protoscript  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    ProtoScript II First Strand cDNA Synthesis Kit
    Description:
    ProtoScript II First Strand cDNA Synthesis Kit 150 rxns
    Catalog Number:
    e6560l
    Price:
    671
    Size:
    150 rxns
    Category:
    First Strand Template Preparation for PCR
    Buy from Supplier


    Structured Review

    New England Biolabs protoscript
    ProtoScript II First Strand cDNA Synthesis Kit
    ProtoScript II First Strand cDNA Synthesis Kit 150 rxns
    https://www.bioz.com/result/protoscript/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    protoscript - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells
    Article Snippet: .. Wild type STAT3 was PCR amplified from bEnd5 cDNA, produced by reverse transcription using oligo dT primers and 2 μg of template RNA with NEB's ProtoScript II kit according to manufacturer's instructions (Cat # E6560S, NEB). .. All PCR reactions were performed with a high fidelity Taq polymerase, using 2 μl of cDNA as a template according to kit guidelines (Cat#KK2102, KAPA Biosystems).

    Article Title: Mouse model of imiquimod-induced psoriatic itch
    Article Snippet: Reverse transcription of 0.5 μg total RNA was performed using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA). .. Amplification of GAPDH cDNA was used for normalization.

    Article Title: A Ruthenium(II) N-Heterocyclic Carbene (NHC) Complex with Naphthalimide Ligand Triggers Apoptosis in Colorectal Cancer Cells via Activating the ROS-p38 MAPK Pathway
    Article Snippet: RNA Isolation, Reverse Transcription, and Quantitative Real Time (qRT) PCR At the end of treatments, total RNA was isolated using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the quality of RNA samples was determined by NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). cDNA synthesis was performed from 500–1000 ng of total RNA using ProtoScript II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. .. The amplification reaction solutions (5 μL) were prepared with 2.5× of ready to use master mix LightCycler® 480 SYBR Green I (Roche, Mannheim, Germany), 1× of nuclease-free H2 O and cDNA templates, as well as 1× of the following primer mixtures (Eurofins Genomics, Ebersberg, Germany): CDKN1A (5s: GACACCACTGGAGGGTGACT; 3as: CAGGTCCACATGGTCTTCCT), Bax (5s: GGGGACGAACTGGACAGTAA; 3as: CAGTTGAAGTTGCCGTCAGA), Bad (5s: GGTTCTGAGGGGAGACTGAGG; 3as: GCTTCCTCTCCCACCGTAGC, ATF2 (5 s: CAGCGTTTTACCAACGAGGA; 3as: GA ATCTTGTTGGTGTTGGGGTC), Stat1 (5 s: GGAAAAGCAAGCGTAA TCTTCAGG; 3as: GAATATTCCCCGACTGAGCC), and vinculin (as reference gene) (5s-CAGTCAGACCCTTACTCAGTG-3′; 3as-CAGCCTCATCGAAGGTAAGGA).

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB). .. The cycling conditions were as follows: 95°C for 15 min followed by 40 cycles of 95°C for 15 s and then 60°C for 1 min. A melt curve analysis was performed to confirm the specificity of the PCR amplification.

    MTT Assay:

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: Dimethyl sulfoxide (DMSO) and 3-(4, 5-Dimethylthylthiazol-2-yl)-2, 5 diphenylterazolium bromide (MTT) were from Sigma-Aldrich Co. (St. Louis, MO, USA). .. ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA).

    Quantitative RT-PCR:

    Article Title: Loss of GET pathway orthologs in Arabidopsis thaliana causes root hair growth defects and affects SNARE abundance
    Article Snippet: .. For cDNA synthesis, ProtoScript II–First Strand cDNA Synthesis Kit (NEB; 1 µg RNA) was used. qRT-PCR was performed using oligonucleotides ( ) specific to SYP123, GFP, and ACT2 as internal control. iQ SYBR Green Supermix (Bio-Rad) was used and performed on the CFX96 Real-Time PCR System (Bio-Rad). ..

    Article Title: Mouse model of imiquimod-induced psoriatic itch
    Article Snippet: Paragraph title: Real-time qRT-PCR ... Reverse transcription of 0.5 μg total RNA was performed using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA).

    Article Title: A Ruthenium(II) N-Heterocyclic Carbene (NHC) Complex with Naphthalimide Ligand Triggers Apoptosis in Colorectal Cancer Cells via Activating the ROS-p38 MAPK Pathway
    Article Snippet: .. RNA Isolation, Reverse Transcription, and Quantitative Real Time (qRT) PCR At the end of treatments, total RNA was isolated using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the quality of RNA samples was determined by NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). cDNA synthesis was performed from 500–1000 ng of total RNA using ProtoScript II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. .. The thermal cycler q-Tower (Analytik Jena AG, Jena, Germany) was used to analyze gene expression levels.

    Article Title: Large G protein α-subunit XLαs limits clathrin-mediated endocytosis and regulates tissue iron levels in vivo
    Article Snippet: .. One microgram of total RNA was used to synthesize first-strand cDNA using ProtoScript II First-Strand cDNA Synthesis Kit (New England Biolabs). qRT-PCR analysis was performed with specific primers and FastStart Universal SYBR Green Master (Roche) with β-actin as a reference gene. .. Primers used for qRT-PCR were: β-actin (F) GATCTGGCACCACACCTTCT and (R) GGGGTGTTGAAGGTCTCAAA; TfRc (F) ATGCCCTCTCTGGTGACATTTGGA and (R) ACCCTCCACAAGCACACTCTTTCT; and XLαs (F) CTCATCGACAAGCAACTGGA and (R) CCCTCTCCGTTAAACCCATT.

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis, and RT-qPCR ... RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany).

    Article Title: 20-HETE promotes glucose-stimulated insulin secretion in an autocrine manner through FFAR1
    Article Snippet: Paragraph title: RNA isolation and quantitative RT-PCR ... RNA isolation and reverse transcription from mouse and human pancreatic islets were performed by using RNAeasy kit (Qiagen) and ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: Alteration of the proteostasis network of plant cells promotes the post-endoplasmic reticulum trafficking of recombinant mutant (L444P) human β-glucocerebrosidase
    Article Snippet: .. One µg RNA was reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs Ltd, Whitby, ON CA) with a mixture of random hexamers and oligo-dT primers. cDNA from 3 biological replicate RNA samples was used for qPCR. .. Quantitative (q) RT-PCRs were performed using the PerfeCTa Sybr Green Supermix with ROX (Qanta Biosciences, Gaithersburg, USA) as described previously.

    Article Title: Loss of GET pathway orthologs in Arabidopsis thaliana causes root hair growth defects and affects SNARE abundance
    Article Snippet: .. For cDNA synthesis, ProtoScript II–First Strand cDNA Synthesis Kit (NEB; 1 µg RNA) was used. qRT-PCR was performed using oligonucleotides ( ) specific to SYP123, GFP, and ACT2 as internal control. iQ SYBR Green Supermix (Bio-Rad) was used and performed on the CFX96 Real-Time PCR System (Bio-Rad). ..

    Article Title: Mouse model of imiquimod-induced psoriatic itch
    Article Snippet: Reverse transcription of 0.5 μg total RNA was performed using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA). .. Real-time RT-PCR was performed using Fast Plus EvaGreen qPCR Master Mix (Biotium, Hayward, CA) on a 7500 Real Time PCR System (Applied Biosystems, Grand Island, NY).

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. Quantitative real-time PCR analysis was performed using Power SYBR Green PCR Master Mix (Life Technologies).

    Article Title: Chemically synthesized Secoisolariciresinol diglucoside (LGM2605) improves mitochondrial function in cardiac myocytes and alleviates septic cardiomyopathy
    Article Snippet: DNase-treated RNA was used for cDNA synthesis using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). .. Quantitative real-time PCR was performed with the SYBR Select Master Mix (Applied Biosystems).

    Article Title: Pli1PIAS1 SUMO Ligase Protected by the Nuclear Pore-associated SUMO Protease Ulp1SENP1/2 *
    Article Snippet: A total of 1 μg of DNase-treated RNA was reverse transcribed using the ProtoScript® II first strand cDNA synthesis kit (New England Biolabs). .. The completed reactions were diluted 10-fold, and 5 μl of the dilutions was used as the template in 20-μl quantitative PCR mixtures using the SensiFAST SYBR No-ROX kit (Bioline), and the quantitative PCRs were carried out using the Chromo4 system (Bio-Rad).

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA). .. The number of AAV transcripts was determined by real-time PCR (MyIQ; Bio-Rad, Hercules, CA), using primers against the GFP portion of pTR-UF11 (forward primer TGA TGC CAC ATA CGG AAA GC and reverse primer AAA AGC ACT GCA CGC CAT AG). pTR-UF11 plasmid DNA linearized with ScaI was used as a standard for determining copy numbers.

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: Paragraph title: RNA isolation and qPCR. ... The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB).

    Incubation:

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: Washed bacterial cells were then transferred to either unpasteurized whole cow's milk or mouse milk or into LB broth at a concentration of 108 CFU/ml and incubated for 30 min at 37°C. .. The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB).

    Universal Probe Library Assay:

    Article Title: 20-HETE promotes glucose-stimulated insulin secretion in an autocrine manner through FFAR1
    Article Snippet: RNA isolation and reverse transcription from mouse and human pancreatic islets were performed by using RNAeasy kit (Qiagen) and ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions. .. RNA isolation and reverse transcription from mouse and human pancreatic islets were performed by using RNAeasy kit (Qiagen) and ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions.

    Infection:

    Article Title: Yap1 safeguards mouse embryonic stem cells from excessive apoptosis during differentiation
    Article Snippet: Paragraph title: Lentiviral production and infection and transposon-mediated gene integration ... Doxycycline (Fisher Scientific) was used at a concentration of 500 ng/mL for all inducible OE experiments. cDNAs for all OE experiments were obtained from either vectors (Bcl-xL - Sino Biological, Bcl-2–3149 pSFFV-neo Bcl-2 cDNA from AddGene, Puma - GenScript, Taz - pcDNA3.1/HisC-mTAZ from AddGene) or full-length mouse ESC cDNA reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs (Bmf).

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: Cell were infected with 1 × 104 viral genomes (vg)/cell of either wild-type or mutant AAV packaged with pRT-UF11 and coinfected with Ad5 (MOI = 10), as described above. .. RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA).

    Expressing:

    Article Title: A Ruthenium(II) N-Heterocyclic Carbene (NHC) Complex with Naphthalimide Ligand Triggers Apoptosis in Colorectal Cancer Cells via Activating the ROS-p38 MAPK Pathway
    Article Snippet: RNA Isolation, Reverse Transcription, and Quantitative Real Time (qRT) PCR At the end of treatments, total RNA was isolated using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the quality of RNA samples was determined by NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). cDNA synthesis was performed from 500–1000 ng of total RNA using ProtoScript II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. .. The thermal cycler q-Tower (Analytik Jena AG, Jena, Germany) was used to analyze gene expression levels.

    Article Title: Chemically synthesized Secoisolariciresinol diglucoside (LGM2605) improves mitochondrial function in cardiac myocytes and alleviates septic cardiomyopathy
    Article Snippet: Paragraph title: 2.2. RNA purification and gene expression analysis- ... DNase-treated RNA was used for cDNA synthesis using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs).

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany). .. The thermal cycle qTower (Analytik Jena AG) was used to assess mRNA expression of various genes in real time.

    BIA-KA:

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA). .. BCA Protein Assay Kit, Cytoplasmic Protein Extraction Kit, and horseradish peroxidase-conjugated secondary antibodies were obtained from Beyotime Biotechnology Inc. (Beijing, China).

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: RNA isolation, cDNA synthesis, and RT-qPCR BCa cells were treated with 1,25(OH)2 D3 (100 nM) for 72 h, after which total RNA was isolated using QIAzol lysis reagent (Qiagen, Germany), following the manufacturer’s instructions. .. RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells
    Article Snippet: Wild type STAT3 was PCR amplified from bEnd5 cDNA, produced by reverse transcription using oligo dT primers and 2 μg of template RNA with NEB's ProtoScript II kit according to manufacturer's instructions (Cat # E6560S, NEB). .. All PCR reactions were performed with a high fidelity Taq polymerase, using 2 μl of cDNA as a template according to kit guidelines (CatKK2102, KAPA Biosystems).

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA). .. The number of AAV transcripts was determined by real-time PCR (MyIQ; Bio-Rad, Hercules, CA), using primers against the GFP portion of pTR-UF11 (forward primer TGA TGC CAC ATA CGG AAA GC and reverse primer AAA AGC ACT GCA CGC CAT AG). pTR-UF11 plasmid DNA linearized with ScaI was used as a standard for determining copy numbers.

    Countercurrent Chromatography:

    Article Title: Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells
    Article Snippet: Wild type STAT3 was PCR amplified from bEnd5 cDNA, produced by reverse transcription using oligo dT primers and 2 μg of template RNA with NEB's ProtoScript II kit according to manufacturer's instructions (Cat # E6560S, NEB). .. GFP was PCR amplified with the following primers: FWD 5′ CCC AAGCTT ACCATGGTGAGCAAGGGC, 3′ REV 5′ TCTAGATCTGAGTCCGGAGCC CTTGTACAGCTCGTCCATG 3′ using plasmid DNA containing GFP as template.

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. The following primer pairs were used: human GAPDH : forward, ctt tgg tat cgt gga agg act ca; reverse, ttc ccg ttc agc tca ggg atg a; CAV1 : forward, tta ctt cgc cat tct ctc tt; reverse, agt tga tgc gga cat tgc t; LRP5 : forward, aac gtg gtc atc tcc ggc ctg gtc tct; reverse, ggg gtc caa ggc gat ggc cct cgg ct; LRP6 , forward, gca tgt gat tgg ctt gga gaa aaa tt; reverse, cac ttc tcc cca gtc tgt cca gta ca; FZD1 : forward, ggc tgc acc atc ctc ttc atg at; reverse, gat ggt ctt gat ggc cgg cac a; FZD2 : forward, gct tcg tgt cgc tct tcc gca t; reverse, acg agc gct ccc agt gct cgc gg; FZD3 : forward, cat ccc tgc aca ata taa ggc tt; reverse, ttc ttc tca ata gct tca cta c; FZD4 : forward, gga tgt gca ata att ttc ttg ct; reverse, aat ggt ttt cac tgc ggg gat g; FZD5 : forward, tcg cca cct tct gga tag gcc tg; reverse, cat ggc cca cga cca gac gca c; FZD6 : forward, ttc tgg ggg aca agg ata taa gt; reverse, aat ctt cta aca tca att aaa a; FZD7 : forward, gac gct ctt tac cgt tct cac ct; reverse, acc gtg cgg tag cca tcg tcc g; FZD8 : forward, tcg ccg gct act cgc agt act t; reverse, aag agg tag atg acc agc ggc g; FZD9 : forward, tga cgc tca cct ggt tcc tgg ct; reverse, ccg tgc tgg cca cgt agc aaa g; FZD10 : forward, caa cat gga tta ctg gaa gat c; reverse, gtc ttg gag gtc caa atc cac at.

    Synthesized:

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: .. Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. Quantitative real-time PCR analysis was performed using Power SYBR Green PCR Master Mix (Life Technologies).

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: .. RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany). .. The thermal cycle qTower (Analytik Jena AG) was used to assess mRNA expression of various genes in real time.

    Cell Culture:

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: .. Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. Quantitative real-time PCR analysis was performed using Power SYBR Green PCR Master Mix (Life Technologies).

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: Materials and Chemicals Cell culture products were purchased from GIBO BRL Life Technologies (New York, NY, USA). .. ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: Paragraph title: RT-PCR assay. ... RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA).

    Sequencing:

    Article Title: Yap1 safeguards mouse embryonic stem cells from excessive apoptosis during differentiation
    Article Snippet: Doxycycline (Fisher Scientific) was used at a concentration of 500 ng/mL for all inducible OE experiments. cDNAs for all OE experiments were obtained from either vectors (Bcl-xL - Sino Biological, Bcl-2–3149 pSFFV-neo Bcl-2 cDNA from AddGene, Puma - GenScript, Taz - pcDNA3.1/HisC-mTAZ from AddGene) or full-length mouse ESC cDNA reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs (Bmf). .. All inserts were confirmed by Sanger sequencing.

    Cellular Antioxidant Activity Assay:

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. The following primer pairs were used: human GAPDH : forward, ctt tgg tat cgt gga agg act ca; reverse, ttc ccg ttc agc tca ggg atg a; CAV1 : forward, tta ctt cgc cat tct ctc tt; reverse, agt tga tgc gga cat tgc t; LRP5 : forward, aac gtg gtc atc tcc ggc ctg gtc tct; reverse, ggg gtc caa ggc gat ggc cct cgg ct; LRP6 , forward, gca tgt gat tgg ctt gga gaa aaa tt; reverse, cac ttc tcc cca gtc tgt cca gta ca; FZD1 : forward, ggc tgc acc atc ctc ttc atg at; reverse, gat ggt ctt gat ggc cgg cac a; FZD2 : forward, gct tcg tgt cgc tct tcc gca t; reverse, acg agc gct ccc agt gct cgc gg; FZD3 : forward, cat ccc tgc aca ata taa ggc tt; reverse, ttc ttc tca ata gct tca cta c; FZD4 : forward, gga tgt gca ata att ttc ttg ct; reverse, aat ggt ttt cac tgc ggg gat g; FZD5 : forward, tcg cca cct tct gga tag gcc tg; reverse, cat ggc cca cga cca gac gca c; FZD6 : forward, ttc tgg ggg aca agg ata taa gt; reverse, aat ctt cta aca tca att aaa a; FZD7 : forward, gac gct ctt tac cgt tct cac ct; reverse, acc gtg cgg tag cca tcg tcc g; FZD8 : forward, tcg ccg gct act cgc agt act t; reverse, aag agg tag atg acc agc ggc g; FZD9 : forward, tga cgc tca cct ggt tcc tgg ct; reverse, ccg tgc tgg cca cgt agc aaa g; FZD10 : forward, caa cat gga tta ctg gaa gat c; reverse, gtc ttg gag gtc caa atc cac at.

    Nucleic Acid Electrophoresis:

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: The integrity of the isolated RNA was verified by gel electrophoresis. .. The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB).

    Mutagenesis:

    Article Title: Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells
    Article Snippet: Paragraph title: 2.9. Generation of GFP tagged STAT3 wild type (WT) and mutant (S727A, S727D) plasmids ... Wild type STAT3 was PCR amplified from bEnd5 cDNA, produced by reverse transcription using oligo dT primers and 2 μg of template RNA with NEB's ProtoScript II kit according to manufacturer's instructions (Cat # E6560S, NEB).

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: Cell were infected with 1 × 104 viral genomes (vg)/cell of either wild-type or mutant AAV packaged with pRT-UF11 and coinfected with Ad5 (MOI = 10), as described above. .. RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA).

    Isolation:

    Article Title: Loss of GET pathway orthologs in Arabidopsis thaliana causes root hair growth defects and affects SNARE abundance
    Article Snippet: Total RNAs were isolated from 100 mg 5-d-old seedlings grown on 1/2 Murashige and Skoog medium by using the Isolate II RNA Plant Kit (Bioline). .. For cDNA synthesis, ProtoScript II–First Strand cDNA Synthesis Kit (NEB; 1 µg RNA) was used. qRT-PCR was performed using oligonucleotides ( ) specific to SYP123, GFP, and ACT2 as internal control. iQ SYBR Green Supermix (Bio-Rad) was used and performed on the CFX96 Real-Time PCR System (Bio-Rad).

    Article Title: Mouse model of imiquimod-induced psoriatic itch
    Article Snippet: Cervical dorsal root ganglia (DRG) and skin samples were isolated from mice, submerged in RNAlater (Qiagen, Valencia, CA), and stored at −80°C. .. Reverse transcription of 0.5 μg total RNA was performed using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA).

    Article Title: A Ruthenium(II) N-Heterocyclic Carbene (NHC) Complex with Naphthalimide Ligand Triggers Apoptosis in Colorectal Cancer Cells via Activating the ROS-p38 MAPK Pathway
    Article Snippet: .. RNA Isolation, Reverse Transcription, and Quantitative Real Time (qRT) PCR At the end of treatments, total RNA was isolated using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the quality of RNA samples was determined by NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). cDNA synthesis was performed from 500–1000 ng of total RNA using ProtoScript II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. .. The thermal cycler q-Tower (Analytik Jena AG, Jena, Germany) was used to analyze gene expression levels.

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis, and RT-qPCR ... RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany).

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: Paragraph title: RNA isolation and qPCR. ... The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB).

    Article Title: 20-HETE promotes glucose-stimulated insulin secretion in an autocrine manner through FFAR1
    Article Snippet: .. RNA isolation and reverse transcription from mouse and human pancreatic islets were performed by using RNAeasy kit (Qiagen) and ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions. .. Quantitative RT-PCR was done with primers designed with the Roche’s online tool and a Universal Probe Library assay (Roche).

    Mouse Assay:

    Article Title: Mouse model of imiquimod-induced psoriatic itch
    Article Snippet: Cervical dorsal root ganglia (DRG) and skin samples were isolated from mice, submerged in RNAlater (Qiagen, Valencia, CA), and stored at −80°C. .. Reverse transcription of 0.5 μg total RNA was performed using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA).

    Polymerase Chain Reaction:

    Article Title: Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells
    Article Snippet: .. Wild type STAT3 was PCR amplified from bEnd5 cDNA, produced by reverse transcription using oligo dT primers and 2 μg of template RNA with NEB's ProtoScript II kit according to manufacturer's instructions (Cat # E6560S, NEB). .. All PCR reactions were performed with a high fidelity Taq polymerase, using 2 μl of cDNA as a template according to kit guidelines (Cat#KK2102, KAPA Biosystems).

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. Quantitative real-time PCR analysis was performed using Power SYBR Green PCR Master Mix (Life Technologies).

    Article Title: Chemically synthesized Secoisolariciresinol diglucoside (LGM2605) improves mitochondrial function in cardiac myocytes and alleviates septic cardiomyopathy
    Article Snippet: DNase-treated RNA was used for cDNA synthesis using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). .. Incorporation of the SYBR green dye into the PCR products was monitored with the Applied Biosystems StepOnePlus Real-Time PCR System.

    Article Title: Pli1PIAS1 SUMO Ligase Protected by the Nuclear Pore-associated SUMO Protease Ulp1SENP1/2 *
    Article Snippet: Paragraph title: RNA Extraction and RT-Quantitative PCR ... A total of 1 μg of DNase-treated RNA was reverse transcribed using the ProtoScript® II first strand cDNA synthesis kit (New England Biolabs).

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB). .. The cycling conditions were as follows: 95°C for 15 min followed by 40 cycles of 95°C for 15 s and then 60°C for 1 min. A melt curve analysis was performed to confirm the specificity of the PCR amplification.

    Protein Extraction:

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA). .. BCA Protein Assay Kit, Cytoplasmic Protein Extraction Kit, and horseradish peroxidase-conjugated secondary antibodies were obtained from Beyotime Biotechnology Inc. (Beijing, China).

    Activated Clotting Time Assay:

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. The following primer pairs were used: human GAPDH : forward, ctt tgg tat cgt gga agg act ca; reverse, ttc ccg ttc agc tca ggg atg a; CAV1 : forward, tta ctt cgc cat tct ctc tt; reverse, agt tga tgc gga cat tgc t; LRP5 : forward, aac gtg gtc atc tcc ggc ctg gtc tct; reverse, ggg gtc caa ggc gat ggc cct cgg ct; LRP6 , forward, gca tgt gat tgg ctt gga gaa aaa tt; reverse, cac ttc tcc cca gtc tgt cca gta ca; FZD1 : forward, ggc tgc acc atc ctc ttc atg at; reverse, gat ggt ctt gat ggc cgg cac a; FZD2 : forward, gct tcg tgt cgc tct tcc gca t; reverse, acg agc gct ccc agt gct cgc gg; FZD3 : forward, cat ccc tgc aca ata taa ggc tt; reverse, ttc ttc tca ata gct tca cta c; FZD4 : forward, gga tgt gca ata att ttc ttg ct; reverse, aat ggt ttt cac tgc ggg gat g; FZD5 : forward, tcg cca cct tct gga tag gcc tg; reverse, cat ggc cca cga cca gac gca c; FZD6 : forward, ttc tgg ggg aca agg ata taa gt; reverse, aat ctt cta aca tca att aaa a; FZD7 : forward, gac gct ctt tac cgt tct cac ct; reverse, acc gtg cgg tag cca tcg tcc g; FZD8 : forward, tcg ccg gct act cgc agt act t; reverse, aag agg tag atg acc agc ggc g; FZD9 : forward, tga cgc tca cct ggt tcc tgg ct; reverse, ccg tgc tgg cca cgt agc aaa g; FZD10 : forward, caa cat gga tta ctg gaa gat c; reverse, gtc ttg gag gtc caa atc cac at.

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA). .. The number of AAV transcripts was determined by real-time PCR (MyIQ; Bio-Rad, Hercules, CA), using primers against the GFP portion of pTR-UF11 (forward primer TGA TGC CAC ATA CGG AAA GC and reverse primer AAA AGC ACT GCA CGC CAT AG). pTR-UF11 plasmid DNA linearized with ScaI was used as a standard for determining copy numbers.

    Purification:

    Article Title: Chemically synthesized Secoisolariciresinol diglucoside (LGM2605) improves mitochondrial function in cardiac myocytes and alleviates septic cardiomyopathy
    Article Snippet: Paragraph title: 2.2. RNA purification and gene expression analysis- ... DNase-treated RNA was used for cDNA synthesis using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs).

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: Mammalian Cell Lysis Kit and Spin Column Animal total RNA Purification Kit were obtained from Sangon Biological Engineering Technology & Service CO., Ltd (Shanghai, China). .. ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA).

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: At 24 h postinfection (p.i.), cells were collected, and the total cellular fraction was purified by using TRIzol RNA reagent (Life Technologies, Grand Island, NY). .. RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA).

    Plasmid Preparation:

    Article Title: Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells
    Article Snippet: Wild type STAT3 was PCR amplified from bEnd5 cDNA, produced by reverse transcription using oligo dT primers and 2 μg of template RNA with NEB's ProtoScript II kit according to manufacturer's instructions (Cat # E6560S, NEB). .. GFP was PCR amplified with the following primers: FWD 5′ CCC AAGCTT ACCATGGTGAGCAAGGGC, 3′ REV 5′ TCTAGATCTGAGTCCGGAGCC CTTGTACAGCTCGTCCATG 3′ using plasmid DNA containing GFP as template.

    Article Title: Mutants at the 2-Fold Interface of Adeno-associated Virus Type 2 (AAV2) Structural Proteins Suggest a Role in Viral Transcription for AAV Capsids
    Article Snippet: RNA integrity was assessed by using an Agilent 2100 bioanalyzer, and all samples were found to have an RNA integrity number (RIN) of 9 or higher, after using a ProtoScript II first-strand cDNA synthesis kit (New England BioLabs, Ipswich, MA). .. The number of AAV transcripts was determined by real-time PCR (MyIQ; Bio-Rad, Hercules, CA), using primers against the GFP portion of pTR-UF11 (forward primer TGA TGC CAC ATA CGG AAA GC and reverse primer AAA AGC ACT GCA CGC CAT AG). pTR-UF11 plasmid DNA linearized with ScaI was used as a standard for determining copy numbers.

    SYBR Green Assay:

    Article Title: Loss of GET pathway orthologs in Arabidopsis thaliana causes root hair growth defects and affects SNARE abundance
    Article Snippet: .. For cDNA synthesis, ProtoScript II–First Strand cDNA Synthesis Kit (NEB; 1 µg RNA) was used. qRT-PCR was performed using oligonucleotides ( ) specific to SYP123, GFP, and ACT2 as internal control. iQ SYBR Green Supermix (Bio-Rad) was used and performed on the CFX96 Real-Time PCR System (Bio-Rad). ..

    Article Title: A Ruthenium(II) N-Heterocyclic Carbene (NHC) Complex with Naphthalimide Ligand Triggers Apoptosis in Colorectal Cancer Cells via Activating the ROS-p38 MAPK Pathway
    Article Snippet: RNA Isolation, Reverse Transcription, and Quantitative Real Time (qRT) PCR At the end of treatments, total RNA was isolated using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the quality of RNA samples was determined by NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). cDNA synthesis was performed from 500–1000 ng of total RNA using ProtoScript II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. .. The amplification reaction solutions (5 μL) were prepared with 2.5× of ready to use master mix LightCycler® 480 SYBR Green I (Roche, Mannheim, Germany), 1× of nuclease-free H2 O and cDNA templates, as well as 1× of the following primer mixtures (Eurofins Genomics, Ebersberg, Germany): CDKN1A (5s: GACACCACTGGAGGGTGACT; 3as: CAGGTCCACATGGTCTTCCT), Bax (5s: GGGGACGAACTGGACAGTAA; 3as: CAGTTGAAGTTGCCGTCAGA), Bad (5s: GGTTCTGAGGGGAGACTGAGG; 3as: GCTTCCTCTCCCACCGTAGC, ATF2 (5 s: CAGCGTTTTACCAACGAGGA; 3as: GA ATCTTGTTGGTGTTGGGGTC), Stat1 (5 s: GGAAAAGCAAGCGTAA TCTTCAGG; 3as: GAATATTCCCCGACTGAGCC), and vinculin (as reference gene) (5s-CAGTCAGACCCTTACTCAGTG-3′; 3as-CAGCCTCATCGAAGGTAAGGA).

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. Quantitative real-time PCR analysis was performed using Power SYBR Green PCR Master Mix (Life Technologies).

    Article Title: Chemically synthesized Secoisolariciresinol diglucoside (LGM2605) improves mitochondrial function in cardiac myocytes and alleviates septic cardiomyopathy
    Article Snippet: DNase-treated RNA was used for cDNA synthesis using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs). .. Incorporation of the SYBR green dye into the PCR products was monitored with the Applied Biosystems StepOnePlus Real-Time PCR System.

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA). .. Applied BiosystemsTM PowerUpTM SYBR® Green Master Mix Kit was obtained from Thermo Fisher (Rochford, MI, USA).

    Article Title: Large G protein α-subunit XLαs limits clathrin-mediated endocytosis and regulates tissue iron levels in vivo
    Article Snippet: .. One microgram of total RNA was used to synthesize first-strand cDNA using ProtoScript II First-Strand cDNA Synthesis Kit (New England Biolabs). qRT-PCR analysis was performed with specific primers and FastStart Universal SYBR Green Master (Roche) with β-actin as a reference gene. .. Primers used for qRT-PCR were: β-actin (F) GATCTGGCACCACACCTTCT and (R) GGGGTGTTGAAGGTCTCAAA; TfRc (F) ATGCCCTCTCTGGTGACATTTGGA and (R) ACCCTCCACAAGCACACTCTTTCT; and XLαs (F) CTCATCGACAAGCAACTGGA and (R) CCCTCTCCGTTAAACCCATT.

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany). .. The LightCycler® 480 SYBR Green I Master (Roche, Germany) reaction mix was used.

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB). .. Reaction mixtures for qPCR consisted of 2× Sybr Green master mix and High ROX master mix (Genesee Scientific) with 3 μM (each) forward and reverse primers, and reactions were performed using a StepOne real-time PCR system.

    RNA Extraction:

    Article Title: Alteration of the proteostasis network of plant cells promotes the post-endoplasmic reticulum trafficking of recombinant mutant (L444P) human β-glucocerebrosidase
    Article Snippet: Paragraph title: RNA extraction and cDNA synthesis ... One µg RNA was reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs Ltd, Whitby, ON CA) with a mixture of random hexamers and oligo-dT primers. cDNA from 3 biological replicate RNA samples was used for qPCR.

    Article Title: Pli1PIAS1 SUMO Ligase Protected by the Nuclear Pore-associated SUMO Protease Ulp1SENP1/2 *
    Article Snippet: Paragraph title: RNA Extraction and RT-Quantitative PCR ... A total of 1 μg of DNase-treated RNA was reverse transcribed using the ProtoScript® II first strand cDNA synthesis kit (New England Biolabs).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: LDH, NO, eNOS, and iNOS RAT ELISA Kits was obtained from LianShuo Biotechnology Co., Ltd (Shanghai, China). .. ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA).

    Spectrophotometry:

    Article Title: Alteration of the proteostasis network of plant cells promotes the post-endoplasmic reticulum trafficking of recombinant mutant (L444P) human β-glucocerebrosidase
    Article Snippet: The purity of RNA was determined with a nanodrop spectrophotometer (ND-2000C, Thermo Scientific) to assess the OD260/280 ratios. .. One µg RNA was reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs Ltd, Whitby, ON CA) with a mixture of random hexamers and oligo-dT primers. cDNA from 3 biological replicate RNA samples was used for qPCR.

    Article Title: A Ruthenium(II) N-Heterocyclic Carbene (NHC) Complex with Naphthalimide Ligand Triggers Apoptosis in Colorectal Cancer Cells via Activating the ROS-p38 MAPK Pathway
    Article Snippet: .. RNA Isolation, Reverse Transcription, and Quantitative Real Time (qRT) PCR At the end of treatments, total RNA was isolated using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the quality of RNA samples was determined by NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). cDNA synthesis was performed from 500–1000 ng of total RNA using ProtoScript II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. .. The thermal cycler q-Tower (Analytik Jena AG, Jena, Germany) was used to analyze gene expression levels.

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: .. RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany). .. The thermal cycle qTower (Analytik Jena AG) was used to assess mRNA expression of various genes in real time.

    Produced:

    Article Title: Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells
    Article Snippet: .. Wild type STAT3 was PCR amplified from bEnd5 cDNA, produced by reverse transcription using oligo dT primers and 2 μg of template RNA with NEB's ProtoScript II kit according to manufacturer's instructions (Cat # E6560S, NEB). .. All PCR reactions were performed with a high fidelity Taq polymerase, using 2 μl of cDNA as a template according to kit guidelines (Cat#KK2102, KAPA Biosystems).

    Concentration Assay:

    Article Title: Yap1 safeguards mouse embryonic stem cells from excessive apoptosis during differentiation
    Article Snippet: .. Doxycycline (Fisher Scientific) was used at a concentration of 500 ng/mL for all inducible OE experiments. cDNAs for all OE experiments were obtained from either vectors (Bcl-xL - Sino Biological, Bcl-2–3149 pSFFV-neo Bcl-2 cDNA from AddGene, Puma - GenScript, Taz - pcDNA3.1/HisC-mTAZ from AddGene) or full-length mouse ESC cDNA reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs (Bmf). .. All inserts were confirmed by Sanger sequencing.

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: .. RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany). .. The thermal cycle qTower (Analytik Jena AG) was used to assess mRNA expression of various genes in real time.

    Article Title: Genome-Wide Identification of Fitness Factors in Mastitis-Associated Escherichia coli
    Article Snippet: Washed bacterial cells were then transferred to either unpasteurized whole cow's milk or mouse milk or into LB broth at a concentration of 108 CFU/ml and incubated for 30 min at 37°C. .. The RNA was used to make cDNA using a ProtoScript II First Strand cDNA synthesis kit (NEB).

    CTG Assay:

    Article Title: Oligomerization of Frizzled and LRP5/6 protein initiates intracellular signaling for the canonical WNT/β-catenin pathway
    Article Snippet: Total RNAs were extracted from cultured cells by directly adding the TRIzol reagent to the cells. cDNAs were synthesized using the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA). .. The following primer pairs were used: human GAPDH : forward, ctt tgg tat cgt gga agg act ca; reverse, ttc ccg ttc agc tca ggg atg a; CAV1 : forward, tta ctt cgc cat tct ctc tt; reverse, agt tga tgc gga cat tgc t; LRP5 : forward, aac gtg gtc atc tcc ggc ctg gtc tct; reverse, ggg gtc caa ggc gat ggc cct cgg ct; LRP6 , forward, gca tgt gat tgg ctt gga gaa aaa tt; reverse, cac ttc tcc cca gtc tgt cca gta ca; FZD1 : forward, ggc tgc acc atc ctc ttc atg at; reverse, gat ggt ctt gat ggc cgg cac a; FZD2 : forward, gct tcg tgt cgc tct tcc gca t; reverse, acg agc gct ccc agt gct cgc gg; FZD3 : forward, cat ccc tgc aca ata taa ggc tt; reverse, ttc ttc tca ata gct tca cta c; FZD4 : forward, gga tgt gca ata att ttc ttg ct; reverse, aat ggt ttt cac tgc ggg gat g; FZD5 : forward, tcg cca cct tct gga tag gcc tg; reverse, cat ggc cca cga cca gac gca c; FZD6 : forward, ttc tgg ggg aca agg ata taa gt; reverse, aat ctt cta aca tca att aaa a; FZD7 : forward, gac gct ctt tac cgt tct cac ct; reverse, acc gtg cgg tag cca tcg tcc g; FZD8 : forward, tcg ccg gct act cgc agt act t; reverse, aag agg tag atg acc agc ggc g; FZD9 : forward, tga cgc tca cct ggt tcc tgg ct; reverse, ccg tgc tgg cca cgt agc aaa g; FZD10 : forward, caa cat gga tta ctg gaa gat c; reverse, gtc ttg gag gtc caa atc cac at.

    Lysis:

    Article Title: A Ruthenium(II) N-Heterocyclic Carbene (NHC) Complex with Naphthalimide Ligand Triggers Apoptosis in Colorectal Cancer Cells via Activating the ROS-p38 MAPK Pathway
    Article Snippet: .. RNA Isolation, Reverse Transcription, and Quantitative Real Time (qRT) PCR At the end of treatments, total RNA was isolated using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the quality of RNA samples was determined by NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Darmstadt, Germany). cDNA synthesis was performed from 500–1000 ng of total RNA using ProtoScript II first strand cDNA synthesis kit (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. .. The thermal cycler q-Tower (Analytik Jena AG, Jena, Germany) was used to analyze gene expression levels.

    Article Title: Trichosanthis Pericarpium Aqueous Extract Protects H9c2 Cardiomyocytes from Hypoxia/Reoxygenation Injury by Regulating PI3K/Akt/NO Pathway
    Article Snippet: Mammalian Cell Lysis Kit and Spin Column Animal total RNA Purification Kit were obtained from Sangon Biological Engineering Technology & Service CO., Ltd (Shanghai, China). .. ProtoScript® II First Strand cDNA Synthesis Kit was purchased from New England Biolabs Inc. (Beverly, MA, USA).

    Article Title: Activation of pro-survival metabolic networks by 1,25(OH)2D3 does not hamper the sensitivity of breast cancer cells to chemotherapeutics
    Article Snippet: RNA isolation, cDNA synthesis, and RT-qPCR BCa cells were treated with 1,25(OH)2 D3 (100 nM) for 72 h, after which total RNA was isolated using QIAzol lysis reagent (Qiagen, Germany), following the manufacturer’s instructions. .. RNA concentration and purity were determined using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, Germany). cDNA was synthesized from 500 ng of total RNA/sample using ProtoScript® II first strand cDNA synthesis kit (New England BioLabs, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs protoscript m mulv first strand cdna synthesis kit
    Protoscript M Mulv First Strand Cdna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protoscript m mulv first strand cdna synthesis kit/product/New England Biolabs
    Average 95 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    protoscript m mulv first strand cdna synthesis kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results