chipseq libraries  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    Name:
    NEBNext ChIP Seq Library Prep Master Mix Set for Illumina
    Description:
    NEBNext ChIP Seq Library Prep Master Mix Set for Illumina 60 rxns
    Catalog Number:
    e6240l
    Price:
    1163
    Size:
    60 rxns
    Category:
    DNA Template Preparation for PCR
    Buy from Supplier


    Structured Review

    New England Biolabs chipseq libraries
    NEBNext ChIP Seq Library Prep Master Mix Set for Illumina
    NEBNext ChIP Seq Library Prep Master Mix Set for Illumina 60 rxns
    https://www.bioz.com/result/chipseq libraries/product/New England Biolabs
    Average 87 stars, based on 4290 article reviews
    Price from $9.99 to $1999.99
    chipseq libraries - by Bioz Stars, 2020-03
    87/100 stars

    Images

    1) Product Images from "Electrostatic repulsion causes anticooperative DNA binding between tumor suppressor ETS transcription factors and JUN–FOS at composite DNA sites"

    Article Title: Electrostatic repulsion causes anticooperative DNA binding between tumor suppressor ETS transcription factors and JUN–FOS at composite DNA sites

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.RA118.003352

    Preferential binding of ERG to ETS–AP1 sites in vivo . A, heat map of reads for ERG–FLAG and EHF–FLAG ChIP data; numbers at left indicate clusters referred to in the text. Analysis of ChIPseq data using MACS2 returned 34,746 enriched
    Figure Legend Snippet: Preferential binding of ERG to ETS–AP1 sites in vivo . A, heat map of reads for ERG–FLAG and EHF–FLAG ChIP data; numbers at left indicate clusters referred to in the text. Analysis of ChIPseq data using MACS2 returned 34,746 enriched

    Techniques Used: Binding Assay, In Vivo, Chromatin Immunoprecipitation

    2) Product Images from "Mof-associated complexes have overlapping and unique roles in regulating pluripotency in embryonic stem cells and during differentiation"

    Article Title: Mof-associated complexes have overlapping and unique roles in regulating pluripotency in embryonic stem cells and during differentiation

    Journal: eLife

    doi: 10.7554/eLife.02104

    Msl1 and Nsl1 incorporate into endogenous complexes in mESCs. ( A and B ) Western Blot analysis using the raised anti-Msl1 (3208) or anti-Nsl1 (3130) antibodies on nuclear extracts. Preimmune sera (pre) were used as negative controls. ( C ) Anti-Msl1 (3208) or anti-Nsl1 (3130) antibodies were used to immunoprecipitate protein complexes from mESC nuclear extracts. The IP-ed complexes were then analysed by multidimensional protein identification technology (MudPIT). The identified MSL- or NSL-containing complex proteins and their relative protein abundance in the samples are represented by normalized spectral abundance factor (NSAF) ( Zybailov et al., 2006 ). NSAF allows the comparison of abundance of individual proteins in multiple independent samples and in multiprotein complexes ( Florens et al., 2006 ; Paoletti et al., 2006 ). The colour intensity reflects of the NSAF values multiplied by 1000 (as indicated). ( D ) Gel filtration of mESC nuclear extracts. Every second fraction eluted from a Superose 6 column was analysed for the presence of Nsl1, Msl1, and Mof by Western Blot. Molecular weight markers for the corresponding fractions are indicated on the top of the panel. DOI: http://dx.doi.org/10.7554/eLife.02104.003 10.7554/eLife.02104.004 List of identified proteins of MudPIT analyses. SAF and NSAF values of all significantly enriched proteins in the Msl1 3208 or Nsl1 3130 IP in NE of mESCs. DOI: http://dx.doi.org/10.7554/eLife.02104.004
    Figure Legend Snippet: Msl1 and Nsl1 incorporate into endogenous complexes in mESCs. ( A and B ) Western Blot analysis using the raised anti-Msl1 (3208) or anti-Nsl1 (3130) antibodies on nuclear extracts. Preimmune sera (pre) were used as negative controls. ( C ) Anti-Msl1 (3208) or anti-Nsl1 (3130) antibodies were used to immunoprecipitate protein complexes from mESC nuclear extracts. The IP-ed complexes were then analysed by multidimensional protein identification technology (MudPIT). The identified MSL- or NSL-containing complex proteins and their relative protein abundance in the samples are represented by normalized spectral abundance factor (NSAF) ( Zybailov et al., 2006 ). NSAF allows the comparison of abundance of individual proteins in multiple independent samples and in multiprotein complexes ( Florens et al., 2006 ; Paoletti et al., 2006 ). The colour intensity reflects of the NSAF values multiplied by 1000 (as indicated). ( D ) Gel filtration of mESC nuclear extracts. Every second fraction eluted from a Superose 6 column was analysed for the presence of Nsl1, Msl1, and Mof by Western Blot. Molecular weight markers for the corresponding fractions are indicated on the top of the panel. DOI: http://dx.doi.org/10.7554/eLife.02104.003 10.7554/eLife.02104.004 List of identified proteins of MudPIT analyses. SAF and NSAF values of all significantly enriched proteins in the Msl1 3208 or Nsl1 3130 IP in NE of mESCs. DOI: http://dx.doi.org/10.7554/eLife.02104.004

    Techniques Used: Western Blot, Filtration, Molecular Weight

    Knockdown (KD) of Msl1 or Nsl1 through lentiviral shRNA vectors. ( A and C ) ESCs were treated with sh control, sh Msl1 or sh Nsl1 expressing lentiviral vectors, 5 days after lentiviral infection total RNA was isolated and RT-qPCR was carried out. Samples were normalized to actin and the sh control was set to 100%. Error bars represent standard deviation of three independent experiments. ( B and D ) Validation of the Msl1 or Nsl1 downregulation in sh control or shRNA conditions by Western Blot. 20 μg of proteins were loaded per lane and normalized by ponceau staining. ( E and F ) anti-Msl1 ( E ) or anti-Nsl1 ( F ) ChIP was carried out on sh control ( E ) or sh Nsl1 ( F ) KD-treated cells. The results of ChIP-qPCR amplifications at selected genes (TSS or genebody [gb] regions) are shown. Fold enrichment higher than five is defined as binding. DOI: http://dx.doi.org/10.7554/eLife.02104.009
    Figure Legend Snippet: Knockdown (KD) of Msl1 or Nsl1 through lentiviral shRNA vectors. ( A and C ) ESCs were treated with sh control, sh Msl1 or sh Nsl1 expressing lentiviral vectors, 5 days after lentiviral infection total RNA was isolated and RT-qPCR was carried out. Samples were normalized to actin and the sh control was set to 100%. Error bars represent standard deviation of three independent experiments. ( B and D ) Validation of the Msl1 or Nsl1 downregulation in sh control or shRNA conditions by Western Blot. 20 μg of proteins were loaded per lane and normalized by ponceau staining. ( E and F ) anti-Msl1 ( E ) or anti-Nsl1 ( F ) ChIP was carried out on sh control ( E ) or sh Nsl1 ( F ) KD-treated cells. The results of ChIP-qPCR amplifications at selected genes (TSS or genebody [gb] regions) are shown. Fold enrichment higher than five is defined as binding. DOI: http://dx.doi.org/10.7554/eLife.02104.009

    Techniques Used: shRNA, Expressing, Infection, Isolation, Quantitative RT-PCR, Standard Deviation, Western Blot, Staining, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay

    Msl1, Nsl1 and Mof regulate mESC-unspecific genes. ( A ) GO analysis ( Tassy and Pourquie, 2013 ) of downregulated genes in sh Msl1, sh Nsl1 and Mof KO mESCs. ( B ) Oct4 expression in cell extracts prepared from sh control, sh Msl1, sh Nsl1 and sh Msl1/Nsl1 mESCs was analysed by Western Blot. Extracts from mouse embryonic fibroblasts (mEFs) were used as negative control. 20 μg of proteins were loaded per lane and normalized by ponceau staining, and the blots were developed with an anti-Oct4 antibody. DOI: http://dx.doi.org/10.7554/eLife.02104.019
    Figure Legend Snippet: Msl1, Nsl1 and Mof regulate mESC-unspecific genes. ( A ) GO analysis ( Tassy and Pourquie, 2013 ) of downregulated genes in sh Msl1, sh Nsl1 and Mof KO mESCs. ( B ) Oct4 expression in cell extracts prepared from sh control, sh Msl1, sh Nsl1 and sh Msl1/Nsl1 mESCs was analysed by Western Blot. Extracts from mouse embryonic fibroblasts (mEFs) were used as negative control. 20 μg of proteins were loaded per lane and normalized by ponceau staining, and the blots were developed with an anti-Oct4 antibody. DOI: http://dx.doi.org/10.7554/eLife.02104.019

    Techniques Used: Expressing, Western Blot, Negative Control, Staining

    MSL and NSL significantly bind to shared and specific gene sets. ( A – C ) Bootstrap statistical analyses (‘Materials and methods’) were carried out with a random selection of 10,600 genes (IDs) out of a total pool of 26,460 ENSEMBL IDs. Histograms represent the average numbers of observed IDs in the three random sets. The average numbers and SDs are: only Msl1 1303 ± 27 ( A ), Msl1 and Nsl1 1027 ± 23 ( B ) and for only Nsl1 870 ± 22 ( C ). These averages are significantly far from the experimentally determined numbers (p-value
    Figure Legend Snippet: MSL and NSL significantly bind to shared and specific gene sets. ( A – C ) Bootstrap statistical analyses (‘Materials and methods’) were carried out with a random selection of 10,600 genes (IDs) out of a total pool of 26,460 ENSEMBL IDs. Histograms represent the average numbers of observed IDs in the three random sets. The average numbers and SDs are: only Msl1 1303 ± 27 ( A ), Msl1 and Nsl1 1027 ± 23 ( B ) and for only Nsl1 870 ± 22 ( C ). These averages are significantly far from the experimentally determined numbers (p-value

    Techniques Used: Selection, Significance Assay

    shMsl1, shNsl1 and double KD mESCs do not undergo apoptosis. ( A ) mESCs were treated with sh control or a mix of sh Msl1 and sh Nsl1 (sh Msl1/Nsl1) expressing lentiviral vectors. 5 days after lentiviral infection Msl1 and Nsl1 downregulation in sh control or sh Msl1/Nsl1 mESCs was tested by Western Blot. 20 μg of proteins were loaded per lane and normalized by ponceau staining and the blots were revealed with the indicated antibodies. ( B ) Cell death analyses of sh control, sh Msl1, sh Nsl1 and sh Ms1/Nsl1 mESCs 6 days after lentiviral infection. Sh control mESCs treated with 10 mM of H 2 O 2 were used as positive control. Phosphatidylserine appearance at the outer cell membrane of apoptotic cells was analysed by colorimetric measurement at 550 nm using the APOpercentage assay. DOI: http://dx.doi.org/10.7554/eLife.02104.016
    Figure Legend Snippet: shMsl1, shNsl1 and double KD mESCs do not undergo apoptosis. ( A ) mESCs were treated with sh control or a mix of sh Msl1 and sh Nsl1 (sh Msl1/Nsl1) expressing lentiviral vectors. 5 days after lentiviral infection Msl1 and Nsl1 downregulation in sh control or sh Msl1/Nsl1 mESCs was tested by Western Blot. 20 μg of proteins were loaded per lane and normalized by ponceau staining and the blots were revealed with the indicated antibodies. ( B ) Cell death analyses of sh control, sh Msl1, sh Nsl1 and sh Ms1/Nsl1 mESCs 6 days after lentiviral infection. Sh control mESCs treated with 10 mM of H 2 O 2 were used as positive control. Phosphatidylserine appearance at the outer cell membrane of apoptotic cells was analysed by colorimetric measurement at 550 nm using the APOpercentage assay. DOI: http://dx.doi.org/10.7554/eLife.02104.016

    Techniques Used: Expressing, Infection, Western Blot, Staining, Positive Control

    Msl1 and Nsl1 bind to active genes, but participate differentially to gene expression. ( A ) Boxplots showing the log2 of RNA FPKM expression values from mESCs of all analysed, Msl1-, or Nsl1-bound ENSEMBL genes. (B, C and D ) RNA expression values are ranked into five groups, where group 5 represents the highest RNA expression level and group 1 the lowest (see bottom of panels B – D ). Boxplots show the tag density of the nearest peak to the TSS for ( B ) Pol II, ( C ) Msl1 and ( D ) Nsl1 tag densities around the TSSs at the five groups. Only density values higher than zero were taken into consideration. The median is different between groups, if the notches of the boxplots do not overlap. DOI: http://dx.doi.org/10.7554/eLife.02104.010
    Figure Legend Snippet: Msl1 and Nsl1 bind to active genes, but participate differentially to gene expression. ( A ) Boxplots showing the log2 of RNA FPKM expression values from mESCs of all analysed, Msl1-, or Nsl1-bound ENSEMBL genes. (B, C and D ) RNA expression values are ranked into five groups, where group 5 represents the highest RNA expression level and group 1 the lowest (see bottom of panels B – D ). Boxplots show the tag density of the nearest peak to the TSS for ( B ) Pol II, ( C ) Msl1 and ( D ) Nsl1 tag densities around the TSSs at the five groups. Only density values higher than zero were taken into consideration. The median is different between groups, if the notches of the boxplots do not overlap. DOI: http://dx.doi.org/10.7554/eLife.02104.010

    Techniques Used: Expressing, RNA Expression

    Identification and validation of Msl1 and Nsl1 binding sites. ( A ) Identified binding sites of Msl1 and Nsl1 using MACS14 (p-value
    Figure Legend Snippet: Identification and validation of Msl1 and Nsl1 binding sites. ( A ) Identified binding sites of Msl1 and Nsl1 using MACS14 (p-value

    Techniques Used: Binding Assay, Significance Assay

    MSL affects H4K16 acetylation in mESCs. ( A and B ) Scatter Plots indicating the Pearson correlation and Pearson p-values between H4K16ac and Msl1 ( A ) or Nsl1 ( B ) densities at Msl1 peaks or Nsl1 peaks. Log2 represented tag densities were calculated at peak regions and normalized to the control (Input) data set. ( C ) Average binding profiles of Msl1, Nsl1, Pol II and H4K16ac at a region of +2 kb around all ENSEMBL promoters. Only Nsl1 and Msl1 positive genes are taken into consideration. The input serves as control and tag densities are normalized to the input. ( D ) mESCs were treated for 5 days with lentiviral vectors expressing sh control, sh Msl1, or sh Nsl1 interfering RNAs. Total histones were isolated by acidic extraction and H4K16ac, H4K5ac, and H4K8ac levels were analysed by western blot. Histones were normalized using an antibody against non-modified histone 3 (H3). KD efficiencies were tested in Figure 2—figure supplement 2A–D . DOI: http://dx.doi.org/10.7554/eLife.02104.011
    Figure Legend Snippet: MSL affects H4K16 acetylation in mESCs. ( A and B ) Scatter Plots indicating the Pearson correlation and Pearson p-values between H4K16ac and Msl1 ( A ) or Nsl1 ( B ) densities at Msl1 peaks or Nsl1 peaks. Log2 represented tag densities were calculated at peak regions and normalized to the control (Input) data set. ( C ) Average binding profiles of Msl1, Nsl1, Pol II and H4K16ac at a region of +2 kb around all ENSEMBL promoters. Only Nsl1 and Msl1 positive genes are taken into consideration. The input serves as control and tag densities are normalized to the input. ( D ) mESCs were treated for 5 days with lentiviral vectors expressing sh control, sh Msl1, or sh Nsl1 interfering RNAs. Total histones were isolated by acidic extraction and H4K16ac, H4K5ac, and H4K8ac levels were analysed by western blot. Histones were normalized using an antibody against non-modified histone 3 (H3). KD efficiencies were tested in Figure 2—figure supplement 2A–D . DOI: http://dx.doi.org/10.7554/eLife.02104.011

    Techniques Used: Binding Assay, Expressing, Isolation, Western Blot, Modification

    MSL binds to bivalent genes. ( A ) H3K27me3 and Ezh2 profiles together with Nsl1, Msl1, H3K4me3 and Pol II at the bivalent Hes5 gene at the UCSC genome browser. The input serves as negative control. ( B ) Bootstrap statistical analyses (‘Materials and methods’) were carried out with a random selection of 13,505 genes (IDs) out of a total pool of 26,460 ENSEMBL IDs. The histograms represent the average numbers of observed IDs in the random sets. The average number and SD is: 165 ± 10 using a random selection (p-value=4.48e−66). The experimentally obtained 343 Msl1 positive bivalent genes in Cluster C (indicated by a bold arrow) is significantly far from the average of randomly selected gene IDs. ( C and D ) mESCs were treated with sh control or sh Msl1 expressing lentiviral vectors, 5 days after lentiviral infection mESCs were cultured without LIF. RA was added for additional 4 days to induce NPC formation. ( C ) Msl1 downregulation in sh control, or sh Msl1 conditions were tested by Western Blot as indicated. 20 μg of proteins were loaded per lane and normalized by tubulin and ponceau staining. ( D ) Morphology was analysed with a reverse-phase microscope using a 10x magnification. DOI: http://dx.doi.org/10.7554/eLife.02104.022
    Figure Legend Snippet: MSL binds to bivalent genes. ( A ) H3K27me3 and Ezh2 profiles together with Nsl1, Msl1, H3K4me3 and Pol II at the bivalent Hes5 gene at the UCSC genome browser. The input serves as negative control. ( B ) Bootstrap statistical analyses (‘Materials and methods’) were carried out with a random selection of 13,505 genes (IDs) out of a total pool of 26,460 ENSEMBL IDs. The histograms represent the average numbers of observed IDs in the random sets. The average number and SD is: 165 ± 10 using a random selection (p-value=4.48e−66). The experimentally obtained 343 Msl1 positive bivalent genes in Cluster C (indicated by a bold arrow) is significantly far from the average of randomly selected gene IDs. ( C and D ) mESCs were treated with sh control or sh Msl1 expressing lentiviral vectors, 5 days after lentiviral infection mESCs were cultured without LIF. RA was added for additional 4 days to induce NPC formation. ( C ) Msl1 downregulation in sh control, or sh Msl1 conditions were tested by Western Blot as indicated. 20 μg of proteins were loaded per lane and normalized by tubulin and ponceau staining. ( D ) Morphology was analysed with a reverse-phase microscope using a 10x magnification. DOI: http://dx.doi.org/10.7554/eLife.02104.022

    Techniques Used: Negative Control, Selection, Significance Assay, Expressing, Infection, Cell Culture, Western Blot, Staining, Microscopy

    Msl1 and Mof binding at pluripotency genes. ( A and B ) Msl1, Nsl1 and Mof binding together with Pol II and H4K16ac profiles at the ( A ) Pou5f1 (Oct4) and ( B ) Sox2 locus at the UCSC genome browser. The Input serves as control. DOI: http://dx.doi.org/10.7554/eLife.02104.020
    Figure Legend Snippet: Msl1 and Mof binding at pluripotency genes. ( A and B ) Msl1, Nsl1 and Mof binding together with Pol II and H4K16ac profiles at the ( A ) Pou5f1 (Oct4) and ( B ) Sox2 locus at the UCSC genome browser. The Input serves as control. DOI: http://dx.doi.org/10.7554/eLife.02104.020

    Techniques Used: Binding Assay

    Related Articles

    Centrifugation:

    Article Title: Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1 [OPEN]
    Article Snippet: Sequencing was done in two rounds, using 50 bp single-end reads on an Illumina HiSeq 2000 platform, from a single library preparation using NEBNext ChIP-Seq Library Prep Master Mix Set (New England Biolabs) for each sample. .. Sequencing was done in two rounds, using 50 bp single-end reads on an Illumina HiSeq 2000 platform, from a single library preparation using NEBNext ChIP-Seq Library Prep Master Mix Set (New England Biolabs) for each sample.

    Construct:

    Article Title: Bcl11b sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtb16
    Article Snippet: .. ChIP-seq libraries were constructed using NEBNext ChIP-Seq Library Preparation Kit (E6240, NEB) and sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt. .. Analysis pipelines used are described below under ChIP-seq Analysis and RNA-seq Analysis.

    Incubation:

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Each immunoprecipitation was performed using 9 μg of sheared chromatin and 5 μg of antibody (H3K27ac:ab4729, H3K4me3:ab8580) with an overnight incubation at 4°C following the Magna ChIP A/G Chromatin Immunoprecipitation Kit protocol. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: Epigenetic evolution and lineage histories of chronic lymphocytic leukemia
    Article Snippet: Briefly, immunoprecipitation reactions were performed with the above-indicated antibodies, each on approximately 500,000 cells, and incubated overnight at 4°C. .. Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240, New England Biolabs, Ipswich, MA) and TruSeq Adaptors (Illumina) according to the manufacturer’s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode).

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Each immunoprecipitation was performed using 9 μg of sheared chromatin and 5 μg of antibody (H3K27ac:ab4729, H3K4me3:ab8580) with an overnight incubation at 4°C following the Magna ChIP A/G Chromatin Immunoprecipitation Kit protocol. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: The chromatin was washed several times at 4°C with 5‐min incubation between each wash and 2‐min magnetization to collect beads; twice with Low Salt Wash Buffer (10 mM Tris–HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% Triton X‐100, 0.15% SDS, 1 mM PMSF), once with High Salt Wash Buffer (10 mM Tris–HCl pH 8.0, 500 mM NaCl, 1 mM EDTA, 1% Triton X‐100, 0.15% SDS, 1 mM PMSF), once with LiCl Wash Buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.5 mM EGTA, 250 mM LiCl, 1% NP‐40, 1% sodium deoxycholate, 1 mM PMSF) and with TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA). .. One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp.

    Article Title: Bcl11b sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtb16
    Article Snippet: The samples were incubated overnight at 4 °C, then washed and eluted for 6 h at 65 °C in ChIP elution buffer (20 mM Tris-HCl, pH 7.5, 5 mM EDTA 50 mM NaCl, 1% SDS, and 50 μg/ml proteinase K). .. ChIP-seq libraries were constructed using NEBNext ChIP-Seq Library Preparation Kit (E6240, NEB) and sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt.

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: Pellets were resuspended in 10 ml of lysis buffer II (10 mM Tris–HCL [pH 8.0], 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, and protease inhibitor) and incubated with gentle rocking for 5 min at 4 °C. .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S).

    Article Title: Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1 [OPEN]
    Article Snippet: After overnight incubation at 65°C, DNA was purified with a DNA & Concentrator Kit (Zymo Research). .. Sequencing was done in two rounds, using 50 bp single-end reads on an Illumina HiSeq 2000 platform, from a single library preparation using NEBNext ChIP-Seq Library Prep Master Mix Set (New England Biolabs) for each sample.

    Electroporation:

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Concentration Assay:

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Shearing efficiency was assessed using the Agilent High Sensitivity DNA kit and chromatin concentration was determined using a NanoDrop Spectrophotometer. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation
    Article Snippet: Library preparation ChIP-DNA was isolated by using the QIAquick PCR purification kit (QIAGEN, 28104) and NEBNext® ChIP-seq Library Prep Master Mix Set for Illumina ® (NEB, E6240L) was used for library preparation. .. Agilent Technologies 2200 TapeStation was used to determine fragment size of DNA and the concentration of DNA was measured by PicoGreen (Thermo Fisher Scientific, P7589).

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Shearing efficiency was assessed using the Agilent High Sensitivity DNA kit and chromatin concentration was determined using a NanoDrop Spectrophotometer. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Protease Inhibitor:

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: Nuclei were collected by spinning at 2000 rcf for 5 min at 4 °C and resuspended in shearing buffer (50 mM HEPES [pH 8.0], 10 mM EDTA [pH 8.0], 1% SDS, EDTA-free complete protease inhibitor). .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S).

    Magnetic Beads:

    Article Title: Epigenetic evolution and lineage histories of chronic lymphocytic leukemia
    Article Snippet: The immune complex was collected with protein A/G agarose or magnetic beads and washed sequentially in the low salt wash buffer (20mM Tris pH8, 150mM NaCl, 0.1% SDS, 1% Triton X-100, 2mM EDTA), the high salt wash buffer (20mM Tris pH8, 500mM NaCl, 0.1% SDS, 1% Triton X-100, 2mM EDTA), the LiCl wash buffer (10mM Tris pH8, 250mM LiCl, 1% NP-40, 1% Sodium Deoxycholate, 1mM EDTA) and TE. .. Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240, New England Biolabs, Ipswich, MA) and TruSeq Adaptors (Illumina) according to the manufacturer’s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode).

    Generated:

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Barcoded, strand-specific, polyA+ selected RNA-seq libraries were generated using the Illumina TruSeq Stranded mRNA kit.

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S). .. Briefly, 5 ng purified chromatin and 5 ng purified immunoprecipitated chromatin were used for ChIP-seq library construction.

    DNA Sequencing:

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Sequencing:

    Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes
    Article Snippet: Paragraph title: Additional materials for DNA and RNA high-throughput sequencing methods ... NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England BioLabs Inc, cat. no. E6240S) NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs Inc, cat. no. E7420S) CAUTION: Formaldehyde is toxic by inhalation or if swallowed; is irritating to the skin, eyes, and respiratory system; and may be carcinogenic.

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Article Title: FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation
    Article Snippet: Library preparation ChIP-DNA was isolated by using the QIAquick PCR purification kit (QIAGEN, 28104) and NEBNext® ChIP-seq Library Prep Master Mix Set for Illumina ® (NEB, E6240L) was used for library preparation. .. Samples were pooled and submitted to New York Genome Center or MSKCC Integrated Genomics Operation (IGO) center for SE50 sequencing using a HiSeq 2500.

    Article Title: Comprehensive epigenome characterization reveals diverse transcriptional regulation across human vascular endothelial cells
    Article Snippet: .. ChIP-seq analysis Sequencing libraries were made using the NEBNext ChIP-Seq Library Prep Master Mix Set of Illumina (New England Biolabs). ..

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Article Title: RecG Directs DNA Synthesis during Double-Strand Break Repair
    Article Snippet: .. ChIP library preparation for high-throughput sequencing Input and ChIP samples were processed following NEB’s protocol from the NEBNext ChIP-Seq library preparation kit. .. Briefly, input and ChIP-enriched DNA were subjected to end repair to fill in ssDNA overhangs, remove 3’ phosphates and phosphorylate the 5’ ends of sheared DNA.

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp. .. All libraries were sequenced with 75‐nucleotide read length paired‐end sequencing on a Illumina NextSeq 500 with 30–50 million reads being sequenced for each sample.

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: We isolated the mPFC from five mice at 3 mo of age and performed MeDIP sequencing for all five samples. .. Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech).

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation and Sequencing ... ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S).

    Article Title: Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1 [OPEN]
    Article Snippet: .. Sequencing was done in two rounds, using 50 bp single-end reads on an Illumina HiSeq 2000 platform, from a single library preparation using NEBNext ChIP-Seq Library Prep Master Mix Set (New England Biolabs) for each sample. .. The initial sequencing run produced ∼95 million reads totaling 4.76 billion bases.

    Sonication:

    Article Title: Bcl11b sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtb16
    Article Snippet: Pelleted nuclei were dissolved in lysis buffer (0.5% SDS, 10 mM EDTA, 0.5 mM EGTA, 50 mM Tris-HCl (pH 8) and PIC) and sonicated on a Bioruptor (Diagenode) for 18 cycles of 30sec sonication followed by 30sec rest, with max power. .. ChIP-seq libraries were constructed using NEBNext ChIP-Seq Library Preparation Kit (E6240, NEB) and sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt.

    ChIP-sequencing:

    Article Title: Genome-wide and parental allele-specific analysis of CTCF and cohesin DNA binding in mouse brain reveals a tissue-specific binding pattern and an association with imprinted differentially methylated regions
    Article Snippet: .. ChIP-seq libraries were prepared using the Illumina ChIP-seq library preparation kit (IP-102-1001) and the NEBNext ChIP-seq library preparation kit (E6240). .. Libraries were sized and quantified using an Agilent Bioanalyzer and a High Sensitivity Kit (5067-4626).

    Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes
    Article Snippet: .. NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England BioLabs Inc, cat. no. E6240S) NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs Inc, cat. no. E7420S) CAUTION: Formaldehyde is toxic by inhalation or if swallowed; is irritating to the skin, eyes, and respiratory system; and may be carcinogenic. ..

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Article Title: Epigenetic evolution and lineage histories of chronic lymphocytic leukemia
    Article Snippet: .. Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240, New England Biolabs, Ipswich, MA) and TruSeq Adaptors (Illumina) according to the manufacturer’s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode). .. Phusion High-Fidelity DNA Polymerase (New England Biolabs) and TruSeq PCR Primers (Illumina, San Diego, CA) were used to amplify the libraries, which were then purified to remove adaptor dimers using AMPure XP beads and multiplexed on the HiSeq 2000 (Illumina, San Diego, CA).

    Article Title: FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation
    Article Snippet: .. Library preparation ChIP-DNA was isolated by using the QIAquick PCR purification kit (QIAGEN, 28104) and NEBNext® ChIP-seq Library Prep Master Mix Set for Illumina ® (NEB, E6240L) was used for library preparation. .. Agilent Technologies 2200 TapeStation was used to determine fragment size of DNA and the concentration of DNA was measured by PicoGreen (Thermo Fisher Scientific, P7589).

    Article Title: Comprehensive epigenome characterization reveals diverse transcriptional regulation across human vascular endothelial cells
    Article Snippet: .. ChIP-seq analysis Sequencing libraries were made using the NEBNext ChIP-Seq Library Prep Master Mix Set of Illumina (New England Biolabs). ..

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Article Title: RecG Directs DNA Synthesis during Double-Strand Break Repair
    Article Snippet: .. ChIP library preparation for high-throughput sequencing Input and ChIP samples were processed following NEB’s protocol from the NEBNext ChIP-Seq library preparation kit. .. Briefly, input and ChIP-enriched DNA were subjected to end repair to fill in ssDNA overhangs, remove 3’ phosphates and phosphorylate the 5’ ends of sheared DNA.

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: .. One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp. .. All libraries were sequenced with 75‐nucleotide read length paired‐end sequencing on a Illumina NextSeq 500 with 30–50 million reads being sequenced for each sample.

    Article Title: Bcl11b sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtb16
    Article Snippet: .. ChIP-seq libraries were constructed using NEBNext ChIP-Seq Library Preparation Kit (E6240, NEB) and sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt. .. Analysis pipelines used are described below under ChIP-seq Analysis and RNA-seq Analysis.

    Article Title: Mof-associated complexes have overlapping and unique roles in regulating pluripotency in embryonic stem cells and during differentiation
    Article Snippet: Paragraph title: ChIP-seq ... To create a genomic library, we followed the instructions of NEXTFlex v12.03 (BIO Scientific) for Msl1 and the NEBNext protocol (E6240; Biolabs) for Nsl1.

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: .. Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech). .. Immunoprecipitated as well as input DNA was PCR-amplified using 2× Phusion High-Fidelity PCR Master Mix (ThermoFisher Scientific) as per the kit’s protocol.

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S). .. Briefly, 5 ng purified chromatin and 5 ng purified immunoprecipitated chromatin were used for ChIP-seq library construction.

    Article Title: Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1 [OPEN]
    Article Snippet: .. Sequencing was done in two rounds, using 50 bp single-end reads on an Illumina HiSeq 2000 platform, from a single library preparation using NEBNext ChIP-Seq Library Prep Master Mix Set (New England Biolabs) for each sample. .. The initial sequencing run produced ∼95 million reads totaling 4.76 billion bases.

    RNA Sequencing Assay:

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Barcoded, strand-specific, polyA+ selected RNA-seq libraries were generated using the Illumina TruSeq Stranded mRNA kit.

    Article Title: Bcl11b sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtb16
    Article Snippet: ChIP-seq libraries were constructed using NEBNext ChIP-Seq Library Preparation Kit (E6240, NEB) and sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt. .. Analysis pipelines used are described below under ChIP-seq Analysis and RNA-seq Analysis.

    Methylation:

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: .. Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech). .. Immunoprecipitated as well as input DNA was PCR-amplified using 2× Phusion High-Fidelity PCR Master Mix (ThermoFisher Scientific) as per the kit’s protocol.

    Isolation:

    Article Title: FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation
    Article Snippet: .. Library preparation ChIP-DNA was isolated by using the QIAquick PCR purification kit (QIAGEN, 28104) and NEBNext® ChIP-seq Library Prep Master Mix Set for Illumina ® (NEB, E6240L) was used for library preparation. .. Agilent Technologies 2200 TapeStation was used to determine fragment size of DNA and the concentration of DNA was measured by PicoGreen (Thermo Fisher Scientific, P7589).

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: We isolated the mPFC from five mice at 3 mo of age and performed MeDIP sequencing for all five samples. .. Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech).

    Size-exclusion Chromatography:

    Article Title: Genome-wide and parental allele-specific analysis of CTCF and cohesin DNA binding in mouse brain reveals a tissue-specific binding pattern and an association with imprinted differentially methylated regions
    Article Snippet: DNA was fragmented to a size appropriate for the library preparation step using the Covaris S220, samples were sheared over two cycles: 5% duty cycle, 3 intensity, 200 cycles per burst, and time of 65 sec. DNA from ChIPs performed on chromatin extracted from two mice was pooled. .. ChIP-seq libraries were prepared using the Illumina ChIP-seq library preparation kit (IP-102-1001) and the NEBNext ChIP-seq library preparation kit (E6240).

    Purification:

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: After elution and reverse-crosslinking of protein-DNA complexes, DNA was cleaned with a QIAGEN QIAquick PCR Purification Kit and quantified using the Agilent High Sensitivity DNA kit. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: Epigenetic evolution and lineage histories of chronic lymphocytic leukemia
    Article Snippet: DNA fragments were purified using Agencourt AMPure XP beads (Beckman Coulter, Brea, CA). .. Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240, New England Biolabs, Ipswich, MA) and TruSeq Adaptors (Illumina) according to the manufacturer’s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode).

    Article Title: FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation
    Article Snippet: .. Library preparation ChIP-DNA was isolated by using the QIAquick PCR purification kit (QIAGEN, 28104) and NEBNext® ChIP-seq Library Prep Master Mix Set for Illumina ® (NEB, E6240L) was used for library preparation. .. Agilent Technologies 2200 TapeStation was used to determine fragment size of DNA and the concentration of DNA was measured by PicoGreen (Thermo Fisher Scientific, P7589).

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: After elution and reverse-crosslinking of protein-DNA complexes, DNA was cleaned with a QIAGEN QIAquick PCR Purification Kit and quantified using the Agilent High Sensitivity DNA kit. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: RecG Directs DNA Synthesis during Double-Strand Break Repair
    Article Snippet: ChIP library preparation for high-throughput sequencing Input and ChIP samples were processed following NEB’s protocol from the NEBNext ChIP-Seq library preparation kit. .. After each step, the DNA was purified using the Qiagen MinElute PCR purification kit according to the manufacturer’s instructions.

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: Samples were purified using MinElute PCR Purification Kit (Qiagen, Cat#28006). .. One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp.

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S). .. Briefly, 5 ng purified chromatin and 5 ng purified immunoprecipitated chromatin were used for ChIP-seq library construction.

    Article Title: Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1 [OPEN]
    Article Snippet: After overnight incubation at 65°C, DNA was purified with a DNA & Concentrator Kit (Zymo Research). .. Sequencing was done in two rounds, using 50 bp single-end reads on an Illumina HiSeq 2000 platform, from a single library preparation using NEBNext ChIP-Seq Library Prep Master Mix Set (New England Biolabs) for each sample.

    Polymerase Chain Reaction:

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: After elution and reverse-crosslinking of protein-DNA complexes, DNA was cleaned with a QIAGEN QIAquick PCR Purification Kit and quantified using the Agilent High Sensitivity DNA kit. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: Epigenetic evolution and lineage histories of chronic lymphocytic leukemia
    Article Snippet: Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240, New England Biolabs, Ipswich, MA) and TruSeq Adaptors (Illumina) according to the manufacturer’s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode). .. Phusion High-Fidelity DNA Polymerase (New England Biolabs) and TruSeq PCR Primers (Illumina, San Diego, CA) were used to amplify the libraries, which were then purified to remove adaptor dimers using AMPure XP beads and multiplexed on the HiSeq 2000 (Illumina, San Diego, CA).

    Article Title: FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation
    Article Snippet: .. Library preparation ChIP-DNA was isolated by using the QIAquick PCR purification kit (QIAGEN, 28104) and NEBNext® ChIP-seq Library Prep Master Mix Set for Illumina ® (NEB, E6240L) was used for library preparation. .. Agilent Technologies 2200 TapeStation was used to determine fragment size of DNA and the concentration of DNA was measured by PicoGreen (Thermo Fisher Scientific, P7589).

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: After elution and reverse-crosslinking of protein-DNA complexes, DNA was cleaned with a QIAGEN QIAquick PCR Purification Kit and quantified using the Agilent High Sensitivity DNA kit. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: RecG Directs DNA Synthesis during Double-Strand Break Repair
    Article Snippet: ChIP library preparation for high-throughput sequencing Input and ChIP samples were processed following NEB’s protocol from the NEBNext ChIP-Seq library preparation kit. .. After each step, the DNA was purified using the Qiagen MinElute PCR purification kit according to the manufacturer’s instructions.

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: Samples were purified using MinElute PCR Purification Kit (Qiagen, Cat#28006). .. One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp.

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech). .. Immunoprecipitated as well as input DNA was PCR-amplified using 2× Phusion High-Fidelity PCR Master Mix (ThermoFisher Scientific) as per the kit’s protocol.

    Gel Extraction:

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: .. One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, CatE6240S) using insert size selection of 250 bp. .. All libraries were sequenced with 75‐nucleotide read length paired‐end sequencing on a Illumina NextSeq 500 with 30–50 million reads being sequenced for each sample.

    Mouse Assay:

    Article Title: Genome-wide and parental allele-specific analysis of CTCF and cohesin DNA binding in mouse brain reveals a tissue-specific binding pattern and an association with imprinted differentially methylated regions
    Article Snippet: DNA was fragmented to a size appropriate for the library preparation step using the Covaris S220, samples were sheared over two cycles: 5% duty cycle, 3 intensity, 200 cycles per burst, and time of 65 sec. DNA from ChIPs performed on chromatin extracted from two mice was pooled. .. ChIP-seq libraries were prepared using the Illumina ChIP-seq library preparation kit (IP-102-1001) and the NEBNext ChIP-seq library preparation kit (E6240).

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: We isolated the mPFC from five mice at 3 mo of age and performed MeDIP sequencing for all five samples. .. Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech).

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: Chromatin immunoprecipitation (ChIP) experiments were repeated in triplicate and 3 mice were used for each immunoprecipitation reaction. .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S).

    Chromatin Immunoprecipitation:

    Article Title: Genome-wide and parental allele-specific analysis of CTCF and cohesin DNA binding in mouse brain reveals a tissue-specific binding pattern and an association with imprinted differentially methylated regions
    Article Snippet: DNA enriched through ChIP was quantified using the Qubit (Invitrogen) and Quant-iT dsDNA high-sensitivity assay kit (Invitrogen: ) and was sized using the Agilent Bioanalyzer with a High Sensitivity DNA Bioanalyzer kit (5067-4626). .. ChIP-seq libraries were prepared using the Illumina ChIP-seq library preparation kit (IP-102-1001) and the NEBNext ChIP-seq library preparation kit (E6240).

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Each immunoprecipitation was performed using 9 μg of sheared chromatin and 5 μg of antibody (H3K27ac:ab4729, H3K4me3:ab8580) with an overnight incubation at 4°C following the Magna ChIP A/G Chromatin Immunoprecipitation Kit protocol. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: Epigenetic evolution and lineage histories of chronic lymphocytic leukemia
    Article Snippet: ChIP assays were processed on a SX-8G IP-STAR Compact Automated System (Diagenode, Denville, NJ) using a direct ChIP protocol . .. Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240, New England Biolabs, Ipswich, MA) and TruSeq Adaptors (Illumina) according to the manufacturer’s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode).

    Article Title: FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation
    Article Snippet: .. Library preparation ChIP-DNA was isolated by using the QIAquick PCR purification kit (QIAGEN, 28104) and NEBNext® ChIP-seq Library Prep Master Mix Set for Illumina ® (NEB, E6240L) was used for library preparation. .. Agilent Technologies 2200 TapeStation was used to determine fragment size of DNA and the concentration of DNA was measured by PicoGreen (Thermo Fisher Scientific, P7589).

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Each immunoprecipitation was performed using 9 μg of sheared chromatin and 5 μg of antibody (H3K27ac:ab4729, H3K4me3:ab8580) with an overnight incubation at 4°C following the Magna ChIP A/G Chromatin Immunoprecipitation Kit protocol. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: RecG Directs DNA Synthesis during Double-Strand Break Repair
    Article Snippet: .. ChIP library preparation for high-throughput sequencing Input and ChIP samples were processed following NEB’s protocol from the NEBNext ChIP-Seq library preparation kit. .. Briefly, input and ChIP-enriched DNA were subjected to end repair to fill in ssDNA overhangs, remove 3’ phosphates and phosphorylate the 5’ ends of sheared DNA.

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: For SBR, Zhbtc4 EF1α‐YPet‐Oct4 and Zhbtc4 EF1α‐Oct4‐HALO, cells were first fixed with 2 mM Disuccinimidyl glutarate (DSG) (Thermo Fisher, Cat#20593) for 50 min in PBS at room temperature before proceeding with 1% formaldehyde fixation and chromatin immunoprecipitation as described above. .. One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp.

    Article Title: Bcl11b sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtb16
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation (ChIP) and ChIP-sequencing ... ChIP-seq libraries were constructed using NEBNext ChIP-Seq Library Preparation Kit (E6240, NEB) and sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt.

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation and Sequencing ... ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S).

    Plasmid Preparation:

    Article Title: CAPTURE: In Situ Analysis of Chromatin Composition of Endogenous Genomic Loci by Biotinylated dCas9
    Article Snippet: .. pEF1α-BirA-V5-neo (Addgene plasmid 100548) pEF1α-FB-Cas9-puro (Addgene plasmid 100547) pSLQ1651-sgRNA(F+E)-sgGal4 (non-targeting control sgRNA, Addgene plasmid 100549) VSV-G (Addgene plasmid 8454) psPAX2 (Addgene plasmid 12260) LB liquid medium and agar plates with 100 μg/ml ampicillin QIAprep Spin Miniprep Kit (Qiagen) QIAquick Gel Extraction Kit (Qiagen) MinElute PCR Purification Kit (Qiagen) 10 U/μl BstxI restriction enzyme (New England Biolabs, Cat # R0113L) 10 U/μl BamHI restriction enzyme (New England Biolabs, Cat # R0136L) 10× NEBuffer 3.1 (New England Biolabs, Cat # B7203S) Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Cat # M0530L) 400 U/μl T4 ligase with 10× T4 ligase buffer (New England Biolabs, Cat # M0202L) NEBNext ChIP-seq library prep kit (New England Biolabs, Cat # E6240L) Chemically competent DH5a cells (Home-made) SOC medium (Thermo-Fisher, Cat # 15544034) 37°C incubator (Thermo-Fisher) SORVALL ST16R centrifuge (Thermo-Fisher) Thermomixer (Eppendorf) Thermocycler (Bio-Rad) PEI (Sigma-Aldrich, Polyethylenimine, Branched, Cat # 408727) 16,16-dimethyl Prostaglandin E2 (PGE2, 10 mM in DMSO) (Cayman Chemical Company, Cat # 14750) PEG-it Virus Precipitation Solution (System Bioscience, Cat # LV825A-1) IMDM (Thermo-Fisher, Cat # 12440053) Opti-MEM (Thermo-Fisher, Cat # 31985062) Puromycin (Thermo-Fisher, Cat # A1003802) G418 (Sigma-Aldrich, Cat # G1720) 37% formaldehyde solution (Calbiochem, Cat # 344198) Protease inhibitor cocktail (Sigma-Aldrich, Cat # P8340) Dynabeads® MyOne™ Streptavidin T1 (Invitrogen, Cat # 656-01) RNase A, DNase-free (0.5 mg/ml, Roche, Cat # 11119915001) Proteinase K (20 mg/ml, Ambion, Cat # AM2546) Cas9 antibody (Abcam, ab191468, RRID:AB_2692325) V5-HRP antibody (Thermo-Fisher, Cat # R961-25, RRID:AB_2556565) Goat anti-mouse IgG-HRP (Santa Cruz, Cat # sc-2005, and RRID:AB_631736) ECM 830 Square Wave Electroporation System (BTX) 2 mm electroporation cuvette (BTX, Cat # 45-0141) Digital Sonifier (BRANSON, Models S-450) sgGal4_sgRNA.fwd (non-targeting control sgRNA): ggagaaCCACCTTGTTGG AACGACTAGTTAGGCGTGTA GTTTAAGAGCTATGCTGGAAACAGCA (G NX is the spacer sequence which can be changed for targeting any locus) Universal.rev: ctagtaCTCGAGAAAAAAAGCACCGACTCGGTGCCAC Primer sequences used to validate sgRNA sequence by sanger DNA sequencing: U6-Vector_seq.fwd: GAGATCCAGTTTGGTTAGTACCGGG U6-Vector_seq.rev: ATGCATGGCGGTAATACGGTTAT ..

    Multiplex Assay:

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S). .. Briefly, 5 ng purified chromatin and 5 ng purified immunoprecipitated chromatin were used for ChIP-seq library construction.

    Selection:

    Article Title: Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions
    Article Snippet: .. One replicate of each ChIP‐seq library was prepared with NEBNext ChIP‐seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp. .. All libraries were sequenced with 75‐nucleotide read length paired‐end sequencing on a Illumina NextSeq 500 with 30–50 million reads being sequenced for each sample.

    Next-Generation Sequencing:

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Spectrophotometry:

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Shearing efficiency was assessed using the Agilent High Sensitivity DNA kit and chromatin concentration was determined using a NanoDrop Spectrophotometer. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: Shearing efficiency was assessed using the Agilent High Sensitivity DNA kit and chromatin concentration was determined using a NanoDrop Spectrophotometer. .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina.

    Produced:

    Article Title: Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1Isolation of Open Chromatin Identifies Regulators of Systemic Acquired Resistance 1 [OPEN]
    Article Snippet: Sequencing was done in two rounds, using 50 bp single-end reads on an Illumina HiSeq 2000 platform, from a single library preparation using NEBNext ChIP-Seq Library Prep Master Mix Set (New England Biolabs) for each sample. .. The initial sequencing run produced ∼95 million reads totaling 4.76 billion bases.

    Immunoprecipitation:

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Article Title: Epigenetic evolution and lineage histories of chronic lymphocytic leukemia
    Article Snippet: .. Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (#E6240, New England Biolabs, Ipswich, MA) and TruSeq Adaptors (Illumina) according to the manufacturer’s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode). .. Phusion High-Fidelity DNA Polymerase (New England Biolabs) and TruSeq PCR Primers (Illumina, San Diego, CA) were used to amplify the libraries, which were then purified to remove adaptor dimers using AMPure XP beads and multiplexed on the HiSeq 2000 (Illumina, San Diego, CA).

    Article Title: Genetic and Epigenetic Fine Mapping of Complex Trait Associated Loci in the Human Liver
    Article Snippet: .. 2 or 5 ng of immunoprecipitated and input DNA was used to generate sequencing libraries using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina. .. Libraries were sequenced to generate 100 bp single-end reads on Illumina HiSeq2500 instruments at the Penn Next-Generation Sequencing Core.

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: .. Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech). .. Immunoprecipitated as well as input DNA was PCR-amplified using 2× Phusion High-Fidelity PCR Master Mix (ThermoFisher Scientific) as per the kit’s protocol.

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: Chromatin immunoprecipitation (ChIP) experiments were repeated in triplicate and 3 mice were used for each immunoprecipitation reaction. .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S).

    Methylated DNA Immunoprecipitation:

    Article Title: HDAC1 links early life stress to schizophrenia-like phenotypes
    Article Snippet: Paragraph title: MeDIP. ... Briefly, 200 ng of sheared genomic DNA was end-repaired and adaptor-ligated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (E6240 kit; New England Biolabs), followed by the immunoprecipitation of methylated regions using 5-mC monoclonal antibody (BI-MECY-0100; Eurogentech).

    High Throughput Screening Assay:

    Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes
    Article Snippet: Paragraph title: Additional materials for DNA and RNA high-throughput sequencing methods ... NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England BioLabs Inc, cat. no. E6240S) NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs Inc, cat. no. E7420S) CAUTION: Formaldehyde is toxic by inhalation or if swallowed; is irritating to the skin, eyes, and respiratory system; and may be carcinogenic.

    Article Title: RecG Directs DNA Synthesis during Double-Strand Break Repair
    Article Snippet: .. ChIP library preparation for high-throughput sequencing Input and ChIP samples were processed following NEB’s protocol from the NEBNext ChIP-Seq library preparation kit. .. Briefly, input and ChIP-enriched DNA were subjected to end repair to fill in ssDNA overhangs, remove 3’ phosphates and phosphorylate the 5’ ends of sheared DNA.

    Lysis:

    Article Title: Bcl11b sets pro-T cell fate by site-specific cofactor recruitment and by repressing Id2 and Zbtb16
    Article Snippet: Pelleted nuclei were dissolved in lysis buffer (0.5% SDS, 10 mM EDTA, 0.5 mM EGTA, 50 mM Tris-HCl (pH 8) and PIC) and sonicated on a Bioruptor (Diagenode) for 18 cycles of 30sec sonication followed by 30sec rest, with max power. .. ChIP-seq libraries were constructed using NEBNext ChIP-Seq Library Preparation Kit (E6240, NEB) and sequenced on Illumina HiSeq2500 in single read mode with the read length of 50 nt.

    Article Title: Astrocyte-Specific Deletion of Sox2 Promotes Functional Recovery After Traumatic Brain Injury
    Article Snippet: Pellets were resuspended in 10 ml of lysis buffer II (10 mM Tris–HCL [pH 8.0], 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, and protease inhibitor) and incubated with gentle rocking for 5 min at 4 °C. .. ChIP-seq libraries were generated using a NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina (New England Biolabs, E6240S) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, E7335S).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs chip seq library preparation kit
    Chip Seq Library Preparation Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chip seq library preparation kit/product/New England Biolabs
    Average 99 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    chip seq library preparation kit - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results