longamp  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    LongAmp Taq PCR Kit
    Description:
    LongAmp Taq PCR Kit 100 rxns
    Catalog Number:
    E5200S
    Price:
    117
    Category:
    Long distance PCR Kits
    Size:
    100 rxns
    Buy from Supplier


    Structured Review

    New England Biolabs longamp
    LongAmp Taq PCR Kit
    LongAmp Taq PCR Kit 100 rxns
    https://www.bioz.com/result/longamp/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    longamp - by Bioz Stars, 2021-06
    95/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Potential role for age as a modulator of oral nitrate reductase activity
    Article Snippet: Fecal DNA Isolation Kit (Zymo Research, D6010) was used to prepare DNA from tongue scrapes. .. Extracted DNA was used as a template for PCR (LongAmp Taq PCR kit (NEB, cat. no. E5200S) using unique barcoded primers to V4 region of the 16S rRNA gene to generate an amplicon library for individual samples. .. The PCR products from the individual samples were then electrophoresed on an agarose gel, excised from the gel and purified using a Qiagen QIAquick Gel Extraction Kit[ ].

    Article Title: Epistatic Interactions Between Mutations of Deoxyribonuclease 1-Like 3 and the Inhibitory Fc Gamma Receptor IIB Result in Very Early and Massive Autoantibodies Against Double-Stranded DNA
    Article Snippet: Standard techniques were used to transfect the V6.5 embryonic stem cell line (kindly provided by R. Jaenisch, Boston) derived from a C57BL/6x129Sv F1 cross ( ). .. Homologous recombination was screened with left arm and right arm primers by PCR using LongAmp® Taq (New England Biolabs) according to the instructions of the manufacturer. ..

    Article Title: Dynamics of genome reorganization during human cardiogenesis reveal an RBM20-dependent splicing factory
    Article Snippet: .. Genomic DNA was extracted using the QIAGEN DNeasy Blood & Tissue Kit, and used as template for PCR with LongAmp Taq (NEB). .. Genomic DNA was extracted using the QIAGEN DNeasy Blood & Tissue Kit, and used as template for PCR with LongAmp Taq (NEB).

    Article Title: The gut microbiome of the sea urchin, Lytechinus variegatus, from its natural habitat demonstrates selective attributes of microbial taxa and predictive metabolic profiles
    Article Snippet: An amplicon library was prepared from metacommunity DNA, using unique bar-coded oligonucleotide primers through PCR to amplify the hyper variable region 4 (V4) of the 16S rRNA gene (Kozich et al. ; Kumar et al. ; Caporaso et al. , ), and were as follows: forward primer (515F) V4: 5′-AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTG-CCAGCMGCCGCGGTAA-3′; and reverse primer modified from 806R to include uniquely bar-coded 5′ region and adaptor sequence V4: 5′-CAAGAGAAGACGGCATAC-GAGATNNNNNNAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3′ (Eurofins Genomics, Inc., Huntsville, AL, USA) (Kumar et al. ). .. PCR amplification was set up as follows: 10 μL of 5× Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each oligonucleotide primer solution; 1.5 μL (5 U) of the LongAmp® enzyme kit (New England Biolabs, Ipswich, MA, USA; catalog no. E5200S); 30 μL (2–5 ng μL–1 ) of the template DNA; and 3 μL of sterile H2 O for a total reaction volume of 50 μL. .. The PCR cycling parameters were as follows: initial denaturation at 94°C for 1 min; 32 cycles of amplification with each cycle consisting of 94°C for 30 s, 50°C for 1 min, 65°C for 1 min; followed by final extension of 65°C for 3 min and a final hold at 4°C.

    Article Title: An abundance of Epsilonproteobacteria revealed in the gut microbiome of the laboratory cultured sea urchin, Lytechinus variegatus
    Article Snippet: The oligonucleotide primers used for the PCR amplification of the V4 region of the 16S rRNA gene were as follows: Forward primer V4: 5′-AAT GATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGCGG TAA-3′; and Reverse primer V4: 5′-CAA GAGAAGACGGCATACGAGATNNNNNNAGTCAGTCAGCCGGACTACHVGGGTWTC TAAT-3′ (Eurofins Genomics, Inc., Huntsville, AL) (Kumar et al., ). .. The individual PCR reactions were set up as follows: 10 μL of 5X Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each of the oligonucleotide primers; 1.5 μL (5 U) of the “LongAmp” enzyme kit (New England Biolabs, Ipswich, MA; cat # E5200S); 30 μL (2–5 ng/μl) of the template DNA; and 3 μL of sterile H2 O to a total reaction volume of 50 μL. .. The PCR cycling parameters were as follows: initial denature 94°C for 1 min; 32 cycles of amplification in which each cycle consisted of 94°C for 30 s, 50°C for 1 min, 65°C for 1 min; followed by final extension of 65°C for 3 min; then a final hold at 4°C.

    Article Title: CpG Methylation, a Parent-of-Origin Effect for Maternal-Biased Transmission of Congenital Myotonic Dystrophy
    Article Snippet: .. For analysis of the expanded CTG, a specific PCR for long fragments followed by Southern blot was performed in DM1 samples as described previously., 10 to 100 pg of DNA was amplified using the LongAmp Taq PCR Kit (New England Biolabs) with 2.5 units LongAmp Taq DNA polymerase, 1x LongAmp buffer (New England Biolabs), 0.2 mM dNTPs, and 0.4 μM of primers DM101 and DM102 (IDT) (sequences in ) in a total reaction volume of 25 μL on a Veriti thermal cycler (Life Technologies). ..

    Amplification:

    Article Title: Potential role for age as a modulator of oral nitrate reductase activity
    Article Snippet: Fecal DNA Isolation Kit (Zymo Research, D6010) was used to prepare DNA from tongue scrapes. .. Extracted DNA was used as a template for PCR (LongAmp Taq PCR kit (NEB, cat. no. E5200S) using unique barcoded primers to V4 region of the 16S rRNA gene to generate an amplicon library for individual samples. .. The PCR products from the individual samples were then electrophoresed on an agarose gel, excised from the gel and purified using a Qiagen QIAquick Gel Extraction Kit[ ].

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Alexa Fluor 594-labeled donkey anti-goat IgG (A-11058), Alexa Fluor 488-labeled donkey anti-mouse IgG (A-21202), Alexa Fluor 488-labeled donkey anti-rabbit IgG (A-21206), Alexa Fluor 647-labeled donkey anti-rabbit IgG (A-31573), Alexa Fluor 594-labeled goat anti-mouse IgG (A-11005), and Alexa Fluor 488-labeled goat anti-rabbit IgG (A-11034) were obtained from Invitrogen. .. Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The PCR products were digested with KpnI and EcoRI and were cloned into pcDHA (a plasmid carrying an HA epitope tag) as described previously ( ).

    Article Title: The gut microbiome of the sea urchin, Lytechinus variegatus, from its natural habitat demonstrates selective attributes of microbial taxa and predictive metabolic profiles
    Article Snippet: An amplicon library was prepared from metacommunity DNA, using unique bar-coded oligonucleotide primers through PCR to amplify the hyper variable region 4 (V4) of the 16S rRNA gene (Kozich et al. ; Kumar et al. ; Caporaso et al. , ), and were as follows: forward primer (515F) V4: 5′-AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTG-CCAGCMGCCGCGGTAA-3′; and reverse primer modified from 806R to include uniquely bar-coded 5′ region and adaptor sequence V4: 5′-CAAGAGAAGACGGCATAC-GAGATNNNNNNAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3′ (Eurofins Genomics, Inc., Huntsville, AL, USA) (Kumar et al. ). .. PCR amplification was set up as follows: 10 μL of 5× Reaction Buffer; 1.5 μL (200 μM) of each of the dNTPs; 2 μL (1.5 μM) of each oligonucleotide primer solution; 1.5 μL (5 U) of the LongAmp® enzyme kit (New England Biolabs, Ipswich, MA, USA; catalog no. E5200S); 30 μL (2–5 ng μL–1 ) of the template DNA; and 3 μL of sterile H2 O for a total reaction volume of 50 μL. .. The PCR cycling parameters were as follows: initial denaturation at 94°C for 1 min; 32 cycles of amplification with each cycle consisting of 94°C for 30 s, 50°C for 1 min, 65°C for 1 min; followed by final extension of 65°C for 3 min and a final hold at 4°C.

    Article Title: CpG Methylation, a Parent-of-Origin Effect for Maternal-Biased Transmission of Congenital Myotonic Dystrophy
    Article Snippet: .. For analysis of the expanded CTG, a specific PCR for long fragments followed by Southern blot was performed in DM1 samples as described previously., 10 to 100 pg of DNA was amplified using the LongAmp Taq PCR Kit (New England Biolabs) with 2.5 units LongAmp Taq DNA polymerase, 1x LongAmp buffer (New England Biolabs), 0.2 mM dNTPs, and 0.4 μM of primers DM101 and DM102 (IDT) (sequences in ) in a total reaction volume of 25 μL on a Veriti thermal cycler (Life Technologies). ..

    Variant Assay:

    Article Title: Induction of Stress Granule-Like Structures in Vesicular Stomatitis Virus-Infected Cells
    Article Snippet: Alexa Fluor 594-labeled donkey anti-goat IgG (A-11058), Alexa Fluor 488-labeled donkey anti-mouse IgG (A-21202), Alexa Fluor 488-labeled donkey anti-rabbit IgG (A-21206), Alexa Fluor 647-labeled donkey anti-rabbit IgG (A-31573), Alexa Fluor 594-labeled goat anti-mouse IgG (A-11005), and Alexa Fluor 488-labeled goat anti-rabbit IgG (A-11034) were obtained from Invitrogen. .. Coding sequences of TIA1a (variant 2; ) and TIARb (variant 1; ) were amplified using total RNA from HeLa cells and a LongAmp kit (New England Biolabs) with the specific primers shown in . .. The PCR products were digested with KpnI and EcoRI and were cloned into pcDHA (a plasmid carrying an HA epitope tag) as described previously ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Identification of Theileria lestoquardi Antigens Recognized by CD8+ T Cells
    Article Snippet: Total RNA was extracted with the Qiagen RNeasy Mini kit from cryopreserved lymphocytes of T . lestoquardi -infected sheep. .. Contaminating DNA was removed with the Turbo DNA-free™ kit (Applied Biosystems) before cDNA synthesis, which was carried out using the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). .. Partial MHC class I sequences were amplified from cDNA samples using class I generic primers 416 (5' CGGCTACGTGGACGACAYG 3') and Cr (5' ATGGGTCACATGTGYCTTTG 3'), which bind within exons 1 and 3 [ ], generating a 500 bp product.

    Homologous Recombination:

    Article Title: Epistatic Interactions Between Mutations of Deoxyribonuclease 1-Like 3 and the Inhibitory Fc Gamma Receptor IIB Result in Very Early and Massive Autoantibodies Against Double-Stranded DNA
    Article Snippet: Standard techniques were used to transfect the V6.5 embryonic stem cell line (kindly provided by R. Jaenisch, Boston) derived from a C57BL/6x129Sv F1 cross ( ). .. Homologous recombination was screened with left arm and right arm primers by PCR using LongAmp® Taq (New England Biolabs) according to the instructions of the manufacturer. ..

    Southern Blot:

    Article Title: CpG Methylation, a Parent-of-Origin Effect for Maternal-Biased Transmission of Congenital Myotonic Dystrophy
    Article Snippet: .. For analysis of the expanded CTG, a specific PCR for long fragments followed by Southern blot was performed in DM1 samples as described previously., 10 to 100 pg of DNA was amplified using the LongAmp Taq PCR Kit (New England Biolabs) with 2.5 units LongAmp Taq DNA polymerase, 1x LongAmp buffer (New England Biolabs), 0.2 mM dNTPs, and 0.4 μM of primers DM101 and DM102 (IDT) (sequences in ) in a total reaction volume of 25 μL on a Veriti thermal cycler (Life Technologies). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    New England Biolabs longamp taq
    Longamp Taq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longamp taq/product/New England Biolabs
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    longamp taq - by Bioz Stars, 2021-06
    97/100 stars
      Buy from Supplier

    Image Search Results