manufactureã cents  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80
    Name:
    EpiMark Bisulfite Conversion Kit
    Description:
    EpiMark Bisulfite Conversion Kit 48 rxns
    Catalog Number:
    e3318s
    Price:
    166
    Size:
    48 rxns
    Category:
    DNA Fragment Analysis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs manufactureã cents
    EpiMark Bisulfite Conversion Kit
    EpiMark Bisulfite Conversion Kit 48 rxns
    https://www.bioz.com/result/manufactureã cents/product/New England Biolabs
    Average 80 stars, based on 12332 article reviews
    Price from $9.99 to $1999.99
    manufactureã cents - by Bioz Stars, 2020-04
    80/100 stars

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: Paragraph title: Bisulfite sequencing ... After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB).

    Article Title: Epigenetic Silencing of Apoptosis-Inducing Gene Expression Can Be Efficiently Overcome by Combined SAHA and TRAIL Treatment in Uterine Sarcoma Cells
    Article Snippet: .. For bisulfite sequencing analysis 1 μg of purified genomic DNA was treated with the EpiMark Bisulfite Conversion kit (NEB, Frankfurt, Germany) which, after bisulfite conversion and the subsequent desulphonation reaction, converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. .. Methylation-specific PCR (MSP) and bisulfite sequencing were performed as previously described .

    Article Title: Loss of RasGAP tumor suppressors underlie the aggressive nature of luminal B breast cancers
    Article Snippet: Paragraph title: Bisulfite Sequencing ... Genomic DNA was isolated using a Qiagen kit (cat. # 69504) and the bisulfite conversion reaction was performed using a New England BioLabs kit (cat. # E3318S).

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions. .. For bisulfite sequencing PCR (BSP) oligonucleotide primers 5′-TTGGGAGTTGGTTAGAAATGTA-3′ and 5′-AACAATACTTCCCAATTCCCT-3′ were designed to amplify a 270 bp fragment from bisulfite converted DNA.

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Paragraph title: Bisulfite sequencing ... Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol.

    Article Title: Establishment of a CpG island microarray for analyses of genome-wide DNA methylation in Chinese hamster ovary cells
    Article Snippet: Paragraph title: Bisulfite sequencing ... Bisulfite conversion of 500 ng genomic DNA was carried out using the Epimark Bisulfite Conversion Kit (NEB) according to the manufacturer´s protocol.

    Clone Assay:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. The resulting DNA extracts were cloned into the pGEM T-easy subcloning vector (Promega), and 2 μl of ligation reaction was then transformed into 50 μl of 5α competent cells (NEB), and grown overnight on ampicillin-LB-Agar plates at 37C (NEB).

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. At least 10 clones of each PCR product were subjected to Sanger sequencing, and CpG methylation was analyzed by Quantification Tool for Methylation Analysis (QUMA) .

    Article Title: The epigenetic regulation of HsMar1, a human DNA transposon
    Article Snippet: Methylation analysis 500 ng of genomic DNA (from recombinant CHO and HeLa cell lines) was treated with sodium bisulfite according to Epimark bisulfite conversion kit (New England Biolabs). .. PCR products were cloned in pGEMT and sequenced by Eurofins.

    Amplification:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. Following cleanup, bisulfite-specific PCR amplicons were amplified using GoTaq 2X, covering the promoter region (Promega).

    Article Title: Successful knock-in of Hypertrophic Cardiomyopathy-mutation R723G into the MYH7 gene mimics HCM pathology in pigs
    Article Snippet: .. Genomic DNA was subjected to bisulfite conversion using the EpiMark Bisulfite Conversion Kit (NEB, USA) according to the suppliers’ instructions and subsequently the MYH7- promotor was PCR amplified. .. PCR-products were subjected to Sanger sequencing and methylation status of each CpG site was assessed semi-quantitatively from the sequence chromatograms .

    Article Title: Loss of RasGAP tumor suppressors underlie the aggressive nature of luminal B breast cancers
    Article Snippet: Genomic DNA was isolated using a Qiagen kit (cat. # 69504) and the bisulfite conversion reaction was performed using a New England BioLabs kit (cat. # E3318S). .. The primers used for amplifying up the CpG region of interest were designed using the MethPrimer browser (( )) and were as follows: DAB2IP 5’ AGAATTCGGGATAGGTTTAAAGTTGTAGT 3’ AGAATTCCCTCTTAACCCCAAATAACTAT RASAL2 5’ AGAATTCTGTTTTTTAGTAAAAGAATGGGATTG 3’ AGAATTCACAAACTCTTACCTAAAATCTACAT The amplification PCR reaction was carried out using a kit from New England Biolabs (cat. # M0490) and the reaction was set up and run according to the manufacturer’s instructions.

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: PCR —1575bp and 1605bp fragments of p38δ MAPK mRNA, corresponding to positions 111–1686 and 82–1686 respectively of NCBI Reference Sequence NM_002754.4 were amplified from cellular cDNA using oligonucleotide primers P003F (5′-CGAGATCGGGTGCCCGGGAT-3′) or P002F (5′-CCGGAAAAAGGGCTTCTACAA-3′) and P001R (5′-CCGCCACAAGCTAAAAAGAG-3′). .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions.

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB). .. Modified DNA was then amplified using EpiMark Hot Start Taq DNA polymerase (NEB), with primers listed in Supplementary Table , and purified with a PCR purification kit (Qiagen).

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. Bisulfite-modified DNA (40 ng) was amplified by PCR using Platinum™ Taq DNA polymerase and primer pairs (see below) to cover the BRCA1 promoter (GenBank Accession No. U37574).

    Article Title: Establishment of a CpG island microarray for analyses of genome-wide DNA methylation in Chinese hamster ovary cells
    Article Snippet: Bisulfite conversion of 500 ng genomic DNA was carried out using the Epimark Bisulfite Conversion Kit (NEB) according to the manufacturer´s protocol. .. Specific genomic regions were amplified using Epimark Taq polymerase (NEB) and primers specific for bisulfite converted DNA (Metabion, Martinsried, Germany).

    Article Title: The epigenetic regulation of HsMar1, a human DNA transposon
    Article Snippet: Methylation analysis 500 ng of genomic DNA (from recombinant CHO and HeLa cell lines) was treated with sodium bisulfite according to Epimark bisulfite conversion kit (New England Biolabs). .. Fragments adjacent to the 5′ and the 3′ recombinant HsMar1 TIRs were amplified using 50 ng of treated DNA and the m-primers designed by Methprimer (Additional file : Table S1).

    Polymerase Chain Reaction:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. Following cleanup, bisulfite-specific PCR amplicons were amplified using GoTaq 2X, covering the promoter region (Promega).

    Article Title: Successful knock-in of Hypertrophic Cardiomyopathy-mutation R723G into the MYH7 gene mimics HCM pathology in pigs
    Article Snippet: .. Genomic DNA was subjected to bisulfite conversion using the EpiMark Bisulfite Conversion Kit (NEB, USA) according to the suppliers’ instructions and subsequently the MYH7- promotor was PCR amplified. .. PCR-products were subjected to Sanger sequencing and methylation status of each CpG site was assessed semi-quantitatively from the sequence chromatograms .

    Article Title: Epigenetic Silencing of Apoptosis-Inducing Gene Expression Can Be Efficiently Overcome by Combined SAHA and TRAIL Treatment in Uterine Sarcoma Cells
    Article Snippet: Paragraph title: Methylation-specific PCR and bisulfite sequencing ... For bisulfite sequencing analysis 1 μg of purified genomic DNA was treated with the EpiMark Bisulfite Conversion kit (NEB, Frankfurt, Germany) which, after bisulfite conversion and the subsequent desulphonation reaction, converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected.

    Article Title: Loss of RasGAP tumor suppressors underlie the aggressive nature of luminal B breast cancers
    Article Snippet: Genomic DNA was isolated using a Qiagen kit (cat. # 69504) and the bisulfite conversion reaction was performed using a New England BioLabs kit (cat. # E3318S). .. The primers used for amplifying up the CpG region of interest were designed using the MethPrimer browser (( )) and were as follows: DAB2IP 5’ AGAATTCGGGATAGGTTTAAAGTTGTAGT 3’ AGAATTCCCTCTTAACCCCAAATAACTAT RASAL2 5’ AGAATTCTGTTTTTTAGTAAAAGAATGGGATTG 3’ AGAATTCACAAACTCTTACCTAAAATCTACAT The amplification PCR reaction was carried out using a kit from New England Biolabs (cat. # M0490) and the reaction was set up and run according to the manufacturer’s instructions.

    Article Title: DNA Methylation of BDNF Gene in Schizophrenia
    Article Snippet: Methylation-specific PCR was performed with primers specific for either methylated or unmethylated DNA. .. We treated 100 ng DNA samples with EpiMark Bisulfite Conversion Kit (Catalog No. E3318, New England Biolabs), in accordance with the manufacturer’s standard instructions.

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: PCR —1575bp and 1605bp fragments of p38δ MAPK mRNA, corresponding to positions 111–1686 and 82–1686 respectively of NCBI Reference Sequence NM_002754.4 were amplified from cellular cDNA using oligonucleotide primers P003F (5′-CGAGATCGGGTGCCCGGGAT-3′) or P002F (5′-CCGGAAAAAGGGCTTCTACAA-3′) and P001R (5′-CCGCCACAAGCTAAAAAGAG-3′). .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions.

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB). .. Modified DNA was then amplified using EpiMark Hot Start Taq DNA polymerase (NEB), with primers listed in Supplementary Table , and purified with a PCR purification kit (Qiagen).

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. Bisulfite-modified DNA (40 ng) was amplified by PCR using Platinum™ Taq DNA polymerase and primer pairs (see below) to cover the BRCA1 promoter (GenBank Accession No. U37574).

    Article Title: The epigenetic regulation of HsMar1, a human DNA transposon
    Article Snippet: Methylation analysis 500 ng of genomic DNA (from recombinant CHO and HeLa cell lines) was treated with sodium bisulfite according to Epimark bisulfite conversion kit (New England Biolabs). .. PCR products were cloned in pGEMT and sequenced by Eurofins.

    TA Cloning:

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. The PCR products were run on a 1% agarose gel, excised, extracted using QIAquick Gel Extraction Kit (Qiagen), and subcloned into pCR™ 2.1-TOPO® TA vector using TOPO® TA Cloning® Kit (ThermoFisher Scientific).

    Quantitative RT-PCR:

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: Quantitative rt-PCR —p38δ MAPK mRNA expression was quantitated using a Qiagen QuantiFast® MAPK13 Probe Assay with one-step rt-PCR and simultaneous detection of GAPDH according to manufacturer′s instructions. .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Immunoprecipitated DNA was extracted with phenol/chloroform and analyzed using quantitative PCR (qPCR), as described below. .. Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB).

    Expressing:

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: Quantitative rt-PCR —p38δ MAPK mRNA expression was quantitated using a Qiagen QuantiFast® MAPK13 Probe Assay with one-step rt-PCR and simultaneous detection of GAPDH according to manufacturer′s instructions. .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions.

    Modification:

    Article Title: Quantitative and multiplexed DNA methylation analysis using long-read single-molecule real-time bisulfite sequencing (SMRT-BS)
    Article Snippet: .. Six commercial kits were evaluated: (1) Diagenode Premium Bisulfite Kit, (2) Epigentek Methylamp DNA Modification Kit, (3) NEB EpiMark Bisulfite Conversion Kit, (4) Promega MethylEdge Bisulfite Conversion System, (5) Qiagen EpiTect Bisulfite Kit, and (6) Zymo EZ-DNA Methylation-Gold Kit. .. Bisulfite-treated DNAs were quantified using the NanoDrop 1000 and sized with a 2100 Bioanalyzer using the RNA6000 Pico kit (Agilent Technologies).

    Article Title: DNA Methylation of BDNF Gene in Schizophrenia
    Article Snippet: We treated 100 ng DNA samples with EpiMark Bisulfite Conversion Kit (Catalog No. E3318, New England Biolabs), in accordance with the manufacturer’s standard instructions. .. PCR mixture contained 10 ng of modified DNA, 2.0 mmol each of dATP, dGTP, dCTP, and dTTP, 1.0 pmol each of primer, 2.0 mmol MgCl2, 1× reaction buffer, and 1.0 U Taq polymerase.

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB). .. Modified DNA was then amplified using EpiMark Hot Start Taq DNA polymerase (NEB), with primers listed in Supplementary Table , and purified with a PCR purification kit (Qiagen).

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: .. Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. Bisulfite-modified DNA (40 ng) was amplified by PCR using Platinum™ Taq DNA polymerase and primer pairs (see below) to cover the BRCA1 promoter (GenBank Accession No. U37574).

    Transformation Assay:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. The resulting DNA extracts were cloned into the pGEM T-easy subcloning vector (Promega), and 2 μl of ligation reaction was then transformed into 50 μl of 5α competent cells (NEB), and grown overnight on ampicillin-LB-Agar plates at 37C (NEB).

    Transfection:

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Bisulfite sequencing Cells were harvested 48 h after siRNA transfection, and genomic DNA was extracted using phenol-chloroform. .. Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol.

    Ligation:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. The resulting DNA extracts were cloned into the pGEM T-easy subcloning vector (Promega), and 2 μl of ligation reaction was then transformed into 50 μl of 5α competent cells (NEB), and grown overnight on ampicillin-LB-Agar plates at 37C (NEB).

    CpG Methylation Assay:

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. At least 10 clones of each PCR product were subjected to Sanger sequencing, and CpG methylation was analyzed by Quantification Tool for Methylation Analysis (QUMA) .

    Sequencing:

    Article Title: Successful knock-in of Hypertrophic Cardiomyopathy-mutation R723G into the MYH7 gene mimics HCM pathology in pigs
    Article Snippet: Genomic DNA was subjected to bisulfite conversion using the EpiMark Bisulfite Conversion Kit (NEB, USA) according to the suppliers’ instructions and subsequently the MYH7- promotor was PCR amplified. .. PCR-products were subjected to Sanger sequencing and methylation status of each CpG site was assessed semi-quantitatively from the sequence chromatograms .

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: PCR —1575bp and 1605bp fragments of p38δ MAPK mRNA, corresponding to positions 111–1686 and 82–1686 respectively of NCBI Reference Sequence NM_002754.4 were amplified from cellular cDNA using oligonucleotide primers P003F (5′-CGAGATCGGGTGCCCGGGAT-3′) or P002F (5′-CCGGAAAAAGGGCTTCTACAA-3′) and P001R (5′-CCGCCACAAGCTAAAAAGAG-3′). .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions.

    Article Title: Molecular effect of an OPTN common variant associated to Paget's disease of bone
    Article Snippet: .. Methylation analysis by bisulfite conversion and sanger sequencing Sodium bisulfite treatment was performed on 1.5 μg of genomic DNA sample using the EpiMark® Bisulfite Conversion Kit [ ] (New England Biolabs Inc., Canada) following the manufacturers’ standard protocol. .. Cell culture conditions The U937 (Human monocytes/lymphoma) and U2OS (Human bone osteosarcoma) cell lines were grown in Dulbecco's modified eagle medium (DMEM), supplemented with 10% fetal bovine serum (FBS), 2mM L-glutamine and 1% penicillin/streptomycin (P/S).

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. At least 10 clones of each PCR product were subjected to Sanger sequencing, and CpG methylation was analyzed by Quantification Tool for Methylation Analysis (QUMA) .

    Recombinant:

    Article Title: The epigenetic regulation of HsMar1, a human DNA transposon
    Article Snippet: .. Methylation analysis 500 ng of genomic DNA (from recombinant CHO and HeLa cell lines) was treated with sodium bisulfite according to Epimark bisulfite conversion kit (New England Biolabs). .. Fragments adjacent to the 5′ and the 3′ recombinant HsMar1 TIRs were amplified using 50 ng of treated DNA and the m-primers designed by Methprimer (Additional file : Table S1).

    Staining:

    Article Title: Epigenetic Silencing of Apoptosis-Inducing Gene Expression Can Be Efficiently Overcome by Combined SAHA and TRAIL Treatment in Uterine Sarcoma Cells
    Article Snippet: For bisulfite sequencing analysis 1 μg of purified genomic DNA was treated with the EpiMark Bisulfite Conversion kit (NEB, Frankfurt, Germany) which, after bisulfite conversion and the subsequent desulphonation reaction, converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. .. MSP amplicons were run on a 2% agarose gel, stained with ethidium bromide, and visualized by UV illumination.

    MTT Assay:

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: Migrated cells were treated with MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (5 mg/mL) and absorbance read at 540 nm to calculate viable cell numbers as previously described [ ]. .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions.

    Methylation:

    Article Title: Successful knock-in of Hypertrophic Cardiomyopathy-mutation R723G into the MYH7 gene mimics HCM pathology in pigs
    Article Snippet: Paragraph title: Methylation analysis of the MYH7 -gene ... Genomic DNA was subjected to bisulfite conversion using the EpiMark Bisulfite Conversion Kit (NEB, USA) according to the suppliers’ instructions and subsequently the MYH7- promotor was PCR amplified.

    Article Title: Epigenetic Silencing of Apoptosis-Inducing Gene Expression Can Be Efficiently Overcome by Combined SAHA and TRAIL Treatment in Uterine Sarcoma Cells
    Article Snippet: Paragraph title: Methylation-specific PCR and bisulfite sequencing ... For bisulfite sequencing analysis 1 μg of purified genomic DNA was treated with the EpiMark Bisulfite Conversion kit (NEB, Frankfurt, Germany) which, after bisulfite conversion and the subsequent desulphonation reaction, converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected.

    Article Title: Quantitative and multiplexed DNA methylation analysis using long-read single-molecule real-time bisulfite sequencing (SMRT-BS)
    Article Snippet: .. Six commercial kits were evaluated: (1) Diagenode Premium Bisulfite Kit, (2) Epigentek Methylamp DNA Modification Kit, (3) NEB EpiMark Bisulfite Conversion Kit, (4) Promega MethylEdge Bisulfite Conversion System, (5) Qiagen EpiTect Bisulfite Kit, and (6) Zymo EZ-DNA Methylation-Gold Kit. .. Bisulfite-treated DNAs were quantified using the NanoDrop 1000 and sized with a 2100 Bioanalyzer using the RNA6000 Pico kit (Agilent Technologies).

    Article Title: DNA Methylation of BDNF Gene in Schizophrenia
    Article Snippet: Methylation-specific PCR was performed with primers specific for either methylated or unmethylated DNA. .. We treated 100 ng DNA samples with EpiMark Bisulfite Conversion Kit (Catalog No. E3318, New England Biolabs), in accordance with the manufacturer’s standard instructions.

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions. .. Methylation-specific PCR (MSP) is a method of assessing the methylation status of a group of CpG sites using individual pairs of primers specific for methylated (M) versus unmethylated (U) DNA [ ].

    Article Title: Molecular effect of an OPTN common variant associated to Paget's disease of bone
    Article Snippet: .. Methylation analysis by bisulfite conversion and sanger sequencing Sodium bisulfite treatment was performed on 1.5 μg of genomic DNA sample using the EpiMark® Bisulfite Conversion Kit [ ] (New England Biolabs Inc., Canada) following the manufacturers’ standard protocol. .. Cell culture conditions The U937 (Human monocytes/lymphoma) and U2OS (Human bone osteosarcoma) cell lines were grown in Dulbecco's modified eagle medium (DMEM), supplemented with 10% fetal bovine serum (FBS), 2mM L-glutamine and 1% penicillin/streptomycin (P/S).

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB). .. Methylation was then assessed through Sanger-sequencing of the NAPRT promoter.

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. At least 10 clones of each PCR product were subjected to Sanger sequencing, and CpG methylation was analyzed by Quantification Tool for Methylation Analysis (QUMA) .

    Article Title: Establishment of a CpG island microarray for analyses of genome-wide DNA methylation in Chinese hamster ovary cells
    Article Snippet: Bisulfite sequencing The efficiency of enrichment of methylated DNA was compared to bisulfite sequencing experiments of promoter regions of a positive (branched chain-amino-acid aminotransferase cytosolic-like, Bcat1 , GeneID 100763658) and a negative (β-actin, Actb , GeneID 100689477) control. .. Bisulfite conversion of 500 ng genomic DNA was carried out using the Epimark Bisulfite Conversion Kit (NEB) according to the manufacturer´s protocol.

    Article Title: The epigenetic regulation of HsMar1, a human DNA transposon
    Article Snippet: .. Methylation analysis 500 ng of genomic DNA (from recombinant CHO and HeLa cell lines) was treated with sodium bisulfite according to Epimark bisulfite conversion kit (New England Biolabs). .. Fragments adjacent to the 5′ and the 3′ recombinant HsMar1 TIRs were amplified using 50 ng of treated DNA and the m-primers designed by Methprimer (Additional file : Table S1).

    Isolation:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: .. After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. Following cleanup, bisulfite-specific PCR amplicons were amplified using GoTaq 2X, covering the promoter region (Promega).

    Article Title: Epigenetic Silencing of Apoptosis-Inducing Gene Expression Can Be Efficiently Overcome by Combined SAHA and TRAIL Treatment in Uterine Sarcoma Cells
    Article Snippet: Methylation-specific PCR and bisulfite sequencing Genomic DNA was isolated according to standard methods using a proteinase K digest. .. For bisulfite sequencing analysis 1 μg of purified genomic DNA was treated with the EpiMark Bisulfite Conversion kit (NEB, Frankfurt, Germany) which, after bisulfite conversion and the subsequent desulphonation reaction, converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected.

    Article Title: Loss of RasGAP tumor suppressors underlie the aggressive nature of luminal B breast cancers
    Article Snippet: .. Genomic DNA was isolated using a Qiagen kit (cat. # 69504) and the bisulfite conversion reaction was performed using a New England BioLabs kit (cat. # E3318S). .. The primers used for amplifying up the CpG region of interest were designed using the MethPrimer browser (( )) and were as follows: DAB2IP 5’ AGAATTCGGGATAGGTTTAAAGTTGTAGT 3’ AGAATTCCCTCTTAACCCCAAATAACTAT RASAL2 5’ AGAATTCTGTTTTTTAGTAAAAGAATGGGATTG 3’ AGAATTCACAAACTCTTACCTAAAATCTACAT The amplification PCR reaction was carried out using a kit from New England Biolabs (cat. # M0490) and the reaction was set up and run according to the manufacturer’s instructions.

    Subcloning:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. The resulting DNA extracts were cloned into the pGEM T-easy subcloning vector (Promega), and 2 μl of ligation reaction was then transformed into 50 μl of 5α competent cells (NEB), and grown overnight on ampicillin-LB-Agar plates at 37C (NEB).

    Purification:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. These PCR products of 170 bp. were run on 2% agarose gels, and the bands of interest were isolated and gel purified with the Qiaquick PCR purification kit (Qiagen).

    Article Title: Epigenetic Silencing of Apoptosis-Inducing Gene Expression Can Be Efficiently Overcome by Combined SAHA and TRAIL Treatment in Uterine Sarcoma Cells
    Article Snippet: .. For bisulfite sequencing analysis 1 μg of purified genomic DNA was treated with the EpiMark Bisulfite Conversion kit (NEB, Frankfurt, Germany) which, after bisulfite conversion and the subsequent desulphonation reaction, converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. .. Methylation-specific PCR (MSP) and bisulfite sequencing were performed as previously described .

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Me/hME-DIP, bisulfite conversion, and global 5-hmC detection Genomic DNA was purified using the Wizard Genomic DNA purification kit (Promega), and subsequently immunoprecipitated or bisulfite-converted. .. Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Hypermethylation of MAPK13 Promoter in Oesophageal Squamous Cell Carcinoma Is Associated with Loss of p38δ MAPK Expression
    Article Snippet: Quantitative rt-PCR —p38δ MAPK mRNA expression was quantitated using a Qiagen QuantiFast® MAPK13 Probe Assay with one-step rt-PCR and simultaneous detection of GAPDH according to manufacturer′s instructions. .. Methylation analysis — The methylation status of DNA was determined using sodium bisulfite conversion with an EpiMark® Bisulfite Conversion Kit (New England BioLabs, Hertfordshire, UK) according to manufacturer′s instructions.

    Lysis:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: For sperm samples, the mirVana RNA extraction lysis buffer treatment was performed prior to this extraction (Life Technologies). .. After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB).

    Plasmid Preparation:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB). .. The resulting DNA extracts were cloned into the pGEM T-easy subcloning vector (Promega), and 2 μl of ligation reaction was then transformed into 50 μl of 5α competent cells (NEB), and grown overnight on ampicillin-LB-Agar plates at 37C (NEB).

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. The PCR products were run on a 1% agarose gel, excised, extracted using QIAquick Gel Extraction Kit (Qiagen), and subcloned into pCR™ 2.1-TOPO® TA vector using TOPO® TA Cloning® Kit (ThermoFisher Scientific).

    Software:

    Article Title: Successful knock-in of Hypertrophic Cardiomyopathy-mutation R723G into the MYH7 gene mimics HCM pathology in pigs
    Article Snippet: Methylation analysis of the MYH7 -gene CpG-island detection in the MYH7 promotor and Bisulfite specific primer design was accomplished using the software Methyl Primer express. .. Genomic DNA was subjected to bisulfite conversion using the EpiMark Bisulfite Conversion Kit (NEB, USA) according to the suppliers’ instructions and subsequently the MYH7- promotor was PCR amplified.

    Article Title: The epigenetic regulation of HsMar1, a human DNA transposon
    Article Snippet: Methylation analysis 500 ng of genomic DNA (from recombinant CHO and HeLa cell lines) was treated with sodium bisulfite according to Epimark bisulfite conversion kit (New England Biolabs). .. Analysis of CpG methylations was done using the QUMA software.

    RNA Extraction:

    Article Title: Breeding scheme and maternal small RNAs affect the efficiency of transgenerational inheritance of a paramutation in mice
    Article Snippet: For sperm samples, the mirVana RNA extraction lysis buffer treatment was performed prior to this extraction (Life Technologies). .. After gDNA was isolated, 1 μg was bisulfite treated, following the instructions with the NEB Epimark Bisulfite Conversion Kit (NEB).

    Agarose Gel Electrophoresis:

    Article Title: Epigenetic Silencing of Apoptosis-Inducing Gene Expression Can Be Efficiently Overcome by Combined SAHA and TRAIL Treatment in Uterine Sarcoma Cells
    Article Snippet: For bisulfite sequencing analysis 1 μg of purified genomic DNA was treated with the EpiMark Bisulfite Conversion kit (NEB, Frankfurt, Germany) which, after bisulfite conversion and the subsequent desulphonation reaction, converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. .. MSP amplicons were run on a 2% agarose gel, stained with ethidium bromide, and visualized by UV illumination.

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. The PCR products were run on a 1% agarose gel, excised, extracted using QIAquick Gel Extraction Kit (Qiagen), and subcloned into pCR™ 2.1-TOPO® TA vector using TOPO® TA Cloning® Kit (ThermoFisher Scientific).

    Immunoprecipitation:

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Immunoprecipitated DNA was extracted with phenol/chloroform and analyzed using quantitative PCR (qPCR), as described below. .. Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB).

    DNA Purification:

    Article Title: PPM1D mutations silence NAPRT gene expression and confer NAMPT inhibitor sensitivity in glioma
    Article Snippet: Me/hME-DIP, bisulfite conversion, and global 5-hmC detection Genomic DNA was purified using the Wizard Genomic DNA purification kit (Promega), and subsequently immunoprecipitated or bisulfite-converted. .. Bisulfite conversion was performed via EpiMark Bisulfite Conversion kit (NEB).

    Gel Extraction:

    Article Title: ZC3H18 specifically binds and activates the BRCA1 promoter to facilitate homologous recombination in ovarian cancer
    Article Snippet: Genomic DNA (2 µg) was modified with bisulfite using the EpiMark® Bisulfite Conversion Kit (New England Biolabs) according to the supplier’s protocol. .. The PCR products were run on a 1% agarose gel, excised, extracted using QIAquick Gel Extraction Kit (Qiagen), and subcloned into pCR™ 2.1-TOPO® TA vector using TOPO® TA Cloning® Kit (ThermoFisher Scientific).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs epimark bisulfite conversion kit
    Epimark Bisulfite Conversion Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/epimark bisulfite conversion kit/product/New England Biolabs
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    epimark bisulfite conversion kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results