA571) NEB Next Multiplex Oligos for Illumina primer set 1 (New England Biolabs; Cat. no.: E7500S/L) NEB Next Multiplex Oligos for Illumina primer set 2 (New England Biolabs; Cat. no.: E7335S/L) Herculase II Fusion polymerase kit (Agilent, Cheadle, UK; Cat. no.: 600677) Tris-EDTA, TE (Sigma-Aldrich; Cat. no.: 99302) D1000 reagents (Agilent; Cat. no.: 50675583) D1000 loading tips (Agilent; Cat. no.: 50675153) D1000 screen tape (Agilent; Cat. no.: 50675582) KAPA Library Quantification Complete Kit (Roche; Cat. no.: KK4824) MiSeq Reagent Nano Kit, v2 500-Cycles (Illumina, Cambridge, UK; Cat. no.: MS-103-1003) PhiX Control v3 (Illumina; Cat. no.: FC-110-3001) .. Equipment 8- or 12-channel pipette (Labgene Scientific, Châtel-Saint-Denis, Switzerland: Cat. no.: 5121, 5125) Centrifuge with buckets for plates (Eppendorf; Cat. no.: 5810R) Thermocycler with 96-well plate capacity (Bio-Rad, Watford, UK; Cat. no.: T100) Electrophoresis gel tank and power pack Magnetic rack (DynaMag-2; Thermo Fisher; Cat. no.: 13221) Minifuge (Starlab, Milton Keynes, UK; Cat. no.: N2631-0007) Qubit fluorometer (Thermo Fisher; Cat. no.: Q33226) Agilent 2200 TapeStation (Agilent; Cat. no.: G2964AA) Real-time quantitative polymerase chain reaction (qPCR) thermocycler (Thermo Fisher StepOnePlus; Thermo Fisher; Cat. no.: 4376598) MiSeq (Illumina; Cat. no.: SY-410-1003) Microcentrifuge (Eppendorf; Cat. no.: 5424R)

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step. .. Ten PCR reactions (98 °C for 45 seconds (s); followed by 10 cycles of 98 °C for 15 s, 65 °C for 30 s, 72 °C for 10 s) with 1 µl adaptor ligated DNA as template were performed, using KAPA Hifi Hot Start Ready Mix (KAPA Biosystems; cat. no. KK2602) and primers (fw: TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT and rev: GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), which add a specific 15-nt extension to both adapters for directional cloning using recombination (Clontech In-Fusion HD; cat. no. 639650).

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added. .. Following a 72h hybridisation step a streptavidin bead pull down (Invitrogen M270) was performed followed by multiple bead washes (Nimblegen SeqCap EZ) and PCR amplification of the captured material (Kappa / Nimblegen SeqCap EZ accessory kit v2).

    Article Title: N6-Methyladenosine Landscape of Glioma Stem-Like Cells: METTL3 Is Essential for the Expression of Actively Transcribed Genes and Sustenance of the Oncogenic Signaling
    Article Snippet: Index primers of NEBNext Multiplex oligonucleotides for Illumina (Index Primers Set 1) were used (E7335S, NEB). .. The final PCR enrichment of adaptor-ligated libraries was performed in 12 cycles.

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: .. The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing. .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Article Title: Transcription-induced formation of extrachromosomal DNA during yeast ageing
    Article Snippet: After addition of 1.25 μl 1:25 diluted NEBNext adaptor (E7335), 0.5 μl ligation enhancer and 15 μl NEBNext Ultra II ligation mix (E7103) samples were incubated 15 minutes at 20°C, then 1.5 μl USER enzyme (E7335) was added and incubated 15 minutes at 37°C. .. A total of 1.25 μl library was amplified with 0.4 μl each NEBNext index and universal primers (E7335) and 5μl NEBNext Ultra II PCR mix (E7103) in 10 μl total volume using recommended cycling conditions with 8 cycles for total samples, 16 cycles for 48 hour aged samples and 18 cycles for 24 hour samples.

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: .. AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.). .. A total of 15 cycles were used for PCR amplification of the adaptor-ligated DNA.

    Article Title: Analysis of the microbiome: Advantages of whole genome shotgun versus 16S amplicon sequencing
    Article Snippet: One microgram fragmented metagenomic DNA was end-repaired and 3′-adenylated, ligated with Illumina adapters, and PCR enriched with Illumina sequencing indexes (barcodes) using the NEBNext Ultra DNA library prep kit for Illumina (Catalogue # E7370L,New England BioLabs Inc). .. In total, 11 libraries were constructed with unique indexes using the NEBNext Multiplex Oligos for Illumina Set 1 (Catalogue # E7335L, NewEngland BioLabs Inc).

    Article Title: GATA2/3-TFAP2A/C transcription factor network couples human pluripotent stem cell differentiation to trophectoderm with repression of pluripotency
    Article Snippet: .. Purified DNA fragments were prepared for sequencing using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (E6200L; New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (E7335S; New England Biolabs) according to manufacturer’s instructions using 15 cycles of enrichment PCR. .. Library size was determined using the High Sensitivity DNA Analysis kit on a 2100 Bioanalyzer instrument, and concentration was measured with Quant-iT PicoGreen dsDNA Assay kit (P7589; Life Technologies).

    Immunoprecipitation:

    Article Title: N6-Methyladenosine Landscape of Glioma Stem-Like Cells: METTL3 Is Essential for the Expression of Actively Transcribed Genes and Sustenance of the Oncogenic Signaling
    Article Snippet: Paragraph title: 2.5. m6 A RNA Immunoprecipitation Sequencing ... Index primers of NEBNext Multiplex oligonucleotides for Illumina (Index Primers Set 1) were used (E7335S, NEB).

    Article Title: Histone acetylation orchestrates wound-induced transcriptional activation and cellular reprogramming in Arabidopsis
    Article Snippet: Sheared chromatin was immunoprecipitated using antibodies against histone H3 (ab1791; Abcam), H3K27me3 (07-449; Millipore), H3K4me3 (ab8580; Abcam), H3K36me3 (ab9050; Abcam), H3K9/14ac (06–599, Millipore), and H3K27ac (ab4729, Abcam). .. Libraries were prepared using the KAPA Hyper Prep Kit for Illumina (KK8502, KAPA Biosystems) and Illumina compatible adaptors (E7335, E7500, E7710, E7730, NEB).

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: Lysates were immunoprecipitated with anti-PKC-θ (5 μg, sc-212, Santa Cruz) and Protein A magnetic beads (Millipore). .. The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing.

    cDNA Library Assay:

    Article Title: Multisystem Analysis of Mycobacterium tuberculosis Reveals Kinase-Dependent Remodeling of the Pathogen-Environment Interface
    Article Snippet: .. The cDNA library was prepared using a NEBNext Ultra Directional RNA Library Prep kit for Illumina (New England Biolabs catalog no. E7420S), NEBNext multiplex oligonucleotides for Illumina (index primers set 1) (New England Biolabs catalog no. E7335S), and NEBNext multiplex oligonucleotides for Illumina (index primers set 2) (New England Biolabs catalog no. E7500S) according to the manufacturer’s instructions. .. The quantity and the quality of cDNA library were determined by Bioanalyzer analysis.

    Chromatin Immunoprecipitation:

    Article Title: Histone acetylation orchestrates wound-induced transcriptional activation and cellular reprogramming in Arabidopsis
    Article Snippet: Paragraph title: ChIP sequencing and data analysis ... Libraries were prepared using the KAPA Hyper Prep Kit for Illumina (KK8502, KAPA Biosystems) and Illumina compatible adaptors (E7335, E7500, E7710, E7730, NEB).

    Article Title: The role of protein kinase-C theta in control of epithelial to mesenchymal transition and cancer stem cell formation
    Article Snippet: The resulting ChIP-DNA (10 ng) was used with the NEBNext ChIP-Seq Library Prep for Illumina (New England BioLabs Inc, NEB#E6240L) according to the manufacturer's instructions. .. The kit consists of an End Repair Enzyme kit, Klenow fragment for dA-tailing, Quick T4 DNA ligase (with NEBNext adaptor primers) and NEBNext High-Fidelity 2× PCR Master mix, Universal PCR primer (25 μM), and index primer (25 μM, New England BioLabs Inc, NEBNext Multiplex Oligos for Illumina, NEB#E7335L) for multiplexing.

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: ChIP-DNA size was selected with AMPure XP beads (Beckman Coulter, Inc., part number ). .. AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.).

    Article Title: Characterization of innate immunity genes in the parasitic nematode Brugia malayi
    Article Snippet: The integrity, purity and concentration of all RNA samples were assessed on an RNA nano chip using an Agilent Bioanalyzer 2100. .. B. malayi mRNA was isolated using theNEBNext Poly(A) mRNA Magnetic Isolation Module (Cat. #E7490, New England Biolabs) and transcriptomic libraries were prepared using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Cat. #E7530, New England Biolabs) and the NEBNext® Multiplex Oligos for Illumina (Index Primers 1–12) (Cat. # E7335, New England Biolabs) following the kit protocol.

    RNA Extraction:

    Article Title: Multisystem Analysis of Mycobacterium tuberculosis Reveals Kinase-Dependent Remodeling of the Pathogen-Environment Interface
    Article Snippet: Paragraph title: RNA extraction, RNA-Seq, and transcriptomic analysis. ... The cDNA library was prepared using a NEBNext Ultra Directional RNA Library Prep kit for Illumina (New England Biolabs catalog no. E7420S), NEBNext multiplex oligonucleotides for Illumina (index primers set 1) (New England Biolabs catalog no. E7335S), and NEBNext multiplex oligonucleotides for Illumina (index primers set 2) (New England Biolabs catalog no. E7500S) according to the manufacturer’s instructions.

    Article Title: Characterization of innate immunity genes in the parasitic nematode Brugia malayi
    Article Snippet: Paragraph title: RNA extraction and library preparation ... B. malayi mRNA was isolated using theNEBNext Poly(A) mRNA Magnetic Isolation Module (Cat. #E7490, New England Biolabs) and transcriptomic libraries were prepared using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Cat. #E7530, New England Biolabs) and the NEBNext® Multiplex Oligos for Illumina (Index Primers 1–12) (Cat. # E7335, New England Biolabs) following the kit protocol.

    Agarose Gel Electrophoresis:

    Article Title: Genome-wide assessment of sequence-intrinsic enhancer responsiveness at single-base-pair resolution
    Article Snippet: The DNA was sheared by sonication (Covaris S220) and DNA fragments (100- to 250-bp length) were size-selected using a 1% agarose gel. .. Illumina NEBnext Multiplexing Adaptors (New England BioLabs (NEB); cat. no. E7335 or E7500) were ligated to 1 µg of size-selected DNA fragments using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; cat. no. E7645L) following the manufacturer’s instructions, except the final PCR amplification step.

    In Situ:

    Article Title: Genetic dissection of the α-globin super-enhancer in vivo
    Article Snippet: 3C libraries were made using standard methods similar to the protocol for in situ Hi-C. .. Prior to oligonucleotide capture, 3C libraries were sonicated to 200 bp and Illumina paired-end sequencing adaptors (NEB E6040 / E7335 / E7500; Agilent Herculase II) were added.

    Next-Generation Sequencing:

    Article Title: The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation
    Article Snippet: High-throughput sequencing The poly(A)-containing mRNAs were enriched using Dynabeads (61006; Invitrogen), and RNA-Seq libraries were prepared using NEBNext mRNA Library Prep kits (E6110, E7335; NEB). .. Sequencing was performed at MGH next generation sequencing core.

    Concentration Assay:

    Article Title: N6-Methyladenosine Landscape of Glioma Stem-Like Cells: METTL3 Is Essential for the Expression of Actively Transcribed Genes and Sustenance of the Oncogenic Signaling
    Article Snippet: Index primers of NEBNext Multiplex oligonucleotides for Illumina (Index Primers Set 1) were used (E7335S, NEB). .. The DNA concentration was quantified with the Qubit dsDNA HS kit (Q32851).

    Article Title: Characterization of innate immunity genes in the parasitic nematode Brugia malayi
    Article Snippet: The integrity, purity and concentration of all RNA samples were assessed on an RNA nano chip using an Agilent Bioanalyzer 2100. .. B. malayi mRNA was isolated using theNEBNext Poly(A) mRNA Magnetic Isolation Module (Cat. #E7490, New England Biolabs) and transcriptomic libraries were prepared using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (Cat. #E7530, New England Biolabs) and the NEBNext® Multiplex Oligos for Illumina (Index Primers 1–12) (Cat. # E7335, New England Biolabs) following the kit protocol.

    Article Title: GATA2/3-TFAP2A/C transcription factor network couples human pluripotent stem cell differentiation to trophectoderm with repression of pluripotency
    Article Snippet: Purified DNA fragments were prepared for sequencing using the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (E6200L; New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (E7335S; New England Biolabs) according to manufacturer’s instructions using 15 cycles of enrichment PCR. .. Library size was determined using the High Sensitivity DNA Analysis kit on a 2100 Bioanalyzer instrument, and concentration was measured with Quant-iT PicoGreen dsDNA Assay kit (P7589; Life Technologies).

    DNA Purification:

    Article Title: Chromatinized Protein Kinase C-θ Directly Regulates Inducible Genes in Epithelial to Mesenchymal Transition and Breast Cancer Stem Cells
    Article Snippet: AMPure beads were used to isolate library fragments ranging between 175 and 225 bp in size, and the purified DNA was combined with the NEBNext High-Fidelity 2X PCR master mix, 25 μM Universal PCR primer, and 25 μM index primer for multiplexing purposes (NEBNext multiplex oligonucleotides for Illumina, NEB number E7335L; New England BioLabs Inc.). .. The resultant ChIP-DNA library was subjected to DNA purification with AMPure beads.

    High Throughput Screening Assay:

    Article Title: The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation
    Article Snippet: .. High-throughput sequencing The poly(A)-containing mRNAs were enriched using Dynabeads (61006; Invitrogen), and RNA-Seq libraries were prepared using NEBNext mRNA Library Prep kits (E6110, E7335; NEB). .. Sequencing was performed at MGH next generation sequencing core.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs illumina compatible adaptors
    Illumina Compatible Adaptors, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina compatible adaptors/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    illumina compatible adaptors - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results