onetaq one step rt pcr kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    OneTaq One Step RT PCR Kit
    Description:
    OneTaq One Step RT PCR Kit 30 rxns
    Catalog Number:
    e5315s
    Price:
    164
    Size:
    30 rxns
    Category:
    PCR related Kits
    Buy from Supplier


    Structured Review

    New England Biolabs onetaq one step rt pcr kit
    OneTaq One Step RT PCR Kit
    OneTaq One Step RT PCR Kit 30 rxns
    https://www.bioz.com/result/onetaq one step rt pcr kit/product/New England Biolabs
    Average 95 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    onetaq one step rt pcr kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: For diagnostic purposes and to confirm the presence of CawYV in symptomatic leaf tissue, a primer pair was designed using Primer 3 tool in Geneious (HZ-636 5′ TGA AGA TCC GGG AAA GGC AC 3′ and HZ-637 5′ ACG CTT TCC ACT CTC ACC TG 3′) [ ]. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Clone Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The PCR products were cloned, sequenced and the resulting sequences were assembled using the map to reference tool and the original assembled contigs as references. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Amplification:

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: .. Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega). .. After WISH, embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Article Title: Construction and Rescue of a Molecular Clone of Deformed Wing Virus (DWV)
    Article Snippet: .. The complete DWV genome was amplified using the OneTaq One-Step RT-PCR Kit, oligonucleotides PDV17 and PDV23, and RNA purified from a virus concentrate (1,8 x 1011 GE). .. The 10,164 bp RT-PCR product was inserted in a pBR322 derived vector using a Gibson assembly reaction [ ].

    Article Title: Genetic Adaptation of a Mevalonate Pathway Deficient Mutant in Staphylococcus aureus
    Article Snippet: Reverse Transcription-PCR Reverse Transcription-PCR (RT-PCR) experiments were carried out using the OneTaq One-step RT-PCR kit (New England BioLabs, Frankfurt am Main, Germany). .. As positive control the housekeeping gene pykA was amplified and the OneTaq DNA Polymerase was taken for the no-RT negative control.

    Positive Control:

    Article Title: SecA Cotranslationally Interacts with Nascent Substrate Proteins In Vivo
    Article Snippet: RT-PCR was carried out using the OneTaq one-step RT-PCR kit (NEB). .. Purified E. coli chromosomal DNA was used as a positive control (not shown).

    Article Title: Genetic Adaptation of a Mevalonate Pathway Deficient Mutant in Staphylococcus aureus
    Article Snippet: Reverse Transcription-PCR Reverse Transcription-PCR (RT-PCR) experiments were carried out using the OneTaq One-step RT-PCR kit (New England BioLabs, Frankfurt am Main, Germany). .. As positive control the housekeeping gene pykA was amplified and the OneTaq DNA Polymerase was taken for the no-RT negative control.

    Synthesized:

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: In situ hybridization was carried out as previously described , using the following probes: pax2a ( ); dlx2a ( ); crestin ( ); vax2 ( ); atoh7 ( ). cldn11a was synthesized as a gBlocks® Gene Fragments (IDT) and TA-cloned into pGEMT-Easy (Promega). .. Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega).

    Immunostaining:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. For immunostaining, embryos were fixed in 4% paraformaldehyde (PFA) in PBS.

    Adsorption:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: After 1 h of adsorption, cell monolayers were overlaid with DMEM containing 2% FBS and 10% normal allantoic fluid and incubated in 5% CO2 incubator at 37 °C for 6 days. .. To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems).

    Incubation:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: After 1 h of adsorption, cell monolayers were overlaid with DMEM containing 2% FBS and 10% normal allantoic fluid and incubated in 5% CO2 incubator at 37 °C for 6 days. .. To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Novel encephalomyelitis-associated astrovirus in a muskox (Ovibos moschatus): a surprise from the archives
    Article Snippet: .. One or 4 μL RNA from FFPE midbrain of animal 15375 or muskoxen faecal samples, respectively, were tested using the OneTaq One-Step RT-PCR Kit (New England Biolabs, Ipswich, MA) using the alternative protocol described by the manufacturer. ..

    Infection:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Expressing:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Article Title: Nanobody-Directed Specific Degradation of Proteins by the 26S-Proteasome in Plants
    Article Snippet: .. Detection of Gene Expression by RT-PCR The OneTaq One-Step RT-PCR Kit (New England Biolabs) was used to identify GFP and actin mRNA. .. Briefly, total RNA from plant tissue was extracted using the RNeasy Plant Kit (Qiagen).

    Western Blot:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Countercurrent Chromatography:

    Article Title: Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes
    Article Snippet: RT-PCR primers were developed for hypsignathus dicistrovirus ORF1 (HDorf1F: 5’ – TTG CAG CAA AAC AGT TGA GG – 3’; HDorflR: 5’ - TGA GAC CAC AAA CCC AGA CA – 3’) to confirm NGS-based results and to test laboratory reagents as a potential source of contamination. .. RT-PCR was performed using New England Biolabs OneTaq One-Step RT-PCR kit (New England Biolabs, Ipswich, Mass.) under standard conditions, with the following thermocycling parameters: 48°C for 30 min; 94°C for 60 sec; 40 cycles at 94°C for 15 sec, 51°C for 30 sec, 68°C for 45 sec; 68°C for 5 min. PCR products were visualized under ultraviolet light on 1.5% agarose gels stained with ethidium bromide.

    Immunohistochemistry:

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: Paragraph title: Immunohistochemistry, in situ hybridization and Alcian Blue staining ... Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega).

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: Paragraph title: In situ hybridization and immunohistochemistry ... In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega).

    Cell Culture:

    Article Title: Clinical and Serological Evaluation of LINDA Virus Infections in Post-Weaning Piglets
    Article Snippet: RT-PCR Detection RNA was extracted from serum and tissue samples, saliva, feces, cultured cells or virus cell culture supernatant using the QIAamp Viral RNA Mini Kit and the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) using the oligonucleotides PPF 5′-GTKATHCAATACCCTGARGC-3′ and PPR 5′-GGRTTCCAGGARTACATCA-3′ [ ].

    Polymerase Chain Reaction:

    Article Title: Clinical and Serological Evaluation of LINDA Virus Infections in Post-Weaning Piglets
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) using the oligonucleotides PPF 5′-GTKATHCAATACCCTGARGC-3′ and PPR 5′-GGRTTCCAGGARTACATCA-3′ [ ]. .. PCR amplicons were subjected to gel electrophoresis and purified with the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), if needed.

    Article Title: Congenital infection with atypical porcine pestivirus (APPV) is associated with disease and viral persistence
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) according to the manufacturer’s instructions. .. Resulting PCR amplicons with suitable length were subjected to gel electrophoresis, purified by the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), and sequenced by a commercial provider (Eurofins Genomics, Ebersberg, Germany) using the PCR primers.

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: .. Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega). .. After WISH, embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Article Title: Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes
    Article Snippet: .. RT-PCR was performed using New England Biolabs OneTaq One-Step RT-PCR kit (New England Biolabs, Ipswich, Mass.) under standard conditions, with the following thermocycling parameters: 48°C for 30 min; 94°C for 60 sec; 40 cycles at 94°C for 15 sec, 51°C for 30 sec, 68°C for 45 sec; 68°C for 5 min. PCR products were visualized under ultraviolet light on 1.5% agarose gels stained with ethidium bromide. ..

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The PCR products were cloned, sequenced and the resulting sequences were assembled using the map to reference tool and the original assembled contigs as references. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    DNA Sequencing:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: .. To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Sequencing:

    Article Title: Congenital infection with atypical porcine pestivirus (APPV) is associated with disease and viral persistence
    Article Snippet: Paragraph title: Detection of APPV genomes and sequence analysis ... RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) according to the manufacturer’s instructions.

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: .. To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Article Title: Tomato Twisted Leaf Virus: A Novel Indigenous New World Monopartite Begomovirus Infecting Tomato in Venezuela
    Article Snippet: The deduced amino acid (aa) sequence was subjected to a BLASTp search. .. RT-PCR assays were performed with primers Be-089F (5′-GAGAGCGTCTGTGGAGCCT-3′) and Be-363R (5′-TGAACCTTACATGGGCCTTC-3′) and Be-2147F/Be-363R using a OneTaq® One-Step RT-PCR Kit (New England BioLabs Inc., USA).

    Article Title: A divergent strain of melon chlorotic spot virus isolated from black medic (Medicago lupulina) in Austria
    Article Snippet: Analysis of each segment showed the presence of conserved nt sequences which can also be observed in other tenuiviruses (ACA CAA AGU C at the 5′ end with its complementary sequence UGU GUU UCA G at the 3′ end). .. Eight primers pairs were designed using Primer 3 (2.3.7) tool in Geneious (Table ) to confirm the physical presence of all eight viral segments using RT-PCR (OneTaq One-Step RT-PCR Kit; NEB) [ ] on fresh RNA extracts from N. benthamiana .

    Article Title: Novel encephalomyelitis-associated astrovirus in a muskox (Ovibos moschatus): a surprise from the archives
    Article Snippet: RT-PCR for muskox astrovirus RT-PCR primers were designed with Geneious 10.1.3 [ ] based on the novel astrovirus sequence, with forward primer MOxAstV_F: GGCGGGCCATAGGACTATTC and reverse primer MOxAstV_R: CTTTGGGCATGCTGGAGAGA. .. One or 4 μL RNA from FFPE midbrain of animal 15375 or muskoxen faecal samples, respectively, were tested using the OneTaq One-Step RT-PCR Kit (New England Biolabs, Ipswich, MA) using the alternative protocol described by the manufacturer.

    Recombinant:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: .. To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Cellular Antioxidant Activity Assay:

    Article Title: Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes
    Article Snippet: RT-PCR primers were developed for hypsignathus dicistrovirus ORF1 (HDorf1F: 5’ – TTG CAG CAA AAC AGT TGA GG – 3’; HDorflR: 5’ - TGA GAC CAC AAA CCC AGA CA – 3’) to confirm NGS-based results and to test laboratory reagents as a potential source of contamination. .. RT-PCR was performed using New England Biolabs OneTaq One-Step RT-PCR kit (New England Biolabs, Ipswich, Mass.) under standard conditions, with the following thermocycling parameters: 48°C for 30 min; 94°C for 60 sec; 40 cycles at 94°C for 15 sec, 51°C for 30 sec, 68°C for 45 sec; 68°C for 5 min. PCR products were visualized under ultraviolet light on 1.5% agarose gels stained with ethidium bromide.

    Article Title: A divergent strain of melon chlorotic spot virus isolated from black medic (Medicago lupulina) in Austria
    Article Snippet: Analysis of each segment showed the presence of conserved nt sequences which can also be observed in other tenuiviruses (ACA CAA AGU C at the 5′ end with its complementary sequence UGU GUU UCA G at the 3′ end). .. Eight primers pairs were designed using Primer 3 (2.3.7) tool in Geneious (Table ) to confirm the physical presence of all eight viral segments using RT-PCR (OneTaq One-Step RT-PCR Kit; NEB) [ ] on fresh RNA extracts from N. benthamiana .

    Immunofluorescence:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Nucleic Acid Electrophoresis:

    Article Title: Clinical and Serological Evaluation of LINDA Virus Infections in Post-Weaning Piglets
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) using the oligonucleotides PPF 5′-GTKATHCAATACCCTGARGC-3′ and PPR 5′-GGRTTCCAGGARTACATCA-3′ [ ]. .. PCR amplicons were subjected to gel electrophoresis and purified with the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), if needed.

    Article Title: Congenital infection with atypical porcine pestivirus (APPV) is associated with disease and viral persistence
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) according to the manufacturer’s instructions. .. Resulting PCR amplicons with suitable length were subjected to gel electrophoresis, purified by the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), and sequenced by a commercial provider (Eurofins Genomics, Ebersberg, Germany) using the PCR primers.

    Isolation:

    Article Title: Functional Characterisation of New Sesquiterpene Synthase from the Malaysian Herbal Plant, Polygonum Minus
    Article Snippet: Paragraph title: 4.2. RNA Isolation and cDNA Synthesis ... Three micrograms of RNA were reverse transcribed into cDNA using the Onetaq® One-step RT-PCR kit (New England Biolabs, Ipswich, MA, USA), according to manufacturer’s instructions.

    Size-exclusion Chromatography:

    Article Title: Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes
    Article Snippet: .. RT-PCR was performed using New England Biolabs OneTaq One-Step RT-PCR kit (New England Biolabs, Ipswich, Mass.) under standard conditions, with the following thermocycling parameters: 48°C for 30 min; 94°C for 60 sec; 40 cycles at 94°C for 15 sec, 51°C for 30 sec, 68°C for 45 sec; 68°C for 5 min. PCR products were visualized under ultraviolet light on 1.5% agarose gels stained with ethidium bromide. ..

    Microscopy:

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: Embryos were mounted in VectaShield and imaged on an Olympus IX81 inverted confocal microscope with the Fluoview 1000 confocal package, using a 60x water immersion objective (NA 1.10), a 60x oil immersion objective (NA 1.35) or a 20x objective (NA 0.75). .. Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega).

    Titration:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: Virus titers of the collected supernatant samples were determined by tissue culture infective dose 50% (TCID50 ) titration assay. .. To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Clinical and Serological Evaluation of LINDA Virus Infections in Post-Weaning Piglets
    Article Snippet: .. RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) using the oligonucleotides PPF 5′-GTKATHCAATACCCTGARGC-3′ and PPR 5′-GGRTTCCAGGARTACATCA-3′ [ ]. .. PCR amplicons were subjected to gel electrophoresis and purified with the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), if needed.

    Article Title: Congenital infection with atypical porcine pestivirus (APPV) is associated with disease and viral persistence
    Article Snippet: .. RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) according to the manufacturer’s instructions. ..

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: .. Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega). .. After WISH, embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Article Title: Construction and Rescue of a Molecular Clone of Deformed Wing Virus (DWV)
    Article Snippet: .. The complete DWV genome was amplified using the OneTaq One-Step RT-PCR Kit, oligonucleotides PDV17 and PDV23, and RNA purified from a virus concentrate (1,8 x 1011 GE). .. The 10,164 bp RT-PCR product was inserted in a pBR322 derived vector using a Gibson assembly reaction [ ].

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: .. To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems). .. Surface and intracellular expression of the different forms of the S gene were examined in infected DF-1 cells by immunofluorescence and by Western blot analyses.

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Article Title: Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes
    Article Snippet: .. RT-PCR was performed using New England Biolabs OneTaq One-Step RT-PCR kit (New England Biolabs, Ipswich, Mass.) under standard conditions, with the following thermocycling parameters: 48°C for 30 min; 94°C for 60 sec; 40 cycles at 94°C for 15 sec, 51°C for 30 sec, 68°C for 45 sec; 68°C for 5 min. PCR products were visualized under ultraviolet light on 1.5% agarose gels stained with ethidium bromide. ..

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Article Title: Tomato Twisted Leaf Virus: A Novel Indigenous New World Monopartite Begomovirus Infecting Tomato in Venezuela
    Article Snippet: .. RT-PCR assays were performed with primers Be-089F (5′-GAGAGCGTCTGTGGAGCCT-3′) and Be-363R (5′-TGAACCTTACATGGGCCTTC-3′) and Be-2147F/Be-363R using a OneTaq® One-Step RT-PCR Kit (New England BioLabs Inc., USA). .. Prior to RT-PCR assays, RNA extractions were treated with RQ1 RNase-Free DNase (Promega, USA) to prevent DNA viral contamination.

    Article Title: SecA Cotranslationally Interacts with Nascent Substrate Proteins In Vivo
    Article Snippet: .. RT-PCR was carried out using the OneTaq one-step RT-PCR kit (NEB). ..

    Article Title: Genetic Adaptation of a Mevalonate Pathway Deficient Mutant in Staphylococcus aureus
    Article Snippet: .. Reverse Transcription-PCR Reverse Transcription-PCR (RT-PCR) experiments were carried out using the OneTaq One-step RT-PCR kit (New England BioLabs, Frankfurt am Main, Germany). ..

    Article Title: Nanobody-Directed Specific Degradation of Proteins by the 26S-Proteasome in Plants
    Article Snippet: .. Detection of Gene Expression by RT-PCR The OneTaq One-Step RT-PCR Kit (New England Biolabs) was used to identify GFP and actin mRNA. .. Briefly, total RNA from plant tissue was extracted using the RNeasy Plant Kit (Qiagen).

    Article Title: A divergent strain of melon chlorotic spot virus isolated from black medic (Medicago lupulina) in Austria
    Article Snippet: .. Eight primers pairs were designed using Primer 3 (2.3.7) tool in Geneious (Table ) to confirm the physical presence of all eight viral segments using RT-PCR (OneTaq One-Step RT-PCR Kit; NEB) [ ] on fresh RNA extracts from N. benthamiana . .. The amplicons were gel-purified using Zymoclean Gel DNA Recovery Kit (Zymo Research) and Sanger sequenced; sequence analyses of these amplicons showed that they were 100% identical to the corresponding segment sequences obtained by the HTS analysis and thus confirmed the presence of each individual viral segment.

    Article Title: Functional Characterisation of New Sesquiterpene Synthase from the Malaysian Herbal Plant, Polygonum Minus
    Article Snippet: .. Three micrograms of RNA were reverse transcribed into cDNA using the Onetaq® One-step RT-PCR kit (New England Biolabs, Ipswich, MA, USA), according to manufacturer’s instructions. .. Candidate Gene Selection and Isolation of Full-Length PmSTPS1 and PmSTPS2 The candidate gene selection was achieved by mining the P. minus transcriptome data [ ] for transcripts that were related to the sesquiterpene biosynthetic pathway.

    Staining:

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: Paragraph title: Immunohistochemistry, in situ hybridization and Alcian Blue staining ... Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega).

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Stained embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Article Title: Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes
    Article Snippet: .. RT-PCR was performed using New England Biolabs OneTaq One-Step RT-PCR kit (New England Biolabs, Ipswich, Mass.) under standard conditions, with the following thermocycling parameters: 48°C for 30 min; 94°C for 60 sec; 40 cycles at 94°C for 15 sec, 51°C for 30 sec, 68°C for 45 sec; 68°C for 5 min. PCR products were visualized under ultraviolet light on 1.5% agarose gels stained with ethidium bromide. ..

    Activated Clotting Time Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: For diagnostic purposes and to confirm the presence of CawYV in symptomatic leaf tissue, a primer pair was designed using Primer 3 tool in Geneious (HZ-636 5′ TGA AGA TCC GGG AAA GGC AC 3′ and HZ-637 5′ ACG CTT TCC ACT CTC ACC TG 3′) [ ]. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Purification:

    Article Title: Clinical and Serological Evaluation of LINDA Virus Infections in Post-Weaning Piglets
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) using the oligonucleotides PPF 5′-GTKATHCAATACCCTGARGC-3′ and PPR 5′-GGRTTCCAGGARTACATCA-3′ [ ]. .. PCR amplicons were subjected to gel electrophoresis and purified with the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), if needed.

    Article Title: Congenital infection with atypical porcine pestivirus (APPV) is associated with disease and viral persistence
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) according to the manufacturer’s instructions. .. Resulting PCR amplicons with suitable length were subjected to gel electrophoresis, purified by the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), and sequenced by a commercial provider (Eurofins Genomics, Ebersberg, Germany) using the PCR primers.

    Article Title: Construction and Rescue of a Molecular Clone of Deformed Wing Virus (DWV)
    Article Snippet: .. The complete DWV genome was amplified using the OneTaq One-Step RT-PCR Kit, oligonucleotides PDV17 and PDV23, and RNA purified from a virus concentrate (1,8 x 1011 GE). .. The 10,164 bp RT-PCR product was inserted in a pBR322 derived vector using a Gibson assembly reaction [ ].

    Article Title: SecA Cotranslationally Interacts with Nascent Substrate Proteins In Vivo
    Article Snippet: RT-PCR was carried out using the OneTaq one-step RT-PCR kit (NEB). .. Purified E. coli chromosomal DNA was used as a positive control (not shown).

    In Situ Hybridization:

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: Paragraph title: Immunohistochemistry, in situ hybridization and Alcian Blue staining ... Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega).

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Plasmid Preparation:

    Article Title: Congenital infection with atypical porcine pestivirus (APPV) is associated with disease and viral persistence
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) according to the manufacturer’s instructions. .. DNA fragments belonging to APPV were sub-cloned in the pGEM-T easy vector (Promega, Madison, USA).

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Software:

    Article Title: Zebrafish zic2 controls formation of periocular neural crest and choroid fissure morphogenesis
    Article Snippet: Full length alx1 cDNA was amplified from total mRNA of 24 hpf embryos by PCR with primers 5′-TTGAGACGAGGCCAGAGGAC-3′ and 5′-CCTGGCTCTGTGAATAATTACAAG-3′ primers using OneTaq One-Step RT-PCR kit (NEB), and TA-cloned into pGEMT-Easy (Promega). .. After WISH, embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Stained embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Negative Control:

    Article Title: Genetic Adaptation of a Mevalonate Pathway Deficient Mutant in Staphylococcus aureus
    Article Snippet: Reverse Transcription-PCR Reverse Transcription-PCR (RT-PCR) experiments were carried out using the OneTaq One-step RT-PCR kit (New England BioLabs, Frankfurt am Main, Germany). .. As positive control the housekeeping gene pykA was amplified and the OneTaq DNA Polymerase was taken for the no-RT negative control.

    In Vitro:

    Article Title: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt
    Article Snippet: Paragraph title: In vitro characterization of the NDV-vectored IBV vaccine candidates ... To check the genetic stability, the three recombinant viruses were passaged 5 times in ECE and the presence of the different forms of the S gene was then checked by RT-PCR using OneTaq® One-Step RT-PCR Kit (New England Biolabs® , Inc) and DNA sequencing using BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, USA) in ABI 3130×l genetic analyzer (Applied Biosystems).

    Next-Generation Sequencing:

    Article Title: Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes
    Article Snippet: RNA from NGS positive sera and water blank negative controls were extracted using both trizol and Qiagen column based methods (QIAamp MinElute Virus Spin kit; Qiagen Inc., Valencia, CA). .. RT-PCR was performed using New England Biolabs OneTaq One-Step RT-PCR kit (New England Biolabs, Ipswich, Mass.) under standard conditions, with the following thermocycling parameters: 48°C for 30 min; 94°C for 60 sec; 40 cycles at 94°C for 15 sec, 51°C for 30 sec, 68°C for 45 sec; 68°C for 5 min. PCR products were visualized under ultraviolet light on 1.5% agarose gels stained with ethidium bromide.

    Functional Assay:

    Article Title: Tomato Twisted Leaf Virus: A Novel Indigenous New World Monopartite Begomovirus Infecting Tomato in Venezuela
    Article Snippet: Paragraph title: 2.5. Genetic and Functional Analyses of a Sixth ORF in Be6.6H Isolate ... RT-PCR assays were performed with primers Be-089F (5′-GAGAGCGTCTGTGGAGCCT-3′) and Be-363R (5′-TGAACCTTACATGGGCCTTC-3′) and Be-2147F/Be-363R using a OneTaq® One-Step RT-PCR Kit (New England BioLabs Inc., USA).

    Produced:

    Article Title: Tomato Twisted Leaf Virus: A Novel Indigenous New World Monopartite Begomovirus Infecting Tomato in Venezuela
    Article Snippet: In order to determine whether a transcript is produced from this ORF, total RNA was extracted from young leaf tissue of tomato plants positive to Be6.6H isolate using TRIzol reagent (Invitrogen, USA). .. RT-PCR assays were performed with primers Be-089F (5′-GAGAGCGTCTGTGGAGCCT-3′) and Be-363R (5′-TGAACCTTACATGGGCCTTC-3′) and Be-2147F/Be-363R using a OneTaq® One-Step RT-PCR Kit (New England BioLabs Inc., USA).

    Gel Extraction:

    Article Title: Clinical and Serological Evaluation of LINDA Virus Infections in Post-Weaning Piglets
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) using the oligonucleotides PPF 5′-GTKATHCAATACCCTGARGC-3′ and PPR 5′-GGRTTCCAGGARTACATCA-3′ [ ]. .. PCR amplicons were subjected to gel electrophoresis and purified with the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), if needed.

    Article Title: Congenital infection with atypical porcine pestivirus (APPV) is associated with disease and viral persistence
    Article Snippet: RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) according to the manufacturer’s instructions. .. Resulting PCR amplicons with suitable length were subjected to gel electrophoresis, purified by the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), and sequenced by a commercial provider (Eurofins Genomics, Ebersberg, Germany) using the PCR primers.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs onetaq one step rt pcr kit
    Onetaq One Step Rt Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq one step rt pcr kit/product/New England Biolabs
    Average 95 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    onetaq one step rt pcr kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results