one taq pcr kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Taq PCR Kit
    Description:
    Taq PCR Kit 200 rxns
    Catalog Number:
    e5000s
    Price:
    105
    Size:
    200 rxns
    Category:
    PCR related Kits
    Buy from Supplier


    Structured Review

    New England Biolabs one taq pcr kit
    Taq PCR Kit
    Taq PCR Kit 200 rxns
    https://www.bioz.com/result/one taq pcr kit/product/New England Biolabs
    Average 95 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    one taq pcr kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ). .. The PCR products were cloned into pGEM-T Easy (Promega) and sequenced on contract using ABI 3130 DNA sequencing at Interdisciplinary Center for Biotechnology Research (University of Florida).

    Amplification:

    Article Title: The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae)
    Article Snippet: .. Purified genomic DNA was amplified using the polymerase chain reaction (PCR) technique and the Taq PCR Kit (NEB, MA), under the following cycling parameters: 94°C for 3 min; 35 cycles of 30 s at 94°C, 40 s at 55–60°C, 1–3 min at 72°C; and 72°C for 10 min. .. The PCR products were detected by 1.0% agarose-gel electrophoresis and purified using a DNA gel extraction kit (TaKaRa, Japan).

    Article Title: Prevalence of sweetpotato viruses in Acholi sub-region, northern Uganda
    Article Snippet: The reactions were then incubated in SimpliAmp Thermal Cycler (Life Technologies, Marsiling Industrial Estate Road3, Singapore) under the following conditions: 22 °C for 10 min, 42 °C for 40 min and 95 °C for 4 min. Multiplex PCR was completed in a 25 μl reaction volume using a Taq PCR kit (New England Biolabs Inc.). .. Amplification was performed in SimpliAmp Thermal Cycler as follows: initial denaturation at 94 °C for 5 min and 35 thermal cycles of denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s, extension at 72 °C for 1 min.

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: .. Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together. .. All PCR reactions were carried out on a thermal cycler (Applied Biosystems GeneAmp® PCR System 2700).

    Article Title: α-Synuclein binds the KATP channel at insulin-secretory granules and inhibits insulin secretion
    Article Snippet: DNA concentrations were determined using 260/280-nm absorbance ratios, and samples were diluted to 5 μg/μl for PCR, which was performed using a Taq PCR kit (New England Biolabs). .. Genomic α-synuclein was amplified using the forward primer 5′-GGCGACGTGAAGGAGCCAGG-3′ and the reverse primer 5′-CAGCGAAAGGAAAGCCGAGTGATGTACT-3′.

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: .. Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA). .. The PCR conditions and mixtures of both the first and second amplification were the same as the method described by Liu et al. .

    Article Title: ChimeRScope: a novel alignment-free algorithm for fusion transcript prediction using paired-end RNA-Seq data
    Article Snippet: PCR was performed for each primer set using either the standard Taq PCR kit (New England BioLabs) or the One Taq PCR kit with GC buffer (New England BioLabs) depending on the GC content of the target sequences. .. The PCR products of the approximate expected amplicon size were extracted from the agarose gel using the GeneJET Gel Extraction Kit (ThermoScientific).

    Article Title: Specific Magnetic Isolation of E6 HPV16 Modified Magnetizable Particles Coupled with PCR and Electrochemical Detection
    Article Snippet: Paragraph title: 4.3. Isolation and PCR Amplification of E6 Human Papillomavirus 16 ... The PCR mixture (Taq PCR kit, New England Biolabs, Ispwich, MA, USA), contained the PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl with 1.5 mM MgCl2 included), 0.2 mM of dNTPs and 0.4 µM of each primers with E6-HPV16-pUC57 synthetic plasmid using as a template.

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: PCR amplification failed with ITS1GC/ITS4. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, USA).

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: .. Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ). .. The amplification program was 94°° C for 3 min with 40 cycles of 92°° C for 40 s, 58°° C for 40 s, and 72°° C for 40 followed by 72°° C for 4 min.

    Article Title: Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element
    Article Snippet: .. Reporter plasmid constructions Computationally-predicted conserved regions were amplified using the Taq PCR Kit (New England Biolabs, MA) following the routine Taq PCR reaction protocol. .. Mouse genomic DNA (Swiss Webster strain) was extracted from an adult mouse tail and used as the PCR template for all primers.

    Article Title: Leukemia regression by vascular disruption and antiangiogenic therapy
    Article Snippet: .. Human FLT3 internal tandem duplication (ITD) was amplified by single-step PCR using the New England BioLabs Taq PCR kit. .. The PCR mixture contained 100 ng of DNA, 500 pmol of each primer, 200μM DNTP solution mix, 1× Standard Taq Reaction Buffer with 1.5mM MgCl2, and 1 unit of Taq DNA Polymerase.

    Polymerase Chain Reaction:

    Article Title: The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae)
    Article Snippet: .. Purified genomic DNA was amplified using the polymerase chain reaction (PCR) technique and the Taq PCR Kit (NEB, MA), under the following cycling parameters: 94°C for 3 min; 35 cycles of 30 s at 94°C, 40 s at 55–60°C, 1–3 min at 72°C; and 72°C for 10 min. .. The PCR products were detected by 1.0% agarose-gel electrophoresis and purified using a DNA gel extraction kit (TaKaRa, Japan).

    Article Title: Prevalence of sweetpotato viruses in Acholi sub-region, northern Uganda
    Article Snippet: .. The reactions were then incubated in SimpliAmp Thermal Cycler (Life Technologies, Marsiling Industrial Estate Road3, Singapore) under the following conditions: 22 °C for 10 min, 42 °C for 40 min and 95 °C for 4 min. Multiplex PCR was completed in a 25 μl reaction volume using a Taq PCR kit (New England Biolabs Inc.). .. The reaction mixed contained 1X of 5 μl of PCR buffer, 1 mM of 2 μl of dNTP solution mix, 5000U/ml of 0.2 μl of Taq polymerase, 2.5 mg/ul of 4 μl of MgCl2 , 2 μl of cDNA templates, 10μM of 0.5 μl of forward primers, 10μM of 0.5 μl of reverse primers and PCR water to make the volume up to 25 μl.

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: .. Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together. .. All PCR reactions were carried out on a thermal cycler (Applied Biosystems GeneAmp® PCR System 2700).

    Article Title: α-Synuclein binds the KATP channel at insulin-secretory granules and inhibits insulin secretion
    Article Snippet: .. DNA concentrations were determined using 260/280-nm absorbance ratios, and samples were diluted to 5 μg/μl for PCR, which was performed using a Taq PCR kit (New England Biolabs). .. Genomic α-synuclein was amplified using the forward primer 5′-GGCGACGTGAAGGAGCCAGG-3′ and the reverse primer 5′-CAGCGAAAGGAAAGCCGAGTGATGTACT-3′.

    Article Title: Identification of a stable molecular signature in mammary tumor endothelial cells that persists in vitro
    Article Snippet: .. End-point PCR was carried out using a Taq PCR Kit (NEB) with the products resolved on agarose gels. qPCR was run in triplicate with Maxima SYBR Green (ThermoFisher) on an Applied Biosystems Step One Plus analyzer. .. Cells were analyzed by flow cytometry as previously described using a BD Accuri® C6 Flow Cytometer [ , ].

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: .. Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA). .. The PCR conditions and mixtures of both the first and second amplification were the same as the method described by Liu et al. .

    Article Title: ChimeRScope: a novel alignment-free algorithm for fusion transcript prediction using paired-end RNA-Seq data
    Article Snippet: .. PCR was performed for each primer set using either the standard Taq PCR kit (New England BioLabs) or the One Taq PCR kit with GC buffer (New England BioLabs) depending on the GC content of the target sequences. ..

    Article Title: Specific Magnetic Isolation of E6 HPV16 Modified Magnetizable Particles Coupled with PCR and Electrochemical Detection
    Article Snippet: .. The PCR mixture (Taq PCR kit, New England Biolabs, Ispwich, MA, USA), contained the PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl with 1.5 mM MgCl2 included), 0.2 mM of dNTPs and 0.4 µM of each primers with E6-HPV16-pUC57 synthetic plasmid using as a template. .. The DNA amplification was carried out for 40 cycles of the denaturation at 94 °C for 30 s, the annealing at 56 °C for 30 s and the primer extension at 72 °C for 30 s. The amplified E6-HPV16 oncogene was purified using MiniElute PCR Purification Kit (Qiagen, Germantown, MD, USA).

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, USA). .. PCR cycles consisted of an initial DNA denaturation at 95°C for 3 min, 30 cycles of denaturation at 94°C for 45 s, annealing at 55°C for 45 s, extension at 72°C for 1 min 15 s, and a final elongation step at 72°C for 5 min. DGGE was performed according to the same protocol described above, with a linear denaturing gradient range of 20% to 50%.

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: .. Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ). .. The amplification program was 94°° C for 3 min with 40 cycles of 92°° C for 40 s, 58°° C for 40 s, and 72°° C for 40 followed by 72°° C for 4 min.

    Article Title: Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element
    Article Snippet: .. Reporter plasmid constructions Computationally-predicted conserved regions were amplified using the Taq PCR Kit (New England Biolabs, MA) following the routine Taq PCR reaction protocol. .. Mouse genomic DNA (Swiss Webster strain) was extracted from an adult mouse tail and used as the PCR template for all primers.

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: .. PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs). .. PCR products were run on 1.5% ethidium bromide-stained agarose gels, excised, purified using a Gel Extraction Kit (Qiagen), ligated to pCR4-TOPO vector (Invitrogen), and transformed into DH5α E. coli (Zymo Research).

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA). .. PCR cycles consisted of an initial DNA denaturation at 95°C for 10 min, 30 cycles of denaturation at 93°C for 1 min, annealing at 48°C for 1 min, extension at 72°C for 1 min, and a final elongation step at 72°C for 5 min. DGGE was carried out using a DCode Universal Mutation Detection System (Bio-Rad Laboratories, Hercules, CA, USA) according to Kebli et al [ ] with a modification in the range of denaturing gradient.

    Article Title: Leukemia regression by vascular disruption and antiangiogenic therapy
    Article Snippet: .. Human FLT3 internal tandem duplication (ITD) was amplified by single-step PCR using the New England BioLabs Taq PCR kit. .. The PCR mixture contained 100 ng of DNA, 500 pmol of each primer, 200μM DNTP solution mix, 1× Standard Taq Reaction Buffer with 1.5mM MgCl2, and 1 unit of Taq DNA Polymerase.

    Construct:

    Article Title: Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element
    Article Snippet: Reporter plasmid constructions Computationally-predicted conserved regions were amplified using the Taq PCR Kit (New England Biolabs, MA) following the routine Taq PCR reaction protocol. .. Then, the sticky end inserts were digested, gel purified, and ligated into the βGP-GFP backbone which was linearized with FseI and SpeI to generate experimental constructs ( ).

    Real-time Polymerase Chain Reaction:

    Article Title: Identification of a stable molecular signature in mammary tumor endothelial cells that persists in vitro
    Article Snippet: .. End-point PCR was carried out using a Taq PCR Kit (NEB) with the products resolved on agarose gels. qPCR was run in triplicate with Maxima SYBR Green (ThermoFisher) on an Applied Biosystems Step One Plus analyzer. .. Cells were analyzed by flow cytometry as previously described using a BD Accuri® C6 Flow Cytometer [ , ].

    Incubation:

    Article Title: Prevalence of sweetpotato viruses in Acholi sub-region, northern Uganda
    Article Snippet: .. The reactions were then incubated in SimpliAmp Thermal Cycler (Life Technologies, Marsiling Industrial Estate Road3, Singapore) under the following conditions: 22 °C for 10 min, 42 °C for 40 min and 95 °C for 4 min. Multiplex PCR was completed in a 25 μl reaction volume using a Taq PCR kit (New England Biolabs Inc.). .. The reaction mixed contained 1X of 5 μl of PCR buffer, 1 mM of 2 μl of dNTP solution mix, 5000U/ml of 0.2 μl of Taq polymerase, 2.5 mg/ul of 4 μl of MgCl2 , 2 μl of cDNA templates, 10μM of 0.5 μl of forward primers, 10μM of 0.5 μl of reverse primers and PCR water to make the volume up to 25 μl.

    Modification:

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA). .. PCR cycles consisted of an initial DNA denaturation at 95°C for 10 min, 30 cycles of denaturation at 93°C for 1 min, annealing at 48°C for 1 min, extension at 72°C for 1 min, and a final elongation step at 72°C for 5 min. DGGE was carried out using a DCode Universal Mutation Detection System (Bio-Rad Laboratories, Hercules, CA, USA) according to Kebli et al [ ] with a modification in the range of denaturing gradient.

    Transformation Assay:

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA). .. Thirty-five purified DNA samples were ligated into pGEM-T vector (Promega, WI, USA) and transformed into Escherichia coli DH5α according to manufacture's instructions, resulting in 35 clone libraries.

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs). .. PCR products were run on 1.5% ethidium bromide-stained agarose gels, excised, purified using a Gel Extraction Kit (Qiagen), ligated to pCR4-TOPO vector (Invitrogen), and transformed into DH5α E. coli (Zymo Research).

    Derivative Assay:

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: Genomic DNA sequence data for ITS-1 were derived from specimens of O. insidiosus and O. pumilio collected from our laboratory cultures and from O. tristicolor collected from butterfly bush, Buddleja sp., growing in Wapato, Washington for comparison with previously published sequences from anthocorid species. .. Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ).

    Countercurrent Chromatography:

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: As for the fungal diversity (i.e., yeasts and moulds), we tested five primer sets including NS1 (5′-GTA GTC ATA TGC TTG TCT C-3′)/Fung (5′-ATT CCC CGT TAC CCG TTG-3′) [ ], NL1 (5′-GCC ATA TCA ATA AGC GGA GGA AAA G-3′)/LS2 (5′-ATT CCC AAA CAA CTC GAC TC-3′) [ ], NL3A (5′-GAG ACC GAT AGC GAA CAA G-3′)/NL4 (5′-GGT CCG TGT TTC AAG ACG G-3′) [ ], ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′)/ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) [ ], and ITS1F (5′-TTG GTC ATT TAG AGG AAG TAA-3′)/ITS2 (5′-GCT GCG TTC TTC ATC GAT GC-3′) [ ]. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, USA).

    Cell Culture:

    Article Title: ChimeRScope: a novel alignment-free algorithm for fusion transcript prediction using paired-end RNA-Seq data
    Article Snippet: Experimental validation The NK cell lines used for fusion detection were KHYG1, NKYS and NK92, which were cultured under standard conditions and total RNA was extracted as per standard protocol. .. PCR was performed for each primer set using either the standard Taq PCR kit (New England BioLabs) or the One Taq PCR kit with GC buffer (New England BioLabs) depending on the GC content of the target sequences.

    Generated:

    Article Title: Prevalence of sweetpotato viruses in Acholi sub-region, northern Uganda
    Article Snippet: The cDNA was generated using a RT-PCR kit (New England Biolabs Inc., Ipswich, MA, USA). .. The reactions were then incubated in SimpliAmp Thermal Cycler (Life Technologies, Marsiling Industrial Estate Road3, Singapore) under the following conditions: 22 °C for 10 min, 42 °C for 40 min and 95 °C for 4 min. Multiplex PCR was completed in a 25 μl reaction volume using a Taq PCR kit (New England Biolabs Inc.).

    DNA Sequencing:

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ). .. The PCR products were cloned into pGEM-T Easy (Promega) and sequenced on contract using ABI 3130 DNA sequencing at Interdisciplinary Center for Biotechnology Research (University of Florida).

    Sequencing:

    Article Title: The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae)
    Article Snippet: Paragraph title: Polymerase Chain Reaction Amplification and Sequencing ... Purified genomic DNA was amplified using the polymerase chain reaction (PCR) technique and the Taq PCR Kit (NEB, MA), under the following cycling parameters: 94°C for 3 min; 35 cycles of 30 s at 94°C, 40 s at 55–60°C, 1–3 min at 72°C; and 72°C for 10 min.

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: By comparing their DGGE profiles, primer set ITS1FGC/ITS2 produced more distinct bands and therefore was selected to amplify a fragment of 280 bp of the single sequence repeats region of fungi in silages. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, USA).

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: Genomic DNA sequence data for ITS-1 were derived from specimens of O. insidiosus and O. pumilio collected from our laboratory cultures and from O. tristicolor collected from butterfly bush, Buddleja sp., growing in Wapato, Washington for comparison with previously published sequences from anthocorid species. .. Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ).

    Article Title: Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element
    Article Snippet: Reporter plasmid constructions Computationally-predicted conserved regions were amplified using the Taq PCR Kit (New England Biolabs, MA) following the routine Taq PCR reaction protocol. .. A random extension sequence (CGATATAT) and the SpeI recognition sequence (ACTAGT) was added to the 5′ end of the forward primer, plus a random extension sequence and FseI recognition sequence (GGCCGGCC) was added to the 5′ end of the reverse primer.

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: Paragraph title: Bisulfite-specific PCR and sequencing ... PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs).

    Binding Assay:

    Article Title: ChimeRScope: a novel alignment-free algorithm for fusion transcript prediction using paired-end RNA-Seq data
    Article Snippet: NCBI primer blast ( ) was used to check the off-target amplicons to ensure the binding site specificity of the primers. .. PCR was performed for each primer set using either the standard Taq PCR kit (New England BioLabs) or the One Taq PCR kit with GC buffer (New England BioLabs) depending on the GC content of the target sequences.

    Cellular Antioxidant Activity Assay:

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: As for the fungal diversity (i.e., yeasts and moulds), we tested five primer sets including NS1 (5′-GTA GTC ATA TGC TTG TCT C-3′)/Fung (5′-ATT CCC CGT TAC CCG TTG-3′) [ ], NL1 (5′-GCC ATA TCA ATA AGC GGA GGA AAA G-3′)/LS2 (5′-ATT CCC AAA CAA CTC GAC TC-3′) [ ], NL3A (5′-GAG ACC GAT AGC GAA CAA G-3′)/NL4 (5′-GGT CCG TGT TTC AAG ACG G-3′) [ ], ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′)/ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) [ ], and ITS1F (5′-TTG GTC ATT TAG AGG AAG TAA-3′)/ITS2 (5′-GCT GCG TTC TTC ATC GAT GC-3′) [ ]. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, USA).

    DNA Extraction:

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: Paragraph title: Soil DNA extraction and amplification ... Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together.

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: Molecular analysis DNA was extracted from 35 root samples (20 neighborhood plant and 15 L. virgaurea root samples, 100 mg fine roots for each sample) using a Plant DNA Extraction Kit (Tiangen Biotech, Beijing, China) following the manufacture's instruction. .. Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA).

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: Genomic DNAs of 50 pooled adult O. insidiosus, O. pumilio , or O. tristicolor were isolated using the Wizard Genomic DNA Isolation System (Promega, www.promega.com ) according to the manufacturer's protocol for animal tissues. .. Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ).

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: Genomic DNA was isolated from RWPE-1 and RWPE-2 cells with a PureLink Genomic DNA Isolation kit (Invitrogen) and subjected to bisulfite conversion (EZ DNA-Methylation-Direct, Zymo Research, Orange, CA). .. PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs).

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: Total DNA was extracted from silage samples using the PowerFood Microbial DNA Isolation Kit (MoBio Laboratories, Carlsbad, CA, USA). .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA).

    Nucleic Acid Electrophoresis:

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: Analyses of bacterial and fungal diversity Polymerase chain reaction–denaturing gradient gel electrophoresis (PCR-DGGE) fingerprinting was used to analyze the bacterial and fungal diversity in corn silage. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA).

    Methylation:

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: The BSP primers, designed using Methyl-Primer Express v1.0 (Life technologies, Carlsbad, CA), were: methylated primer pair (M), 5′TTATTTTTCGTTTTTTCTTCGGTCGTCG3′ and 5′GCGCGCTTTTAAAAAAACGCTCG3′; unmethylated primer pair (UM), 5′TGTTTTTTGTTTGGTTGTTGTTT3′ and 5′CTCACAAACCAACTCAAACACAA3′. .. PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs).

    Mutagenesis:

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA). .. PCR cycles consisted of an initial DNA denaturation at 95°C for 10 min, 30 cycles of denaturation at 93°C for 1 min, annealing at 48°C for 1 min, extension at 72°C for 1 min, and a final elongation step at 72°C for 5 min. DGGE was carried out using a DCode Universal Mutation Detection System (Bio-Rad Laboratories, Hercules, CA, USA) according to Kebli et al [ ] with a modification in the range of denaturing gradient.

    Isolation:

    Article Title: Identification of a stable molecular signature in mammary tumor endothelial cells that persists in vitro
    Article Snippet: Total RNA was isolated using an RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. cDNA synthesis was completed using an iScript cDNA Synthesis Kit (Bio-Rad). .. End-point PCR was carried out using a Taq PCR Kit (NEB) with the products resolved on agarose gels. qPCR was run in triplicate with Maxima SYBR Green (ThermoFisher) on an Applied Biosystems Step One Plus analyzer.

    Article Title: Specific Magnetic Isolation of E6 HPV16 Modified Magnetizable Particles Coupled with PCR and Electrochemical Detection
    Article Snippet: Paragraph title: 4.3. Isolation and PCR Amplification of E6 Human Papillomavirus 16 ... The PCR mixture (Taq PCR kit, New England Biolabs, Ispwich, MA, USA), contained the PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl with 1.5 mM MgCl2 included), 0.2 mM of dNTPs and 0.4 µM of each primers with E6-HPV16-pUC57 synthetic plasmid using as a template.

    Article Title: Identity of Two Sympatric Species of Orius (Hemiptera: Heteroptera: Anthocoridae)
    Article Snippet: Genomic DNAs of 50 pooled adult O. insidiosus, O. pumilio , or O. tristicolor were isolated using the Wizard Genomic DNA Isolation System (Promega, www.promega.com ) according to the manufacturer's protocol for animal tissues. .. Direct PCR for the ITS-1 and flanking regions were amplified from the genomic DNAs as template using Taq PCR kit (New England Biolabs, www.neb.com ) with the forward primer, 5′?-ACCGCCCGCGCTACTACCGAT -3′?, and reverse primer, 5′?-TGTTCATGTGTCCTGCAGTTCACA-3′? (Integrated DNA Technologies, www.idtdna.com ), as identified by Muraji et al. ( ).

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: Genomic DNA was isolated from RWPE-1 and RWPE-2 cells with a PureLink Genomic DNA Isolation kit (Invitrogen) and subjected to bisulfite conversion (EZ DNA-Methylation-Direct, Zymo Research, Orange, CA). .. PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs).

    Article Title: Leukemia regression by vascular disruption and antiangiogenic therapy
    Article Snippet: Genomic DNA was isolated from test samples using the Wizard Genomic DNA purification kit (Promega). .. Human FLT3 internal tandem duplication (ITD) was amplified by single-step PCR using the New England BioLabs Taq PCR kit.

    Purification:

    Article Title: The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae)
    Article Snippet: .. Purified genomic DNA was amplified using the polymerase chain reaction (PCR) technique and the Taq PCR Kit (NEB, MA), under the following cycling parameters: 94°C for 3 min; 35 cycles of 30 s at 94°C, 40 s at 55–60°C, 1–3 min at 72°C; and 72°C for 10 min. .. The PCR products were detected by 1.0% agarose-gel electrophoresis and purified using a DNA gel extraction kit (TaKaRa, Japan).

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: Bacterial 16S rRNA genes were amplified from the purified community DNA and negative parallel control by PCR using the universal primer pair 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-TACGGTTACCTTGTTACGACTT-3′). .. Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together.

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA). .. The second PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Inc, Hangzhou, China), and the expected DNA products (c. 560 bp) were obtained.

    Article Title: Specific Magnetic Isolation of E6 HPV16 Modified Magnetizable Particles Coupled with PCR and Electrochemical Detection
    Article Snippet: Isolation and PCR Amplification of E6 Human Papillomavirus 16 The plasmid was purified using the Qiagen Miniprep Kit (Qiagen, Germantown, MD, USA) and the PCR amplification of the gene was performed using a set of primers flanking the complete open reading frame: 5′-ATGCACCAAAAGAGAACTGC-3′ (E6 forward) and 5′-TTACAGCTGGGTTTCTCTAC-3′ (E6 reverse). .. The PCR mixture (Taq PCR kit, New England Biolabs, Ispwich, MA, USA), contained the PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl with 1.5 mM MgCl2 included), 0.2 mM of dNTPs and 0.4 µM of each primers with E6-HPV16-pUC57 synthetic plasmid using as a template.

    Article Title: Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element
    Article Snippet: Reporter plasmid constructions Computationally-predicted conserved regions were amplified using the Taq PCR Kit (New England Biolabs, MA) following the routine Taq PCR reaction protocol. .. Then, the sticky end inserts were digested, gel purified, and ligated into the βGP-GFP backbone which was linearized with FseI and SpeI to generate experimental constructs ( ).

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs). .. PCR products were run on 1.5% ethidium bromide-stained agarose gels, excised, purified using a Gel Extraction Kit (Qiagen), ligated to pCR4-TOPO vector (Invitrogen), and transformed into DH5α E. coli (Zymo Research).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Prevalence of sweetpotato viruses in Acholi sub-region, northern Uganda
    Article Snippet: The cDNA was generated using a RT-PCR kit (New England Biolabs Inc., Ipswich, MA, USA). .. The reactions were then incubated in SimpliAmp Thermal Cycler (Life Technologies, Marsiling Industrial Estate Road3, Singapore) under the following conditions: 22 °C for 10 min, 42 °C for 40 min and 95 °C for 4 min. Multiplex PCR was completed in a 25 μl reaction volume using a Taq PCR kit (New England Biolabs Inc.).

    Staining:

    Article Title: Prevalence of sweetpotato viruses in Acholi sub-region, northern Uganda
    Article Snippet: The reactions were then incubated in SimpliAmp Thermal Cycler (Life Technologies, Marsiling Industrial Estate Road3, Singapore) under the following conditions: 22 °C for 10 min, 42 °C for 40 min and 95 °C for 4 min. Multiplex PCR was completed in a 25 μl reaction volume using a Taq PCR kit (New England Biolabs Inc.). .. The PCR products were electrophoresed in 1% Agarose Basic (AppliChem GmbH, Darmstadt, Germany), stained with SYBR Safe DNA gel stain (Invitrogen) and visualised on an UVIDOC HD5 (UVITEC, Cambridge, UK) ultraviolet trans-illuminator.

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together. .. The presence or absence of PCR products was determined on a 1.0% (w/v) agarose gel with ethidium bromide staining.

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA). .. Electrophoresis was performed at a constant voltage of 75 V and a temperature of 60°C for 16 h. Then the gels were stained with SYBR Gold (Invitrogen, Carlsbad, CA, USA) and visualized under UV illumination using a Molecular Imager ChemiDoc XRS System (Bio-Rad Laboratories, USA).

    Article Title: Leukemia regression by vascular disruption and antiangiogenic therapy
    Article Snippet: Human FLT3 internal tandem duplication (ITD) was amplified by single-step PCR using the New England BioLabs Taq PCR kit. .. Ten microliters of each PCR product were run on a 1% agarose gel and visualized under ultraviolet light after ethidium bromide staining.

    Nested PCR:

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: .. Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA). .. The PCR conditions and mixtures of both the first and second amplification were the same as the method described by Liu et al. .

    Plasmid Preparation:

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA). .. Thirty-five purified DNA samples were ligated into pGEM-T vector (Promega, WI, USA) and transformed into Escherichia coli DH5α according to manufacture's instructions, resulting in 35 clone libraries.

    Article Title: ChimeRScope: a novel alignment-free algorithm for fusion transcript prediction using paired-end RNA-Seq data
    Article Snippet: The RNA extracted from these cells lines was reverse transcribed into cDNA using ProtoScript First Strand cDNA Synthesis Kit (New England BioLabs) as per manufacturer's protocol, followed by polymerase chain reaction (PCR) using the oligonucleotide primers designed using Vector NTI Advance (version 11.5.4) and Primer3Plus ( ). .. PCR was performed for each primer set using either the standard Taq PCR kit (New England BioLabs) or the One Taq PCR kit with GC buffer (New England BioLabs) depending on the GC content of the target sequences.

    Article Title: Specific Magnetic Isolation of E6 HPV16 Modified Magnetizable Particles Coupled with PCR and Electrochemical Detection
    Article Snippet: .. The PCR mixture (Taq PCR kit, New England Biolabs, Ispwich, MA, USA), contained the PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl with 1.5 mM MgCl2 included), 0.2 mM of dNTPs and 0.4 µM of each primers with E6-HPV16-pUC57 synthetic plasmid using as a template. .. The DNA amplification was carried out for 40 cycles of the denaturation at 94 °C for 30 s, the annealing at 56 °C for 30 s and the primer extension at 72 °C for 30 s. The amplified E6-HPV16 oncogene was purified using MiniElute PCR Purification Kit (Qiagen, Germantown, MD, USA).

    Article Title: Identification of a transient Sox5 expressing progenitor population in the neonatal ventral forebrain by a novel cis-regulatory element
    Article Snippet: .. Reporter plasmid constructions Computationally-predicted conserved regions were amplified using the Taq PCR Kit (New England Biolabs, MA) following the routine Taq PCR reaction protocol. .. Mouse genomic DNA (Swiss Webster strain) was extracted from an adult mouse tail and used as the PCR template for all primers.

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs). .. PCR products were run on 1.5% ethidium bromide-stained agarose gels, excised, purified using a Gel Extraction Kit (Qiagen), ligated to pCR4-TOPO vector (Invitrogen), and transformed into DH5α E. coli (Zymo Research).

    Software:

    Article Title: Identification of a stable molecular signature in mammary tumor endothelial cells that persists in vitro
    Article Snippet: Primers were designed using either Invitrogen Primer Perfect Design Software or NCBI-Primer Blast. .. End-point PCR was carried out using a Taq PCR Kit (NEB) with the products resolved on agarose gels. qPCR was run in triplicate with Maxima SYBR Green (ThermoFisher) on an Applied Biosystems Step One Plus analyzer.

    SYBR Green Assay:

    Article Title: Identification of a stable molecular signature in mammary tumor endothelial cells that persists in vitro
    Article Snippet: .. End-point PCR was carried out using a Taq PCR Kit (NEB) with the products resolved on agarose gels. qPCR was run in triplicate with Maxima SYBR Green (ThermoFisher) on an Applied Biosystems Step One Plus analyzer. .. Cells were analyzed by flow cytometry as previously described using a BD Accuri® C6 Flow Cytometer [ , ].

    Multiplex Assay:

    Article Title: Prevalence of sweetpotato viruses in Acholi sub-region, northern Uganda
    Article Snippet: .. The reactions were then incubated in SimpliAmp Thermal Cycler (Life Technologies, Marsiling Industrial Estate Road3, Singapore) under the following conditions: 22 °C for 10 min, 42 °C for 40 min and 95 °C for 4 min. Multiplex PCR was completed in a 25 μl reaction volume using a Taq PCR kit (New England Biolabs Inc.). .. The reaction mixed contained 1X of 5 μl of PCR buffer, 1 mM of 2 μl of dNTP solution mix, 5000U/ml of 0.2 μl of Taq polymerase, 2.5 mg/ul of 4 μl of MgCl2 , 2 μl of cDNA templates, 10μM of 0.5 μl of forward primers, 10μM of 0.5 μl of reverse primers and PCR water to make the volume up to 25 μl.

    Denaturing Gradient Gel Electrophoresis:

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: By comparing their DGGE profiles, primer set ITS1FGC/ITS2 produced more distinct bands and therefore was selected to amplify a fragment of 280 bp of the single sequence repeats region of fungi in silages. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, USA).

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: A 40-bp GC clamp (5′-CGC CCG GGG CGC GCC CCG GGC GGC CCG GGG GCA CCG GGG G-3′) was attached to the 5′ end of primer 357F for DGGE analyses. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA).

    Agarose Gel Electrophoresis:

    Article Title: The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae)
    Article Snippet: Purified genomic DNA was amplified using the polymerase chain reaction (PCR) technique and the Taq PCR Kit (NEB, MA), under the following cycling parameters: 94°C for 3 min; 35 cycles of 30 s at 94°C, 40 s at 55–60°C, 1–3 min at 72°C; and 72°C for 10 min. .. The PCR products were detected by 1.0% agarose-gel electrophoresis and purified using a DNA gel extraction kit (TaKaRa, Japan).

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together. .. The presence or absence of PCR products was determined on a 1.0% (w/v) agarose gel with ethidium bromide staining.

    Article Title: Specific Magnetic Isolation of E6 HPV16 Modified Magnetizable Particles Coupled with PCR and Electrochemical Detection
    Article Snippet: The PCR mixture (Taq PCR kit, New England Biolabs, Ispwich, MA, USA), contained the PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl with 1.5 mM MgCl2 included), 0.2 mM of dNTPs and 0.4 µM of each primers with E6-HPV16-pUC57 synthetic plasmid using as a template. .. The amplified product of 477 base pairs was analyzed by agarose gel electrophoresis and the conditions were as follows: 1% agarose gel (Agarose MP, Roche Diagnostics, Indianapolis, IN, USA) in TAE buffer, at 60 V for 160 min (Bio-Rad, Hercules, CA, USA).

    Article Title: Leukemia regression by vascular disruption and antiangiogenic therapy
    Article Snippet: Human FLT3 internal tandem duplication (ITD) was amplified by single-step PCR using the New England BioLabs Taq PCR kit. .. Ten microliters of each PCR product were run on a 1% agarose gel and visualized under ultraviolet light after ethidium bromide staining.

    Electrophoresis:

    Article Title: The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae)
    Article Snippet: Purified genomic DNA was amplified using the polymerase chain reaction (PCR) technique and the Taq PCR Kit (NEB, MA), under the following cycling parameters: 94°C for 3 min; 35 cycles of 30 s at 94°C, 40 s at 55–60°C, 1–3 min at 72°C; and 72°C for 10 min. .. The PCR products were detected by 1.0% agarose-gel electrophoresis and purified using a DNA gel extraction kit (TaKaRa, Japan).

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA). .. PCR products (15 μL) were applied on 8% polyacrylamide gels (acrylamide:bis-acrylamide, 37.5:1) with a linear denaturing gradient range of 32% to 60% in 1× Tris-acetate-ethylenediaminetetra acetic acid electrophoresis buffer.

    Sampling:

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: Extractions from three replicates at each sampling depth were pooled at this step and analyzed as one sample in the subsequent analyses (resulting in sixteen pooled DNA samples). .. Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together.

    Produced:

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: By comparing their DGGE profiles, primer set ITS1FGC/ITS2 produced more distinct bands and therefore was selected to amplify a fragment of 280 bp of the single sequence repeats region of fungi in silages. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, USA).

    Article Title: Effects on microbial diversity of fermentation temperature (10°C and 20°C), long-term storage at 5°C, and subsequent warming of corn silage
    Article Snippet: For bacterial diversity, we tested four primer sets and retain 357F (5′-CCT ACG GGA GGC AGC AG-3′)/517R (5′-ATT ACC GCG GCT GCT GG-3′) [ ] since it produced more distinct bands from the V3 region of the 16S rDNA of bacteria from silage. .. PCR was carried out in a volume of 15 μL containing 1 μL of DNA template (50 ng), 1 X standard Taq reaction buffer, 200 μM of each deoxynucleotide, 0.3 μM of each primer and 0.025 U/μL of Taq DNA polymerase (Taq PCR Kit, New England BioLabs, Ipswich, MA, USA).

    DNA Purification:

    Article Title: Relative Roles of Deterministic and Stochastic Processes in Driving the Vertical Distribution of Bacterial Communities in a Permafrost Core from the Qinghai-Tibet Plateau, China
    Article Snippet: Pooled community DNA was purified using the Universal DNA Purification Kit (Tiangen Biotech, China) according to the manufacturer’s instructions. .. Amplification reactions were performed in a total volume of 25 μL containing 0.5 μM of each primer and 3 μL of template DNA using a Taq PCR Kit (New England Biolabs, MA, USA) with the following thermocycling conditions: an initial denaturation step of 5 min at 94°C and then subjected to 35 amplification cycles of 1 min denaturation at 94°C, 1 min annealing at 58°C, followed by 72°C for 1 min 30 s and a final extension of 72°C for 10 min. To mitigate individual PCR reaction biases, each amplification was performed in three replicates and pooled together.

    Article Title: Leukemia regression by vascular disruption and antiangiogenic therapy
    Article Snippet: Genomic DNA was isolated from test samples using the Wizard Genomic DNA purification kit (Promega). .. Human FLT3 internal tandem duplication (ITD) was amplified by single-step PCR using the New England BioLabs Taq PCR kit.

    Marker:

    Article Title: Specific Magnetic Isolation of E6 HPV16 Modified Magnetizable Particles Coupled with PCR and Electrochemical Detection
    Article Snippet: The PCR mixture (Taq PCR kit, New England Biolabs, Ispwich, MA, USA), contained the PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl with 1.5 mM MgCl2 included), 0.2 mM of dNTPs and 0.4 µM of each primers with E6-HPV16-pUC57 synthetic plasmid using as a template. .. The 100 bp DNA ladder (New England Biolabs, Ispwich, MA, USA) was used as a molecule size marker.

    Gel Extraction:

    Article Title: The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae)
    Article Snippet: Purified genomic DNA was amplified using the polymerase chain reaction (PCR) technique and the Taq PCR Kit (NEB, MA), under the following cycling parameters: 94°C for 3 min; 35 cycles of 30 s at 94°C, 40 s at 55–60°C, 1–3 min at 72°C; and 72°C for 10 min. .. The PCR products were detected by 1.0% agarose-gel electrophoresis and purified using a DNA gel extraction kit (TaKaRa, Japan).

    Article Title: Relative Importance of Deterministic and Stochastic Processes in Driving Arbuscular Mycorrhizal Fungal Assemblage during the Spreading of a Toxic Plant
    Article Snippet: Partial SSU rDNA fragments of AM fungi were amplified via nested PCR with a first primer pair GeoA2-Geo11 and a second primer pair NS31-AML2 , using the Taq PCR Kit (New England Biolabs, MA, USA). .. The second PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Inc, Hangzhou, China), and the expected DNA products (c. 560 bp) were obtained.

    Article Title: ChimeRScope: a novel alignment-free algorithm for fusion transcript prediction using paired-end RNA-Seq data
    Article Snippet: PCR was performed for each primer set using either the standard Taq PCR kit (New England BioLabs) or the One Taq PCR kit with GC buffer (New England BioLabs) depending on the GC content of the target sequences. .. The PCR products of the approximate expected amplicon size were extracted from the agarose gel using the GeneJET Gel Extraction Kit (ThermoScientific).

    Article Title: Differential Expression of Thrombospondin (THBS1) in Tumorigenic and Non-Tumorigenic Prostate Epithelial Cells in Response to a Chromatin-Binding Soy Peptide
    Article Snippet: PCR was carried out in a 25 μl reaction volume using a Taq PCR Kit (New England BioLabs). .. PCR products were run on 1.5% ethidium bromide-stained agarose gels, excised, purified using a Gel Extraction Kit (Qiagen), ligated to pCR4-TOPO vector (Invitrogen), and transformed into DH5α E. coli (Zymo Research).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs one taq pcr kit
    One Taq Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one taq pcr kit/product/New England Biolabs
    Average 95 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    one taq pcr kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results