onetaq rt pcr kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    OneTaq RT PCR Kit
    Description:
    OneTaq RT PCR Kit 30 rxns
    Catalog Number:
    e5310s
    Price:
    146
    Size:
    30 rxns
    Category:
    PCR related Kits
    Buy from Supplier


    Structured Review

    New England Biolabs onetaq rt pcr kit
    OneTaq RT PCR Kit
    OneTaq RT PCR Kit 30 rxns
    https://www.bioz.com/result/onetaq rt pcr kit/product/New England Biolabs
    Average 95 stars, based on 223 article reviews
    Price from $9.99 to $1999.99
    onetaq rt pcr kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: For diagnostic purposes and to confirm the presence of CawYV in symptomatic leaf tissue, a primer pair was designed using Primer 3 tool in Geneious (HZ-636 5′ TGA AGA TCC GGG AAA GGC AC 3′ and HZ-637 5′ ACG CTT TCC ACT CTC ACC TG 3′) [ ]. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Clone Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The PCR products were cloned, sequenced and the resulting sequences were assembled using the map to reference tool and the original assembled contigs as references. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. The quality of H3J fragments was assessed by cloning an aliquot of the final pool into a TOPO vector (Life Technologies).

    Centrifugation:

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The RNA was collected by centrifugation for 5 minutes and washed with 96% ethanol, pelleted again at 15600g and air dried. .. The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs).

    Amplification:

    Article Title: RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination
    Article Snippet: To convert the purified RNA to cDNA, RT-PCR was performed using a OneTaq RT-PCR kit (NEB). .. Amplification of CUP1 , lacZ , DEF1 , and 18S RNA was performed using OneTaq DNA polymerase in a 25 μL reaction with 2 μL of diluted cDNA template, as directed by the manufacturer.

    Article Title: Size-dependent segregation controls macrophage phagocytosis of antibody-opsonized targets
    Article Snippet: .. Once extracted, the RNA was reverse transcribed and amplified using the OneTaq RT-PCR kit (New England BioLabs). ..

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. The procedure for cDNA synthesis and PCR amplification was based on the manufacturer’s instructions.

    Quantitative RT-PCR:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: Paragraph title: RT-qPCR ... At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S). .. Forward and reverse primers for reverse transcription-quantitative PCR (qRT-PCR) are summarized in .

    Article Title: Transcriptional elongation requires DNA break-induced signalling
    Article Snippet: Paragraph title: RT–qPCR ... Total RNA samples were collected and reverse transcribed into complementary DNA using OneTaq RT-PCR Kit (New England Biolabs).

    SYBR Green Assay:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. Targets were detected with Bio-Rad SsoAdvanced Universal SYBR Green Supermix; melt-curve analysis verified that a single product was generated per primer pair.

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. Real-time PCR was done with the Power SYBR Green PCR master mix (Applied Biosystems).

    Incubation:

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The reactions were started at first-strand cDNA synthesis, with incubation at 42 °C for one hour.

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The reaction was then stopped by adding 2mM of EDTA and incubation at 65°C for 10 minutes. .. The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs).

    Article Title: Epithelial-Mesenchymal Transition-Related MicroRNAs and Their Target Genes in Colorectal Cancerogenesis
    Article Snippet: Reverse Transcription (RT) Target mRNAs of the miR-200 family, CDKN1B , ONECUT2 , PTPN13 , RND3 , SOX2 , TGFB2 , WAVE3 , ZEB1 and ZEB2 , were analysed relatively to the geometric mean of RGs, IPO8 and B2M . mRNAs were reverse transcribed using a OneTaq RT-PCR Kit (New England Biolabs, Ipswich, MA, USA) using random primers according to the manufacturer’s instructions. .. Reverse transcription reactions were started with 3.0 µL (60 ng) of total RNA and 1.0 µL of Random Primer Mix incubated at 70 °C for 5 min.

    Cell Culture:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: The MEF-WT and MEF-VDAC1/3−/− cells were seeded onto 24-well plates (1 × 105 cells/well) and cultured overnight to a confluence of 70%. .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Expressing:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: To confirm the expression of VDAC1, VDAC2, and VDAC3, total RNA was isolated using a Qiagen RNeasy minikit (Qiagen, Germantown, MD; catalog no. 74134) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. To quantify gene expression, the 2-ΔΔCt method was used.

    Article Title: Nanobody-Directed Specific Degradation of Proteins by the 26S-Proteasome in Plants
    Article Snippet: .. Detection of Gene Expression by RT-PCR The OneTaq One-Step RT-PCR Kit (New England Biolabs) was used to identify GFP and actin mRNA. .. Briefly, total RNA from plant tissue was extracted using the RNeasy Plant Kit (Qiagen).

    Derivative Assay:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Article Title: RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination
    Article Snippet: To convert the purified RNA to cDNA, RT-PCR was performed using a OneTaq RT-PCR kit (NEB). .. A negative control received no reverse transcriptase (-RT) to ensure that the final signal was RNA-dependent and not derived from chromosomal DNA template.

    Transfection:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: MEF cells were then transfected with 5 nM Vdac2 siRNA (Invitrogen catalog no. 4390771, identifier [ID] s75924) or a nontargeting siRNA (Silencer Select negative-control no. 1; Invitrogen catalog no. 4390843) using Lipofectamine RNAiMAX transfection reagent (Invitrogen catalog no. 13778030) according to the manufacturer’s instructions. .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Infection:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Article Title: RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination
    Article Snippet: .. To convert the purified RNA to cDNA, RT-PCR was performed using a OneTaq RT-PCR kit (NEB). ..

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: .. At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The reactions were started at first-strand cDNA synthesis, with incubation at 42 °C for one hour.

    Article Title: Multidecade Mortality and a Homolog of Hepatitis C Virus in Bald Eagles (Haliaeetus leucocephalus), the National Bird of the USA
    Article Snippet: .. We performed RT-PCR using the OneTaq RT-PCR kit (New England Biolabs, Ipswich, MA) followed by the KAPA HiFi HotStart PCR kit (KAPA Biosystems, Wilmington, MA). .. We included primers at 400 nM each and conducted RT-PCR as follows: 53 °C for 30 minutes, 94 °C for 2 minutes; 94 °C for 15 s, 56 °C for 30 s, and 68 °C for 2.5 min for 40 cycles; and a terminal extension step at 68 °C for 5 min. We then conducted 35 cycles of nested PCR using 1 µl of external PCR product as template and the same conditions described above, but omitting the initial reverse transcription step and with an annealing temperature of 58 °C.

    Article Title: Size-dependent segregation controls macrophage phagocytosis of antibody-opsonized targets
    Article Snippet: .. Once extracted, the RNA was reverse transcribed and amplified using the OneTaq RT-PCR kit (New England BioLabs). ..

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: .. The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. The procedure for cDNA synthesis and PCR amplification was based on the manufacturer’s instructions.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S). .. Forward and reverse primers for reverse transcription-quantitative PCR (qRT-PCR) are summarized in .

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: .. A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. Real-time PCR was done with the Power SYBR Green PCR master mix (Applied Biosystems).

    Article Title: Nanobody-Directed Specific Degradation of Proteins by the 26S-Proteasome in Plants
    Article Snippet: .. Detection of Gene Expression by RT-PCR The OneTaq One-Step RT-PCR Kit (New England Biolabs) was used to identify GFP and actin mRNA. .. Briefly, total RNA from plant tissue was extracted using the RNeasy Plant Kit (Qiagen).

    Article Title: Transcriptional elongation requires DNA break-induced signalling
    Article Snippet: .. Total RNA samples were collected and reverse transcribed into complementary DNA using OneTaq RT-PCR Kit (New England Biolabs). .. Real-time PCR was performed in CFX96 Real-time PCR detection system (Bio-Rad) using β-actin as an internal control.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Double-stranded DNA containing the repertoire of natural H3J fragments was obtained by PCR using the forward primer ALhuVHFR3com_s 5ʹ- CACAGGTCTCGGACACGGCYGTGTATTACTGTGC containing a BsaI site (underlined) and annealing to CM and three reverse JH primers: ALhujh1245_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACRGTGACCAGGGT, ALhujh3_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAAGAGACGGTGACCATTGTCC, ALhujh6_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACGGTGACCGTGGTC, all containing a BglI site (underlined).

    Generated:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. Targets were detected with Bio-Rad SsoAdvanced Universal SYBR Green Supermix; melt-curve analysis verified that a single product was generated per primer pair.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Pools of tRNAs from 10 donors were generated after determining the concentration by UV absorption and mixing the donors tRNAs in equal amounts to generate 20 tRNA pools. .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo.

    Polymerase Chain Reaction:

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The PCR cycling conditions were as follows: 95 °C for 30 seconds and then immediately cycled 30 times through a 30-second denaturing step at 94 °C, a 30-second annealing step at 61 °C, and a 1 min extension step at 68 °C.

    Article Title: Multidecade Mortality and a Homolog of Hepatitis C Virus in Bald Eagles (Haliaeetus leucocephalus), the National Bird of the USA
    Article Snippet: .. We performed RT-PCR using the OneTaq RT-PCR kit (New England Biolabs, Ipswich, MA) followed by the KAPA HiFi HotStart PCR kit (KAPA Biosystems, Wilmington, MA). .. We included primers at 400 nM each and conducted RT-PCR as follows: 53 °C for 30 minutes, 94 °C for 2 minutes; 94 °C for 15 s, 56 °C for 30 s, and 68 °C for 2.5 min for 40 cycles; and a terminal extension step at 68 °C for 5 min. We then conducted 35 cycles of nested PCR using 1 µl of external PCR product as template and the same conditions described above, but omitting the initial reverse transcription step and with an annealing temperature of 58 °C.

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. The procedure for cDNA synthesis and PCR amplification was based on the manufacturer’s instructions.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S). .. Forward and reverse primers for reverse transcription-quantitative PCR (qRT-PCR) are summarized in .

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The PCR products were cloned, sequenced and the resulting sequences were assembled using the map to reference tool and the original assembled contigs as references. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. Real-time PCR was done with the Power SYBR Green PCR master mix (Applied Biosystems).

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Double-stranded DNA containing the repertoire of natural H3J fragments was obtained by PCR using the forward primer ALhuVHFR3com_s 5ʹ- CACAGGTCTCGGACACGGCYGTGTATTACTGTGC containing a BsaI site (underlined) and annealing to CM and three reverse JH primers: ALhujh1245_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACRGTGACCAGGGT, ALhujh3_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAAGAGACGGTGACCATTGTCC, ALhujh6_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACGGTGACCGTGGTC, all containing a BglI site (underlined).

    Mutagenesis:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: Human fibroblasts were infected with the wild-type and UL34-oriLyt mutant viruses using an equivalent number of genomes, corresponding to 0.1 pfu/cell for wild-type virus. .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions.

    Isolation:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: .. At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The reactions were started at first-strand cDNA synthesis, with incubation at 42 °C for one hour.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: To confirm the expression of VDAC1, VDAC2, and VDAC3, total RNA was isolated using a Qiagen RNeasy minikit (Qiagen, Germantown, MD; catalog no. 74134) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: Paragraph title: RNA isolation, reverse transcription, and real-time PCR ... A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Double-stranded DNA containing the repertoire of natural H3J fragments was obtained by PCR using the forward primer ALhuVHFR3com_s 5ʹ- CACAGGTCTCGGACACGGCYGTGTATTACTGTGC containing a BsaI site (underlined) and annealing to CM and three reverse JH primers: ALhujh1245_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACRGTGACCAGGGT, ALhujh3_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAAGAGACGGTGACCATTGTCC, ALhujh6_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACGGTGACCGTGGTC, all containing a BglI site (underlined).

    Negative Control:

    Article Title: RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination
    Article Snippet: To convert the purified RNA to cDNA, RT-PCR was performed using a OneTaq RT-PCR kit (NEB). .. A negative control received no reverse transcriptase (-RT) to ensure that the final signal was RNA-dependent and not derived from chromosomal DNA template.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: MEF cells were then transfected with 5 nM Vdac2 siRNA (Invitrogen catalog no. 4390771, identifier [ID] s75924) or a nontargeting siRNA (Silencer Select negative-control no. 1; Invitrogen catalog no. 4390843) using Lipofectamine RNAiMAX transfection reagent (Invitrogen catalog no. 13778030) according to the manufacturer’s instructions. .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Purification:

    Article Title: RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination
    Article Snippet: .. To convert the purified RNA to cDNA, RT-PCR was performed using a OneTaq RT-PCR kit (NEB). ..

    Article Title: Multidecade Mortality and a Homolog of Hepatitis C Virus in Bald Eagles (Haliaeetus leucocephalus), the National Bird of the USA
    Article Snippet: We performed phase separation in 2 mL Phase Lock Gel Heavy tubes (5PRIME, Gaithersburg, MD) and purified nucleic acids from the aqueous phase using the RNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA). .. We performed RT-PCR using the OneTaq RT-PCR kit (New England Biolabs, Ipswich, MA) followed by the KAPA HiFi HotStart PCR kit (KAPA Biosystems, Wilmington, MA).

    Sequencing:

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. Primers for primer walking of the SEC4 and TUB2 coding sequence and 3’ UTR are listed in .

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Sanger sequencing of 30 clones indicated that all H3J fragments were different, with length variation resembling the human CDR-H3 repertoire.

    Nested PCR:

    Article Title: Multidecade Mortality and a Homolog of Hepatitis C Virus in Bald Eagles (Haliaeetus leucocephalus), the National Bird of the USA
    Article Snippet: We performed RT-PCR using the OneTaq RT-PCR kit (New England Biolabs, Ipswich, MA) followed by the KAPA HiFi HotStart PCR kit (KAPA Biosystems, Wilmington, MA). .. We included primers at 400 nM each and conducted RT-PCR as follows: 53 °C for 30 minutes, 94 °C for 2 minutes; 94 °C for 15 s, 56 °C for 30 s, and 68 °C for 2.5 min for 40 cycles; and a terminal extension step at 68 °C for 5 min. We then conducted 35 cycles of nested PCR using 1 µl of external PCR product as template and the same conditions described above, but omitting the initial reverse transcription step and with an annealing temperature of 58 °C.

    Agarose Gel Electrophoresis:

    Article Title: Size-dependent segregation controls macrophage phagocytosis of antibody-opsonized targets
    Article Snippet: Once extracted, the RNA was reverse transcribed and amplified using the OneTaq RT-PCR kit (New England BioLabs). .. The amplified DNA from all cells was assayed on an agarose gel to determine length and the CD45 D3-D4 sample was clearly smaller than the WT sample - indicating that this population of cells had a truncation in CD45 mRNA length ( ).

    Activated Clotting Time Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: For diagnostic purposes and to confirm the presence of CawYV in symptomatic leaf tissue, a primer pair was designed using Primer 3 tool in Geneious (HZ-636 5′ TGA AGA TCC GGG AAA GGC AC 3′ and HZ-637 5′ ACG CTT TCC ACT CTC ACC TG 3′) [ ]. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Plasmid Preparation:

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. The quality of H3J fragments was assessed by cloning an aliquot of the final pool into a TOPO vector (Life Technologies).

    Real-time Polymerase Chain Reaction:

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: Paragraph title: RNA isolation, reverse transcription, and real-time PCR ... A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: Transcriptional elongation requires DNA break-induced signalling
    Article Snippet: Total RNA samples were collected and reverse transcribed into complementary DNA using OneTaq RT-PCR Kit (New England Biolabs). .. Real-time PCR was performed in CFX96 Real-time PCR detection system (Bio-Rad) using β-actin as an internal control.

    RNA Extraction:

    Article Title: Size-dependent segregation controls macrophage phagocytosis of antibody-opsonized targets
    Article Snippet: RNA extraction from whole cell lysate was performed with the RNeasy Mini kit (Qiagen). .. Once extracted, the RNA was reverse transcribed and amplified using the OneTaq RT-PCR kit (New England BioLabs).

    Sample Prep:

    Article Title: Multidecade Mortality and a Homolog of Hepatitis C Virus in Bald Eagles (Haliaeetus leucocephalus), the National Bird of the USA
    Article Snippet: We performed RT-PCR using the OneTaq RT-PCR kit (New England Biolabs, Ipswich, MA) followed by the KAPA HiFi HotStart PCR kit (KAPA Biosystems, Wilmington, MA). .. We then prepared amplicons for sequencing using the Nextera XT DNA sample preparation kit (Illumina, San Diego, CA), followed by sequenced on an Illumina MiSeq (MiSeq Reagent Kit, v3, 150 cycles, Illumina, San Diego, CA).

    Chromosome Walking:

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. Primers for primer walking of the SEC4 and TUB2 coding sequence and 3’ UTR are listed in .

    Spectrophotometry:

    Article Title: RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination
    Article Snippet: The Master Pure Yeast RNA Purification Kit (Epicentre) was used to purify total RNA (including 1 hr DNase I treatment), and RNA quality and yield was determined using a NanoDrop spectrophotometer (ThermoFisher). .. To convert the purified RNA to cDNA, RT-PCR was performed using a OneTaq RT-PCR kit (NEB).

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: To confirm the expression of VDAC1, VDAC2, and VDAC3, total RNA was isolated using a Qiagen RNeasy minikit (Qiagen, Germantown, MD; catalog no. 74134) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Concentration Assay:

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Pools of tRNAs from 10 donors were generated after determining the concentration by UV absorption and mixing the donors tRNAs in equal amounts to generate 20 tRNA pools. .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo.

    Staining:

    Article Title: Multidecade Mortality and a Homolog of Hepatitis C Virus in Bald Eagles (Haliaeetus leucocephalus), the National Bird of the USA
    Article Snippet: We performed RT-PCR using the OneTaq RT-PCR kit (New England Biolabs, Ipswich, MA) followed by the KAPA HiFi HotStart PCR kit (KAPA Biosystems, Wilmington, MA). .. We visualized amplicons on 2% agarose gels stained with ethidium bromide and purified them using the Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs onetaq rt pcr kit
    Onetaq Rt Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 223 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq rt pcr kit/product/New England Biolabs
    Average 95 stars, based on 223 article reviews
    Price from $9.99 to $1999.99
    onetaq rt pcr kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results