e coli cell free translation system  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    NEBExpress Cell free E coli Protein Synthesis System
    Description:
    The NEBExpressTM Cell free E coli Protein Synthesis System is a coupled transcription translation system designed to synthesize proteins encoded by a DNA template under the control of a T7 RNA Polymerase promoter The system offers high expression levels the ability to produce high molecular weight proteins scalability and is cost effective for high throughput expression applications The speed and robustness of the system facilitates protein synthesis in applications such as protein engineering mutagenesis studies and enzyme screening
    Catalog Number:
    E5360L
    Price:
    1700
    Category:
    Transcription Translation Systems
    Size:
    100 rxns
    Buy from Supplier


    Structured Review

    New England Biolabs e coli cell free translation system
    NEBExpress Cell free E coli Protein Synthesis System
    The NEBExpressTM Cell free E coli Protein Synthesis System is a coupled transcription translation system designed to synthesize proteins encoded by a DNA template under the control of a T7 RNA Polymerase promoter The system offers high expression levels the ability to produce high molecular weight proteins scalability and is cost effective for high throughput expression applications The speed and robustness of the system facilitates protein synthesis in applications such as protein engineering mutagenesis studies and enzyme screening
    https://www.bioz.com/result/e coli cell free translation system/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli cell free translation system - by Bioz Stars, 2021-05
    95/100 stars

    Images

    1) Product Images from "Ribosomes slide on lysine-encoding homopolymeric A stretches"

    Article Title: Ribosomes slide on lysine-encoding homopolymeric A stretches

    Journal: eLife

    doi: 10.7554/eLife.05534

    Quantification of the efficiency of ribosome sliding on mCherry reporters expressed in the PURExpress system. mCherry reporters ( Figure 1A : no insert, and various A stretches) were expressed in the PURExpress cell-free translation system ( Figure 5 ). The plot reports the percent of truncated peptide product expressed relative to total peptide product for each reporter (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.016
    Figure Legend Snippet: Quantification of the efficiency of ribosome sliding on mCherry reporters expressed in the PURExpress system. mCherry reporters ( Figure 1A : no insert, and various A stretches) were expressed in the PURExpress cell-free translation system ( Figure 5 ). The plot reports the percent of truncated peptide product expressed relative to total peptide product for each reporter (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.016

    Techniques Used: Radioactivity

    Truncated product release is independent of RF3 in the PURExpress cell-free translation system. mCherry reporters ( Figure 1A : no insert, AAG 12 , AAA 12 ) were expressed in the PURExpress cell-free translation system lacking release factors (RFs) (light gray). RFs were added back to the reactions individually (RF1 in green, RF2 in purple), and in combination (RF1/3 in red and Rf2/3 dark gray). The plot displays the fraction of protein in the truncated band (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.013
    Figure Legend Snippet: Truncated product release is independent of RF3 in the PURExpress cell-free translation system. mCherry reporters ( Figure 1A : no insert, AAG 12 , AAA 12 ) were expressed in the PURExpress cell-free translation system lacking release factors (RFs) (light gray). RFs were added back to the reactions individually (RF1 in green, RF2 in purple), and in combination (RF1/3 in red and Rf2/3 dark gray). The plot displays the fraction of protein in the truncated band (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.013

    Techniques Used: Radioactivity

    2) Product Images from "RTP4 inhibits IFN-I response and enhances experimental cerebral malaria and neuropathology"

    Article Title: RTP4 inhibits IFN-I response and enhances experimental cerebral malaria and neuropathology

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.2006492117

    Interaction of RTP4 with STING, MAVS, TBK1, and IRF3 in vitro. The 293T cells (1 × 10 6 ) were cotransfected with plasmids encoding RTP4 and STING, MAVS, TBK1, IRF3, or TRAFs (1 μg each) tagged with either HA, MYC, or V5. The tagged molecules were pulled down and detected using anti-tag antibodies. IP, indicating antibody used in immunoprecipitation; lysate, total proteins from cell lysis; β-actin was used as protein loading control. ( A – F ) The co-IP and protein expression levels as indicated for STING ( A ), MAVS ( B ), IRF3 ( C ), TBK1 ( D ), TRAF2, TRAF3, and TRAF6 ( E ), and MDA5/RIG-I ( F ). ( G and H ) 239T cells (1 × 10 7 ) were transfected with 5 μg of RTP4-HA plasmid only, and anti-TBK1 or anti-IRF3 mouse antibody was used to pull down TBK1 and IRF3, respectively. RTP4 was detected using anti-HA antibody. Mouse IgG was used as control for potential nonspecific binding in the pulldown experiments. Note: The band in the IgG lane in H is likely a IgG heavy chain. ( I and J ) HA- or MYC-tagged RTP4, TBK1, or IRF3 were synthesized in vitro using a cell-free protein expression system (PURExpress, NEB). Anti-HA or anti-MYC antibodies were then used to pull down RTP4. TBK1 and IRF3 were detected using anti-MYC ( I , TBK1) and anti-HA ( J , IRF3).
    Figure Legend Snippet: Interaction of RTP4 with STING, MAVS, TBK1, and IRF3 in vitro. The 293T cells (1 × 10 6 ) were cotransfected with plasmids encoding RTP4 and STING, MAVS, TBK1, IRF3, or TRAFs (1 μg each) tagged with either HA, MYC, or V5. The tagged molecules were pulled down and detected using anti-tag antibodies. IP, indicating antibody used in immunoprecipitation; lysate, total proteins from cell lysis; β-actin was used as protein loading control. ( A – F ) The co-IP and protein expression levels as indicated for STING ( A ), MAVS ( B ), IRF3 ( C ), TBK1 ( D ), TRAF2, TRAF3, and TRAF6 ( E ), and MDA5/RIG-I ( F ). ( G and H ) 239T cells (1 × 10 7 ) were transfected with 5 μg of RTP4-HA plasmid only, and anti-TBK1 or anti-IRF3 mouse antibody was used to pull down TBK1 and IRF3, respectively. RTP4 was detected using anti-HA antibody. Mouse IgG was used as control for potential nonspecific binding in the pulldown experiments. Note: The band in the IgG lane in H is likely a IgG heavy chain. ( I and J ) HA- or MYC-tagged RTP4, TBK1, or IRF3 were synthesized in vitro using a cell-free protein expression system (PURExpress, NEB). Anti-HA or anti-MYC antibodies were then used to pull down RTP4. TBK1 and IRF3 were detected using anti-MYC ( I , TBK1) and anti-HA ( J , IRF3).

    Techniques Used: In Vitro, Immunoprecipitation, Lysis, Co-Immunoprecipitation Assay, Expressing, Transfection, Plasmid Preparation, Binding Assay, Synthesized

    3) Product Images from "Low-cost detection of norovirus using paper-based cell-free systems and synbody-based viral enrichment"

    Article Title: Low-cost detection of norovirus using paper-based cell-free systems and synbody-based viral enrichment

    Journal: Synthetic Biology (Oxford, England)

    doi: 10.1093/synbio/ysy018

    Overview of the norovirus detection assay using paper-based cell-free transcription–translation reactions. A norovirus sample is first enriched using synbodies and viral RNA amplified isothermally using nucleic acid sequence-based amplification (NASBA) or reverse transcriptase recombinase polymerase amplification (RT-RPA). The amplified nucleic acids are added to paper-based cell-free reactions where norovirus RNAs are detected by sequence-specific toehold switches. The toehold switches generate the lacZɑ peptide, which produces a purple-colored product after complementation with lacZω. Samples positive for norovirus can be identified by their purple color following the assay.
    Figure Legend Snippet: Overview of the norovirus detection assay using paper-based cell-free transcription–translation reactions. A norovirus sample is first enriched using synbodies and viral RNA amplified isothermally using nucleic acid sequence-based amplification (NASBA) or reverse transcriptase recombinase polymerase amplification (RT-RPA). The amplified nucleic acids are added to paper-based cell-free reactions where norovirus RNAs are detected by sequence-specific toehold switches. The toehold switches generate the lacZɑ peptide, which produces a purple-colored product after complementation with lacZω. Samples positive for norovirus can be identified by their purple color following the assay.

    Techniques Used: Detection Assay, Amplification, Sequencing, Recombinase Polymerase Amplification

    4) Product Images from "Ribosomes slide on lysine-encoding homopolymeric A stretches"

    Article Title: Ribosomes slide on lysine-encoding homopolymeric A stretches

    Journal: eLife

    doi: 10.7554/eLife.05534

    Quantification of the efficiency of ribosome sliding on mCherry reporters expressed in the PURExpress system. mCherry reporters ( Figure 1A : no insert, and various A stretches) were expressed in the PURExpress cell-free translation system ( Figure 5 ). The plot reports the percent of truncated peptide product expressed relative to total peptide product for each reporter (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.016
    Figure Legend Snippet: Quantification of the efficiency of ribosome sliding on mCherry reporters expressed in the PURExpress system. mCherry reporters ( Figure 1A : no insert, and various A stretches) were expressed in the PURExpress cell-free translation system ( Figure 5 ). The plot reports the percent of truncated peptide product expressed relative to total peptide product for each reporter (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.016

    Techniques Used: Radioactivity

    Truncated product release is independent of RF3 in the PURExpress cell-free translation system. mCherry reporters ( Figure 1A : no insert, AAG 12 , AAA 12 ) were expressed in the PURExpress cell-free translation system lacking release factors (RFs) (light gray). RFs were added back to the reactions individually (RF1 in green, RF2 in purple), and in combination (RF1/3 in red and Rf2/3 dark gray). The plot displays the fraction of protein in the truncated band (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.013
    Figure Legend Snippet: Truncated product release is independent of RF3 in the PURExpress cell-free translation system. mCherry reporters ( Figure 1A : no insert, AAG 12 , AAA 12 ) were expressed in the PURExpress cell-free translation system lacking release factors (RFs) (light gray). RFs were added back to the reactions individually (RF1 in green, RF2 in purple), and in combination (RF1/3 in red and Rf2/3 dark gray). The plot displays the fraction of protein in the truncated band (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.013

    Techniques Used: Radioactivity

    5) Product Images from "The ribosome modulates folding inside the ribosomal exit tunnel"

    Article Title: The ribosome modulates folding inside the ribosomal exit tunnel

    Journal: bioRxiv

    doi: 10.1101/2020.06.30.180224

    Experimental setup. (A) Structure of zinc-finger protein domain ADR1a (PDB: 2ADR). The Zn 2+ ion is depicted as a blue sphere. (B) The construct used in this study. ADR1a was synthesized in a cell-free system in two reaction steps. Transcription/translation reaction 1 (R1) incorporated biotin at the N-terminal amber stop codon with protein synthesis stalled at the His tag. After addition of histidine, protein synthesis continued and transcription/translation reaction 2 (R2) incorporated the donor dye TAMRA and the acceptor dye Atto633 at the two termini of ADR1a. The SecMstr arrest peptide ensured that the fully synthesized protein remained bound following translation. (C) Cartoon of experimental setup at the optical tweezers, where a depicts the DNA handles, b the mRNA of the stalled construct and c the SecMstr-stalled nascent chain.
    Figure Legend Snippet: Experimental setup. (A) Structure of zinc-finger protein domain ADR1a (PDB: 2ADR). The Zn 2+ ion is depicted as a blue sphere. (B) The construct used in this study. ADR1a was synthesized in a cell-free system in two reaction steps. Transcription/translation reaction 1 (R1) incorporated biotin at the N-terminal amber stop codon with protein synthesis stalled at the His tag. After addition of histidine, protein synthesis continued and transcription/translation reaction 2 (R2) incorporated the donor dye TAMRA and the acceptor dye Atto633 at the two termini of ADR1a. The SecMstr arrest peptide ensured that the fully synthesized protein remained bound following translation. (C) Cartoon of experimental setup at the optical tweezers, where a depicts the DNA handles, b the mRNA of the stalled construct and c the SecMstr-stalled nascent chain.

    Techniques Used: Construct, Synthesized

    6) Product Images from "The role of small proteins in Burkholderia cenocepacia J2315 biofilm formation, persistence and intracellular growth"

    Article Title: The role of small proteins in Burkholderia cenocepacia J2315 biofilm formation, persistence and intracellular growth

    Journal: Biofilm

    doi: 10.1016/j.bioflm.2019.100001

    (a) The BCAM0271-2 gene pair constitutes a type II TA system. Overnight cultures of E. coli strains expressing BCAM0272 or BCAM0271-2 were serially diluted (10 −3 to 10 −8 , left to right). Dilutions were spotted on LBA with repressor (glucose 0.2%) and inducer (arabinose 0.2% (w/v) or rhamnose 0.2% (w/v)). (b). Synthesis of GFP-StrepII reporter protein expressed from the T7 promoter in an in vitro transcription-translation system in presence of BCAM0272 with (+) and without (−) acetyl-Coenzyme A. Products of reaction resolved by SDS-PAGE and visualised by Western Blot with anti-strepII-tag antibodies. (c) Acetylation of tRNA pool in an in vitro transcription-translation system by different GNAT toxins with (+) and without (−) [14C]acetyl-Coenzyme A. RNAs resolved by native PAGE and stained with methylene blue (top panel), gel was then dried and exposed to phosphor storage screen (bottom panel).
    Figure Legend Snippet: (a) The BCAM0271-2 gene pair constitutes a type II TA system. Overnight cultures of E. coli strains expressing BCAM0272 or BCAM0271-2 were serially diluted (10 −3 to 10 −8 , left to right). Dilutions were spotted on LBA with repressor (glucose 0.2%) and inducer (arabinose 0.2% (w/v) or rhamnose 0.2% (w/v)). (b). Synthesis of GFP-StrepII reporter protein expressed from the T7 promoter in an in vitro transcription-translation system in presence of BCAM0272 with (+) and without (−) acetyl-Coenzyme A. Products of reaction resolved by SDS-PAGE and visualised by Western Blot with anti-strepII-tag antibodies. (c) Acetylation of tRNA pool in an in vitro transcription-translation system by different GNAT toxins with (+) and without (−) [14C]acetyl-Coenzyme A. RNAs resolved by native PAGE and stained with methylene blue (top panel), gel was then dried and exposed to phosphor storage screen (bottom panel).

    Techniques Used: Expressing, In Vitro, SDS Page, Western Blot, Clear Native PAGE, Staining

    7) Product Images from "Noninvasive Prenatal Measurement of the Fetal Genome"

    Article Title: Noninvasive Prenatal Measurement of the Fetal Genome

    Journal: Nature

    doi: 10.1038/nature11251

    Molecular counting strategies for measuring the fetal genome noninvasively from maternal blood only. Genome-wide, chromosome length haplotypes of the mother are obtained using direct deterministic phasing. The inheritance of maternal haplotypes is revealed by sequencing maternal plasma DNA and summing the count of the alleles specific to each haplotype at heterozygous loci and determining the relative representation of the two alleles. The inherited paternal haplotypes are defined by the paternal specific alleles (i.e. those that are different from the maternal ones at positions where the mother is homozygous). The allelic identity at loci linked to the paternal specific alleles on the paternal haplotype can be imputed. Alternatively, molecular counting can be applied directly to count alleles at individual locus to determine fetal genotypes via targeted deep sequencing, such as exome enriched sequencing of maternal plasma DNA. For illustrative purpose, each locus is biallelic and carries the ‘A’ or ‘G’ alleles.
    Figure Legend Snippet: Molecular counting strategies for measuring the fetal genome noninvasively from maternal blood only. Genome-wide, chromosome length haplotypes of the mother are obtained using direct deterministic phasing. The inheritance of maternal haplotypes is revealed by sequencing maternal plasma DNA and summing the count of the alleles specific to each haplotype at heterozygous loci and determining the relative representation of the two alleles. The inherited paternal haplotypes are defined by the paternal specific alleles (i.e. those that are different from the maternal ones at positions where the mother is homozygous). The allelic identity at loci linked to the paternal specific alleles on the paternal haplotype can be imputed. Alternatively, molecular counting can be applied directly to count alleles at individual locus to determine fetal genotypes via targeted deep sequencing, such as exome enriched sequencing of maternal plasma DNA. For illustrative purpose, each locus is biallelic and carries the ‘A’ or ‘G’ alleles.

    Techniques Used: Genome Wide, Sequencing

    Exome sequencing of P1 maternal plasma DNA in all three trimesters to determine maternal and fetal genotypes.. A-C . Histograms of minor allele fraction in maternal plasma from all three trimesters of P1 at positions that are confidently called in both plasma sequencing data and pure fetal/maternal DNA genotyping data. Insets: ROC curves of positions detecting fetal genotypes differing from maternal genotype when the maternal position is either homozygous or heterozygous. The higher the fetal fraction (~6, 20, 26% for Trimester 1–3), the more the distributions are separated, and the easier it is to distinguish between the two distributions of fetal genotype. D . Histogram of per-position coverage, with bin size of 5. Exome positions > 100X are 75%, 78%, and 90% respectively for Trimester 1–3 and > 200X are 48%, 56%, and 84%. E-F . ROCs curves at genomic positions where mother is heterozygous ( E ) or homozygous ( F ), using either sequencing or SNP array of pure DNA as references for maternal and fetal genotypes. ‘SeqRef’ uses a sequenced reference, ‘Array’ uses a SNP array, and ‘SeqRef-Array’ uses a sequenced reference only at positions on a SNP array.
    Figure Legend Snippet: Exome sequencing of P1 maternal plasma DNA in all three trimesters to determine maternal and fetal genotypes.. A-C . Histograms of minor allele fraction in maternal plasma from all three trimesters of P1 at positions that are confidently called in both plasma sequencing data and pure fetal/maternal DNA genotyping data. Insets: ROC curves of positions detecting fetal genotypes differing from maternal genotype when the maternal position is either homozygous or heterozygous. The higher the fetal fraction (~6, 20, 26% for Trimester 1–3), the more the distributions are separated, and the easier it is to distinguish between the two distributions of fetal genotype. D . Histogram of per-position coverage, with bin size of 5. Exome positions > 100X are 75%, 78%, and 90% respectively for Trimester 1–3 and > 200X are 48%, 56%, and 84%. E-F . ROCs curves at genomic positions where mother is heterozygous ( E ) or homozygous ( F ), using either sequencing or SNP array of pure DNA as references for maternal and fetal genotypes. ‘SeqRef’ uses a sequenced reference, ‘Array’ uses a SNP array, and ‘SeqRef-Array’ uses a sequenced reference only at positions on a SNP array.

    Techniques Used: Sequencing

    Related Articles

    Concentration Assay:

    Article Title: Low-cost detection of norovirus using paper-based cell-free systems and synbody-based viral enrichment
    Article Snippet: This table also contains the primers used for Sanger sequencing of the plasmids. .. Cell-free transcription–translation systems (NEB, PURExpress) were prepared for freeze-drying with the following components by volume: cell-free solution A, 40%; cell-free solution B, 30%; RNase Inhibitor (Roche, 03335402001, distributed by MilliporeSigma), 2%; chlorophenol red-b-D-galactopyranoside (Roche, 10884308001, distributed by MilliporeSigma, 24 mg/ml), 2.5%; with the remaining volume reserved for toehold switch DNA, water and lacZω peptide added to a final concentration of 2 µM. .. When testing the toehold switches expressed from a plasmid, the plasmid DNA was added to the cell-free reaction mix to a final concentration of 30 ng/µl.

    Activity Assay:

    Article Title: A Multiplexed, Electrochemical Interface for Gene Circuit-Based Sensors
    Article Snippet: .. We screened 66 commercially available restriction enzymes for cleavage activity under buffer conditions required for the cell-free transcription and translation system ( , ) . .. The ability of restriction enzymes to cleave target DNA was evaluated using gel electrophoresis (data not shown).

    Expressing:

    Article Title: RTP4 inhibits IFN-I response and enhances experimental cerebral malaria and neuropathology
    Article Snippet: .. To identify the specific RTP4 interacting partners, we used a cell-free protein expression system (PURExpress, NEB) to synthesize HA- or MYC-tagged RTP4, TBK1, or IRF3 in vitro and anti-HA or anti-MYC antibodies to pull down RTP4. ..

    In Vitro:

    Article Title: RTP4 inhibits IFN-I response and enhances experimental cerebral malaria and neuropathology
    Article Snippet: .. To identify the specific RTP4 interacting partners, we used a cell-free protein expression system (PURExpress, NEB) to synthesize HA- or MYC-tagged RTP4, TBK1, or IRF3 in vitro and anti-HA or anti-MYC antibodies to pull down RTP4. ..

    Article Title: The role of small proteins in Burkholderia cenocepacia J2315 biofilm formation, persistence and intracellular growth
    Article Snippet: .. Assessing tRNA acetylation and synthesis of GFP-StrepII reporter protein expressed from the T7 promoter in an in vitro transcription-translation system. .. The DNA fragment for synthesizing the BCAM0272 toxin in vitro in a coupled transcription-translation reaction (PurEXPRESS, NEB) was amplified using oligos 5′UTR-BCAM0272 (GCGAATTAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATATGAGCGGTGCGCAGTTGG) and 3′UTR-BCAM0272-strepII (AAACCCCTCCGTTTAGAGAGGGGTTATGCTAGTTATTATTTTTCGAACTGCGGGTGGCTCCACTTCACCGTTGCCAATGGCAT).

    Article Title: Ribosomes slide on lysine-encoding homopolymeric A stretches
    Article Snippet: Toeprinting assays DNA templates were PCR amplified from plasmids (PCR-Blunt II-TOPO vector) encoding MEA(insert )EAEDYKDD sequences. .. The PURExpress cell-free transcription-translation system (NEB, Ipswich, MA) was used for in vitro protein synthesis. ..

    In Vivo:

    Article Title: Ribosomes slide on lysine-encoding homopolymeric A stretches
    Article Snippet: .. Ribosomes slide on poly(A)-containing reporters in an E. coli cell-free translation system The initial in vivo observation that protein production is more severely impacted by iterated AAA than AAG codons ( ) was recapitulated using the PURExpress E. coli cell-free translation system (NEB) ( ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs e coli cell free translation system
    Quantification of the efficiency of ribosome sliding on mCherry reporters expressed in the PURExpress <t>system.</t> mCherry reporters ( Figure 1A : no insert, and various A stretches) were expressed in the PURExpress <t>cell-free</t> <t>translation</t> system ( Figure 5 ). The plot reports the percent of truncated peptide product expressed relative to total peptide product for each reporter (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.016
    E Coli Cell Free Translation System, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli cell free translation system/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli cell free translation system - by Bioz Stars, 2021-05
    95/100 stars
      Buy from Supplier

    Image Search Results


    Quantification of the efficiency of ribosome sliding on mCherry reporters expressed in the PURExpress system. mCherry reporters ( Figure 1A : no insert, and various A stretches) were expressed in the PURExpress cell-free translation system ( Figure 5 ). The plot reports the percent of truncated peptide product expressed relative to total peptide product for each reporter (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.016

    Journal: eLife

    Article Title: Ribosomes slide on lysine-encoding homopolymeric A stretches

    doi: 10.7554/eLife.05534

    Figure Lengend Snippet: Quantification of the efficiency of ribosome sliding on mCherry reporters expressed in the PURExpress system. mCherry reporters ( Figure 1A : no insert, and various A stretches) were expressed in the PURExpress cell-free translation system ( Figure 5 ). The plot reports the percent of truncated peptide product expressed relative to total peptide product for each reporter (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.016

    Article Snippet: Ribosomes slide on poly(A)-containing reporters in an E. coli cell-free translation system The initial in vivo observation that protein production is more severely impacted by iterated AAA than AAG codons ( ) was recapitulated using the PURExpress E. coli cell-free translation system (NEB) ( ).

    Techniques: Radioactivity

    Truncated product release is independent of RF3 in the PURExpress cell-free translation system. mCherry reporters ( Figure 1A : no insert, AAG 12 , AAA 12 ) were expressed in the PURExpress cell-free translation system lacking release factors (RFs) (light gray). RFs were added back to the reactions individually (RF1 in green, RF2 in purple), and in combination (RF1/3 in red and Rf2/3 dark gray). The plot displays the fraction of protein in the truncated band (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.013

    Journal: eLife

    Article Title: Ribosomes slide on lysine-encoding homopolymeric A stretches

    doi: 10.7554/eLife.05534

    Figure Lengend Snippet: Truncated product release is independent of RF3 in the PURExpress cell-free translation system. mCherry reporters ( Figure 1A : no insert, AAG 12 , AAA 12 ) were expressed in the PURExpress cell-free translation system lacking release factors (RFs) (light gray). RFs were added back to the reactions individually (RF1 in green, RF2 in purple), and in combination (RF1/3 in red and Rf2/3 dark gray). The plot displays the fraction of protein in the truncated band (100% × (radioactivity in truncated band)/(radioactivity in truncated + full-length bands)). DOI: http://dx.doi.org/10.7554/eLife.05534.013

    Article Snippet: Ribosomes slide on poly(A)-containing reporters in an E. coli cell-free translation system The initial in vivo observation that protein production is more severely impacted by iterated AAA than AAG codons ( ) was recapitulated using the PURExpress E. coli cell-free translation system (NEB) ( ).

    Techniques: Radioactivity

    Interaction of RTP4 with STING, MAVS, TBK1, and IRF3 in vitro. The 293T cells (1 × 10 6 ) were cotransfected with plasmids encoding RTP4 and STING, MAVS, TBK1, IRF3, or TRAFs (1 μg each) tagged with either HA, MYC, or V5. The tagged molecules were pulled down and detected using anti-tag antibodies. IP, indicating antibody used in immunoprecipitation; lysate, total proteins from cell lysis; β-actin was used as protein loading control. ( A – F ) The co-IP and protein expression levels as indicated for STING ( A ), MAVS ( B ), IRF3 ( C ), TBK1 ( D ), TRAF2, TRAF3, and TRAF6 ( E ), and MDA5/RIG-I ( F ). ( G and H ) 239T cells (1 × 10 7 ) were transfected with 5 μg of RTP4-HA plasmid only, and anti-TBK1 or anti-IRF3 mouse antibody was used to pull down TBK1 and IRF3, respectively. RTP4 was detected using anti-HA antibody. Mouse IgG was used as control for potential nonspecific binding in the pulldown experiments. Note: The band in the IgG lane in H is likely a IgG heavy chain. ( I and J ) HA- or MYC-tagged RTP4, TBK1, or IRF3 were synthesized in vitro using a cell-free protein expression system (PURExpress, NEB). Anti-HA or anti-MYC antibodies were then used to pull down RTP4. TBK1 and IRF3 were detected using anti-MYC ( I , TBK1) and anti-HA ( J , IRF3).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: RTP4 inhibits IFN-I response and enhances experimental cerebral malaria and neuropathology

    doi: 10.1073/pnas.2006492117

    Figure Lengend Snippet: Interaction of RTP4 with STING, MAVS, TBK1, and IRF3 in vitro. The 293T cells (1 × 10 6 ) were cotransfected with plasmids encoding RTP4 and STING, MAVS, TBK1, IRF3, or TRAFs (1 μg each) tagged with either HA, MYC, or V5. The tagged molecules were pulled down and detected using anti-tag antibodies. IP, indicating antibody used in immunoprecipitation; lysate, total proteins from cell lysis; β-actin was used as protein loading control. ( A – F ) The co-IP and protein expression levels as indicated for STING ( A ), MAVS ( B ), IRF3 ( C ), TBK1 ( D ), TRAF2, TRAF3, and TRAF6 ( E ), and MDA5/RIG-I ( F ). ( G and H ) 239T cells (1 × 10 7 ) were transfected with 5 μg of RTP4-HA plasmid only, and anti-TBK1 or anti-IRF3 mouse antibody was used to pull down TBK1 and IRF3, respectively. RTP4 was detected using anti-HA antibody. Mouse IgG was used as control for potential nonspecific binding in the pulldown experiments. Note: The band in the IgG lane in H is likely a IgG heavy chain. ( I and J ) HA- or MYC-tagged RTP4, TBK1, or IRF3 were synthesized in vitro using a cell-free protein expression system (PURExpress, NEB). Anti-HA or anti-MYC antibodies were then used to pull down RTP4. TBK1 and IRF3 were detected using anti-MYC ( I , TBK1) and anti-HA ( J , IRF3).

    Article Snippet: To identify the specific RTP4 interacting partners, we used a cell-free protein expression system (PURExpress, NEB) to synthesize HA- or MYC-tagged RTP4, TBK1, or IRF3 in vitro and anti-HA or anti-MYC antibodies to pull down RTP4.

    Techniques: In Vitro, Immunoprecipitation, Lysis, Co-Immunoprecipitation Assay, Expressing, Transfection, Plasmid Preparation, Binding Assay, Synthesized

    Overview of the norovirus detection assay using paper-based cell-free transcription–translation reactions. A norovirus sample is first enriched using synbodies and viral RNA amplified isothermally using nucleic acid sequence-based amplification (NASBA) or reverse transcriptase recombinase polymerase amplification (RT-RPA). The amplified nucleic acids are added to paper-based cell-free reactions where norovirus RNAs are detected by sequence-specific toehold switches. The toehold switches generate the lacZɑ peptide, which produces a purple-colored product after complementation with lacZω. Samples positive for norovirus can be identified by their purple color following the assay.

    Journal: Synthetic Biology (Oxford, England)

    Article Title: Low-cost detection of norovirus using paper-based cell-free systems and synbody-based viral enrichment

    doi: 10.1093/synbio/ysy018

    Figure Lengend Snippet: Overview of the norovirus detection assay using paper-based cell-free transcription–translation reactions. A norovirus sample is first enriched using synbodies and viral RNA amplified isothermally using nucleic acid sequence-based amplification (NASBA) or reverse transcriptase recombinase polymerase amplification (RT-RPA). The amplified nucleic acids are added to paper-based cell-free reactions where norovirus RNAs are detected by sequence-specific toehold switches. The toehold switches generate the lacZɑ peptide, which produces a purple-colored product after complementation with lacZω. Samples positive for norovirus can be identified by their purple color following the assay.

    Article Snippet: Cell-free transcription–translation systems (NEB, PURExpress) were prepared for freeze-drying with the following components by volume: cell-free solution A, 40%; cell-free solution B, 30%; RNase Inhibitor (Roche, 03335402001, distributed by MilliporeSigma), 2%; chlorophenol red-b-D-galactopyranoside (Roche, 10884308001, distributed by MilliporeSigma, 24 mg/ml), 2.5%; with the remaining volume reserved for toehold switch DNA, water and lacZω peptide added to a final concentration of 2 µM.

    Techniques: Detection Assay, Amplification, Sequencing, Recombinase Polymerase Amplification