one taq rt pcr kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    New England Biolabs one taq rt pcr kit
    One Taq Rt Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one taq rt pcr kit/product/New England Biolabs
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    one taq rt pcr kit - by Bioz Stars, 2020-04
    95/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: For diagnostic purposes and to confirm the presence of CawYV in symptomatic leaf tissue, a primer pair was designed using Primer 3 tool in Geneious (HZ-636 5′ TGA AGA TCC GGG AAA GGC AC 3′ and HZ-637 5′ ACG CTT TCC ACT CTC ACC TG 3′) [ ]. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Clone Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The PCR products were cloned, sequenced and the resulting sequences were assembled using the map to reference tool and the original assembled contigs as references. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. The quality of H3J fragments was assessed by cloning an aliquot of the final pool into a TOPO vector (Life Technologies).

    Centrifugation:

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The RNA was collected by centrifugation for 5 minutes and washed with 96% ethanol, pelleted again at 15600g and air dried. .. The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs).

    Amplification:

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. The procedure for cDNA synthesis and PCR amplification was based on the manufacturer’s instructions.

    Synthesized:

    Article Title: PDLIM7 and CDH18 regulate the turnover of MDM2 during CDK4/6 inhibitor therapy-induced senescence
    Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of each RNA sample using the One Taq RT-PCR Kit and oligo-dT primers (New England BioLabs). cDNA was diluted 1:5 and 1 μL was used for qPCR per reaction. qPCR was performed by using 400 nM of each forward and reverse primer and SYBR Green PCR Master Mix (Life Technologies). qPCR was performed on Viia 7 Real-Time PCR System (Thermo Scientific). ..

    Quantitative RT-PCR:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: Paragraph title: RT-qPCR ... At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S). .. Forward and reverse primers for reverse transcription-quantitative PCR (qRT-PCR) are summarized in .

    Article Title: Transcriptional elongation requires DNA break-induced signalling
    Article Snippet: Paragraph title: RT–qPCR ... Total RNA samples were collected and reverse transcribed into complementary DNA using OneTaq RT-PCR Kit (New England Biolabs).

    SYBR Green Assay:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. Targets were detected with Bio-Rad SsoAdvanced Universal SYBR Green Supermix; melt-curve analysis verified that a single product was generated per primer pair.

    Article Title: PDLIM7 and CDH18 regulate the turnover of MDM2 during CDK4/6 inhibitor therapy-induced senescence
    Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of each RNA sample using the One Taq RT-PCR Kit and oligo-dT primers (New England BioLabs). cDNA was diluted 1:5 and 1 μL was used for qPCR per reaction. qPCR was performed by using 400 nM of each forward and reverse primer and SYBR Green PCR Master Mix (Life Technologies). qPCR was performed on Viia 7 Real-Time PCR System (Thermo Scientific). ..

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. Real-time PCR was done with the Power SYBR Green PCR master mix (Applied Biosystems).

    Incubation:

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The reactions were started at first-strand cDNA synthesis, with incubation at 42 °C for one hour.

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The reaction was then stopped by adding 2mM of EDTA and incubation at 65°C for 10 minutes. .. The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs).

    Article Title: Epithelial-Mesenchymal Transition-Related MicroRNAs and Their Target Genes in Colorectal Cancerogenesis
    Article Snippet: Reverse Transcription (RT) Target mRNAs of the miR-200 family, CDKN1B , ONECUT2 , PTPN13 , RND3 , SOX2 , TGFB2 , WAVE3 , ZEB1 and ZEB2 , were analysed relatively to the geometric mean of RGs, IPO8 and B2M . mRNAs were reverse transcribed using a OneTaq RT-PCR Kit (New England Biolabs, Ipswich, MA, USA) using random primers according to the manufacturer’s instructions. .. Reverse transcription reactions were started with 3.0 µL (60 ng) of total RNA and 1.0 µL of Random Primer Mix incubated at 70 °C for 5 min.

    Cell Culture:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: The MEF-WT and MEF-VDAC1/3−/− cells were seeded onto 24-well plates (1 × 105 cells/well) and cultured overnight to a confluence of 70%. .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Expressing:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: To confirm the expression of VDAC1, VDAC2, and VDAC3, total RNA was isolated using a Qiagen RNeasy minikit (Qiagen, Germantown, MD; catalog no. 74134) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. To quantify gene expression, the 2-ΔΔCt method was used.

    Article Title: Nanobody-Directed Specific Degradation of Proteins by the 26S-Proteasome in Plants
    Article Snippet: .. Detection of Gene Expression by RT-PCR The OneTaq One-Step RT-PCR Kit (New England Biolabs) was used to identify GFP and actin mRNA. .. Briefly, total RNA from plant tissue was extracted using the RNeasy Plant Kit (Qiagen).

    Derivative Assay:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Transfection:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: MEF cells were then transfected with 5 nM Vdac2 siRNA (Invitrogen catalog no. 4390771, identifier [ID] s75924) or a nontargeting siRNA (Silencer Select negative-control no. 1; Invitrogen catalog no. 4390843) using Lipofectamine RNAiMAX transfection reagent (Invitrogen catalog no. 13778030) according to the manufacturer’s instructions. .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Infection:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Article Title: PDLIM7 and CDH18 regulate the turnover of MDM2 during CDK4/6 inhibitor therapy-induced senescence
    Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of each RNA sample using the One Taq RT-PCR Kit and oligo-dT primers (New England BioLabs). cDNA was diluted 1:5 and 1 μL was used for qPCR per reaction. qPCR was performed by using 400 nM of each forward and reverse primer and SYBR Green PCR Master Mix (Life Technologies). qPCR was performed on Viia 7 Real-Time PCR System (Thermo Scientific). ..

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: .. At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The reactions were started at first-strand cDNA synthesis, with incubation at 42 °C for one hour.

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: .. The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. The procedure for cDNA synthesis and PCR amplification was based on the manufacturer’s instructions.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S). .. Forward and reverse primers for reverse transcription-quantitative PCR (qRT-PCR) are summarized in .

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: .. A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. Real-time PCR was done with the Power SYBR Green PCR master mix (Applied Biosystems).

    Article Title: Nanobody-Directed Specific Degradation of Proteins by the 26S-Proteasome in Plants
    Article Snippet: .. Detection of Gene Expression by RT-PCR The OneTaq One-Step RT-PCR Kit (New England Biolabs) was used to identify GFP and actin mRNA. .. Briefly, total RNA from plant tissue was extracted using the RNeasy Plant Kit (Qiagen).

    Article Title: Transcriptional elongation requires DNA break-induced signalling
    Article Snippet: .. Total RNA samples were collected and reverse transcribed into complementary DNA using OneTaq RT-PCR Kit (New England Biolabs). .. Real-time PCR was performed in CFX96 Real-time PCR detection system (Bio-Rad) using β-actin as an internal control.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Double-stranded DNA containing the repertoire of natural H3J fragments was obtained by PCR using the forward primer ALhuVHFR3com_s 5ʹ- CACAGGTCTCGGACACGGCYGTGTATTACTGTGC containing a BsaI site (underlined) and annealing to CM and three reverse JH primers: ALhujh1245_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACRGTGACCAGGGT, ALhujh3_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAAGAGACGGTGACCATTGTCC, ALhujh6_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACGGTGACCGTGGTC, all containing a BglI site (underlined).

    Article Title: Epithelial-Mesenchymal Transition-Related MicroRNAs and Their Target Genes in Colorectal Cancerogenesis
    Article Snippet: .. Reverse Transcription (RT) Target mRNAs of the miR-200 family, CDKN1B , ONECUT2 , PTPN13 , RND3 , SOX2 , TGFB2 , WAVE3 , ZEB1 and ZEB2 , were analysed relatively to the geometric mean of RGs, IPO8 and B2M . mRNAs were reverse transcribed using a OneTaq RT-PCR Kit (New England Biolabs, Ipswich, MA, USA) using random primers according to the manufacturer’s instructions. .. Reverse transcription reactions were started with 3.0 µL (60 ng) of total RNA and 1.0 µL of Random Primer Mix incubated at 70 °C for 5 min.

    Generated:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. Targets were detected with Bio-Rad SsoAdvanced Universal SYBR Green Supermix; melt-curve analysis verified that a single product was generated per primer pair.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Pools of tRNAs from 10 donors were generated after determining the concentration by UV absorption and mixing the donors tRNAs in equal amounts to generate 20 tRNA pools. .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo.

    Polymerase Chain Reaction:

    Article Title: PDLIM7 and CDH18 regulate the turnover of MDM2 during CDK4/6 inhibitor therapy-induced senescence
    Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of each RNA sample using the One Taq RT-PCR Kit and oligo-dT primers (New England BioLabs). cDNA was diluted 1:5 and 1 μL was used for qPCR per reaction. qPCR was performed by using 400 nM of each forward and reverse primer and SYBR Green PCR Master Mix (Life Technologies). qPCR was performed on Viia 7 Real-Time PCR System (Thermo Scientific). ..

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The PCR cycling conditions were as follows: 95 °C for 30 seconds and then immediately cycled 30 times through a 30-second denaturing step at 94 °C, a 30-second annealing step at 61 °C, and a 1 min extension step at 68 °C.

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. The procedure for cDNA synthesis and PCR amplification was based on the manufacturer’s instructions.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S). .. Forward and reverse primers for reverse transcription-quantitative PCR (qRT-PCR) are summarized in .

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The PCR products were cloned, sequenced and the resulting sequences were assembled using the map to reference tool and the original assembled contigs as references. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. Real-time PCR was done with the Power SYBR Green PCR master mix (Applied Biosystems).

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Double-stranded DNA containing the repertoire of natural H3J fragments was obtained by PCR using the forward primer ALhuVHFR3com_s 5ʹ- CACAGGTCTCGGACACGGCYGTGTATTACTGTGC containing a BsaI site (underlined) and annealing to CM and three reverse JH primers: ALhujh1245_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACRGTGACCAGGGT, ALhujh3_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAAGAGACGGTGACCATTGTCC, ALhujh6_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACGGTGACCGTGGTC, all containing a BglI site (underlined).

    Mutagenesis:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: Human fibroblasts were infected with the wild-type and UL34-oriLyt mutant viruses using an equivalent number of genomes, corresponding to 0.1 pfu/cell for wild-type virus. .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions.

    Isolation:

    Article Title: pUL34 Binding Near the Human Cytomegalovirus Origin of Lytic Replication Enhances DNA Replication and Viral Growth
    Article Snippet: .. At 48 hours post infection, total RNA was isolated with the QIAGEN RNeasy Mini Kit and converted to cDNA with the New England Biolabs OneTaq RT-PCR Kit according to the manufacturer’s instructions. .. For the detection of cDNA derived from UL57 transcripts, primers 698 (5’ AGGCTGCGTTCCACACCGTT 3’) and 699 (5’ CTTGGTGACCGTGCCCGTGA 3’) were used; for the detection of RNA4.9, primers 696 (5’ GGCAAGACGTCCCGGAGAAGA 3’) and 697 (5’ TGTGGTTCGTCGTAC TCACAGTCT 3’) were used; for the detection of housekeeping gene beta-actin, primers 685 (5’ AGAGCTACGACGTGCCTGAC 3’) and 686 (5’ AGCACTGTGTTGGCGTA CAG 3’) were used; for the detection of UL44, primers 664 and 665 were used.

    Article Title: Sodium tanshinone IIA sulfonate suppresses pulmonary fibroblast proliferation and activation induced by silica: role of the Nrf2/Trx pathway
    Article Snippet: .. At the indicated time points, total RNA was isolated with the SV Total RNA Isolation System (Promega) and spectrophotometrically quantified, and reverse transcription–polymerase chain reaction (RT-PCR) was performed with the OneTaq® RT-PCR Kit (New England Biolabs) according to the manufacturer's instructions. .. The reactions were started at first-strand cDNA synthesis, with incubation at 42 °C for one hour.

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: To confirm the expression of VDAC1, VDAC2, and VDAC3, total RNA was isolated using a Qiagen RNeasy minikit (Qiagen, Germantown, MD; catalog no. 74134) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: Paragraph title: RNA isolation, reverse transcription, and real-time PCR ... A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Double-stranded DNA containing the repertoire of natural H3J fragments was obtained by PCR using the forward primer ALhuVHFR3com_s 5ʹ- CACAGGTCTCGGACACGGCYGTGTATTACTGTGC containing a BsaI site (underlined) and annealing to CM and three reverse JH primers: ALhujh1245_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACRGTGACCAGGGT, ALhujh3_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAAGAGACGGTGACCATTGTCC, ALhujh6_r: 5ʹ-TGTTGGCCTCCCGGGCCTGAGGAGACGGTGACCGTGGTC, all containing a BglI site (underlined).

    Sequencing:

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. Primers for primer walking of the SEC4 and TUB2 coding sequence and 3’ UTR are listed in .

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown). .. Further analyses of the CawYV sequence confirmed its identity as a nepovirus.

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. Sanger sequencing of 30 clones indicated that all H3J fragments were different, with length variation resembling the human CDR-H3 repertoire.

    Activated Clotting Time Assay:

    Article Title: Caraway yellows virus, a novel nepovirus from Carum carvi
    Article Snippet: For diagnostic purposes and to confirm the presence of CawYV in symptomatic leaf tissue, a primer pair was designed using Primer 3 tool in Geneious (HZ-636 5′ TGA AGA TCC GGG AAA GGC AC 3′ and HZ-637 5′ ACG CTT TCC ACT CTC ACC TG 3′) [ ]. .. The presence of CawYV was confirmed in the infected plants by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB) resulting in amplicons of 481 bp (data not shown).

    Plasmid Preparation:

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo. .. The quality of H3J fragments was assessed by cloning an aliquot of the final pool into a TOPO vector (Life Technologies).

    Real-time Polymerase Chain Reaction:

    Article Title: PDLIM7 and CDH18 regulate the turnover of MDM2 during CDK4/6 inhibitor therapy-induced senescence
    Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of each RNA sample using the One Taq RT-PCR Kit and oligo-dT primers (New England BioLabs). cDNA was diluted 1:5 and 1 μL was used for qPCR per reaction. qPCR was performed by using 400 nM of each forward and reverse primer and SYBR Green PCR Master Mix (Life Technologies). qPCR was performed on Viia 7 Real-Time PCR System (Thermo Scientific). ..

    Article Title: Tankyrase disrupts metabolic homeostasis and promotes tumorigenesis by inhibiting LKB1-AMPK signalling
    Article Snippet: Paragraph title: RNA isolation, reverse transcription, and real-time PCR ... A reverse transcription assay was done with the OneTaq RT-PCR Kit (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: Transcriptional elongation requires DNA break-induced signalling
    Article Snippet: Total RNA samples were collected and reverse transcribed into complementary DNA using OneTaq RT-PCR Kit (New England Biolabs). .. Real-time PCR was performed in CFX96 Real-time PCR detection system (Bio-Rad) using β-actin as an internal control.

    Negative Control:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: MEF cells were then transfected with 5 nM Vdac2 siRNA (Invitrogen catalog no. 4390771, identifier [ID] s75924) or a nontargeting siRNA (Silencer Select negative-control no. 1; Invitrogen catalog no. 4390843) using Lipofectamine RNAiMAX transfection reagent (Invitrogen catalog no. 13778030) according to the manufacturer’s instructions. .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Chromosome Walking:

    Article Title: Large-scale profiling of noncoding RNA function in yeast
    Article Snippet: The pelleted sample was resuspended in 16.25μl of water to be used for the first strand cDNA synthesis using the OneTaq RT-PCR Kit (New England Biolabs). .. Primers for primer walking of the SEC4 and TUB2 coding sequence and 3’ UTR are listed in .

    Spectrophotometry:

    Article Title: Microsporidia Interact with Host Cell Mitochondria via Voltage-Dependent Anion Channels Using Sporoplasm Surface Protein 1
    Article Snippet: To confirm the expression of VDAC1, VDAC2, and VDAC3, total RNA was isolated using a Qiagen RNeasy minikit (Qiagen, Germantown, MD; catalog no. 74134) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). .. RNA was subjected to reverse transcription (RT) into cDNA using a OneTaq RT-PCR kit (New England BioLabs catalog no. E5310S).

    Concentration Assay:

    Article Title: ALTHEA Gold Libraries™: antibody libraries for therapeutic antibody discovery
    Article Snippet: Pools of tRNAs from 10 donors were generated after determining the concentration by UV absorption and mixing the donors tRNAs in equal amounts to generate 20 tRNA pools. .. Each of the 20 pools were processed to isolate messenger RNA (mRNA) using the polyA Spin™ mRNA Isolation Kit (NEB, Cat No.: S1560S) following the manufacturer instructions. mRNA was used as template to generate cDNAs by reverse transcription using the OneTaq® RT-PCR Kit (NEB, Cat No.: E5310S) and a poly-T oligo.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs onetaq rt pcr kit
    Onetaq Rt Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 223 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onetaq rt pcr kit/product/New England Biolabs
    Average 99 stars, based on 223 article reviews
    Price from $9.99 to $1999.99
    onetaq rt pcr kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results