luna universal one step rt qpcr kits  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    Luna Universal One-Step RT-qPCR Kit
    Description:

    Catalog Number:
    E3005
    Price:
    None
    Buy from Supplier


    Structured Review

    New England Biolabs luna universal one step rt qpcr kits
    Expression level of differentially expressed <t>lncRNAs</t> in NSTEMI and STEMI patients. ENST00000508020.2, LNC_002011, LNC_000303 LNC_000898, ENST00000573866.2, and ENST00000562710.1 was detected by <t>qPCR</t> and normalized by GAPHD expression in STEMI patients and NSTEMI patients (All P values were less than .05). lncRNAs = long noncoding RNAs, NSTEMI = non-ST-elevation myocardial infarction, STEMI = ST-elevation myocardial infarction.

    https://www.bioz.com/result/luna universal one step rt qpcr kits/product/New England Biolabs
    Average 98 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    luna universal one step rt qpcr kits - by Bioz Stars, 2019-09
    98/100 stars

    Images

    1) Product Images from "Differential expression of circulating long non-coding RNAs in patients with acute myocardial infarction"

    Article Title: Differential expression of circulating long non-coding RNAs in patients with acute myocardial infarction

    Journal: Medicine

    doi: 10.1097/MD.0000000000013066

    Expression level of differentially expressed lncRNAs in NSTEMI and STEMI patients. ENST00000508020.2, LNC_002011, LNC_000303 LNC_000898, ENST00000573866.2, and ENST00000562710.1 was detected by qPCR and normalized by GAPHD expression in STEMI patients and NSTEMI patients (All P values were less than .05). lncRNAs = long noncoding RNAs, NSTEMI = non-ST-elevation myocardial infarction, STEMI = ST-elevation myocardial infarction.
    Figure Legend Snippet: Expression level of differentially expressed lncRNAs in NSTEMI and STEMI patients. ENST00000508020.2, LNC_002011, LNC_000303 LNC_000898, ENST00000573866.2, and ENST00000562710.1 was detected by qPCR and normalized by GAPHD expression in STEMI patients and NSTEMI patients (All P values were less than .05). lncRNAs = long noncoding RNAs, NSTEMI = non-ST-elevation myocardial infarction, STEMI = ST-elevation myocardial infarction.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Related Articles

    SYBR Green Assay:

    Article Title: The lncRNA MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating miRNA-487a
    Article Snippet: PCR systems were prepared using a Luna Universal One-Step RT-qPCR Kit (NEB). .. To detect the expression of miRNA-487a, an miRNeasy Mini Kit (QIAGEN) was used to extract miRNA.

    RNA Extraction:

    Article Title: The lncRNA MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating miRNA-487a
    Article Snippet: To detect the expression of MIR4435-2HG, total RNA was extracted using an MPure Total RNA Extraction Kit (117,022,160, MP Biomedicals). .. PCR systems were prepared using a Luna Universal One-Step RT-qPCR Kit (NEB).

    Article Title: Growth enhancement of porcine epidemic diarrhea virus (PEDV) in Vero E6 cells expressing PEDV nucleocapsid protein
    Article Snippet: For analysis of viral RNA synthesis, total RNA was extracted from Vero E6 or Vero E6-N cells infected with PEDV-AVCT12-mCherry (MOI = 0.0001) at indicated time points using the RNA extraction kit (Thermo Scientific). .. One-step RT-qPCR was performed as described above, except with Luna Universal One-Step RT-qPCR mix (New England Biolabs).

    Over Expression:

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. .. qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system.

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Functional testing of mCherry-irg1l fusion protein was performed by RNA overexpression, followed by qRT-PCR assays of mmp9 target gene induction ( ). .. Total RNA (100 ng) was used in a one-step qRT-PCR (Luna Universal One-Step RT-qPCR Kit, NEB) and performed on a Roche LightCycler 96 system.

    RNA Sequencing Assay:

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Plasmids were sequence verified before downstream assembly. .. qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. .. Primers were designed for verifying some of the up-regulated and immune-related genes (see table S1 for primers used).

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. .. Total RNA (100 ng) was used in a one-step qRT-PCR (Luna Universal One-Step RT-qPCR Kit, NEB) and performed on a Roche LightCycler 96 system.

    Article Title: Expression profiles of long noncoding RNAs and mRNAs in peripheral blood mononuclear cells of patients with acute myocardial infarction
    Article Snippet: 2.6 To validate the reliability of RNA sequencing data, differentially expressed lncRNAs were randomly selected and qRT-PCR was employed to examine the expression level of lncRNAs. .. And qRT-PCR reactions were performed by using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA).

    In Vitro:

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. .. Functional testing of mCherry-irg1l fusion protein was performed by RNA overexpression, followed by qRT-PCR assays of mmp9 target gene induction ( ).

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Briefly, untagged irg1l and mCherry-irg1l were subcloned into pCS2+ vectors and used as templates for in vitro transcription. .. Total RNA (100 ng) was used in a one-step qRT-PCR (Luna Universal One-Step RT-qPCR Kit, NEB) and performed on a Roche LightCycler 96 system.

    Synthesized:

    Article Title: The lncRNA MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating miRNA-487a
    Article Snippet: PCR systems were prepared using a Luna Universal One-Step RT-qPCR Kit (NEB). .. A TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) was used to perform reverse transcription and a miScript SYBR Green PCR Kit (QIAGEN) was used to prepare PCR systems.

    Article Title: Differential expression of circulating long non-coding RNAs in patients with acute myocardial infarction
    Article Snippet: Significance is judged when P value is < .05. .. 2.6 cDNA was synthesized and Real-Time Quantitative PCR (RT-qPCR) of lncRNAs expression level was performed using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA) according to the manufacturer's protocol. .. The PCR were performed on the LightCycler 480/II machine (Roche, Mannheim, Germany) and the PCR conditions were set as follow: 1 cycle of 10 minutes at 55 °C, 1 cycle of 1 minute at 95 °C, 45 cycles of 10 second at 95 °C and 30 seconds at 60 °C, and 1 cycle of 1 minute at 60 °C finally.

    Isolation:

    Article Title: CBX2 identified as driver of anoikis escape and dissemination in high grade serous ovarian cancer
    Article Snippet: RNA was isolated using RNAeasy Plus Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. .. RT-qPCR was performed using the Luna Universal One-step RT-qPCR kit (New England BioLabs, Ipswich, MA) on a BioRad CFX96 or Applied Biosystems QuantStudio 6 Flex thermocycler using primers for specific target transcripts; 18s rRNA was examined as a housekeeping gene (Supplementary Table ).

    Functional Assay:

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. .. qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system.

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Functional testing of mCherry-irg1l fusion protein was performed by RNA overexpression, followed by qRT-PCR assays of mmp9 target gene induction ( ). .. Total RNA (100 ng) was used in a one-step qRT-PCR (Luna Universal One-Step RT-qPCR Kit, NEB) and performed on a Roche LightCycler 96 system.

    Quantitative RT-PCR:

    Article Title: The lncRNA MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating miRNA-487a
    Article Snippet: Reverse transcription was performed using a gb Reverse Transcription Kit (Generi Biotech). .. PCR systems were prepared using a Luna Universal One-Step RT-qPCR Kit (NEB). .. To detect the expression of miRNA-487a, an miRNeasy Mini Kit (QIAGEN) was used to extract miRNA.

    Article Title: Differential expression of circulating long non-coding RNAs in patients with acute myocardial infarction
    Article Snippet: Significance is judged when P value is < .05. .. 2.6 cDNA was synthesized and Real-Time Quantitative PCR (RT-qPCR) of lncRNAs expression level was performed using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA) according to the manufacturer's protocol. .. The PCR were performed on the LightCycler 480/II machine (Roche, Mannheim, Germany) and the PCR conditions were set as follow: 1 cycle of 10 minutes at 55 °C, 1 cycle of 1 minute at 95 °C, 45 cycles of 10 second at 95 °C and 30 seconds at 60 °C, and 1 cycle of 1 minute at 60 °C finally.

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Plasmids were sequence verified before downstream assembly. .. qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. .. Primers were designed for verifying some of the up-regulated and immune-related genes (see table S1 for primers used).

    Article Title: CBX2 identified as driver of anoikis escape and dissemination in high grade serous ovarian cancer
    Article Snippet: NanoDrop spectrophotometry was performed to confirm the concentration of extracted RNA. .. RT-qPCR was performed using the Luna Universal One-step RT-qPCR kit (New England BioLabs, Ipswich, MA) on a BioRad CFX96 or Applied Biosystems QuantStudio 6 Flex thermocycler using primers for specific target transcripts; 18s rRNA was examined as a housekeeping gene (Supplementary Table ). .. CBX2-specific shRNA were obtained from the University of Colorado Functional Genomics Facility (CBX2 #1: TRCN 0000020327 and CBX2 #2: TRCN 0000020328).

    Article Title: LncRNA HAND2-AS1 inhibits non-small cell lung cancer migration, invasion and maintains cell stemness through the interactions with TGF-β1
    Article Snippet: Total RNA samples were subjected to reverse transcription using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). .. Luna® Universal One-Step RT-qPCR Kit (NEB) was used to prepare all PCR reaction systems. .. Sequences of primers used in PCR reactions were: 5′-GGGTGTTTACGTAGACCAGAACC-3′ (forward) and 5′-CTTCCAAAAGCCTTCTGCCTTAG-3′ (reverse) for human lncRNA HAND2-AS1; 5′- GACCTCTATGCCAACACAGT3′ (forward) and 5′- AGTACTTGCGCTCAGGAGGA3′ (reverse) for β-actin.

    Article Title: Development of a Dual-Vector System Utilizing MicroRNA Mimics of the Autographa californica miR-1 for an Inducible Knockdown in Insect Cells
    Article Snippet: The genomic DNA contamination of the RNA samples was removed with the TURBO DNA-free Kit (Invitrogen). .. Reverse transcription and subsequent RT-qPCR was carried out in a single reaction with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s instructions. .. For the quantification of eYFP mRNA levels, sequence-specific primers (F: 5’-GGCACAAGCTGGAGTACAAC-3’; R: 5’-AGTTCACCTTGATGCCGTTC-3’) that were designed with the GenScript Real-time PCR Primer Design online software were used.

    Article Title: Growth enhancement of porcine epidemic diarrhea virus (PEDV) in Vero E6 cells expressing PEDV nucleocapsid protein
    Article Snippet: DNaseI (Fermentas) was used to treat the RNA (15 minutes at 37 ºC) and was inactivated with EDTA (10 minutes at 65 ºC). .. One-step RT-qPCR was performed as described above, except with Luna Universal One-Step RT-qPCR mix (New England Biolabs). .. To quantify the levels of genomic RNA, we used primers specific to ORF1 (fwd: 5’-AGTACGGGGCTCTAGTGCAG and rev: 5’-GCTTATCCAAATTCTTCAGGCG ; [ ]).

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Equimolar amounts of each RNA were injected into one-cell–staged embryos, and total RNA was extracted from 50 embryos at 28 hpf using TRIzol reagent (catalog no. 15596026, Invitrogen) following the manufacturer’s recommendations. .. Total RNA (100 ng) was used in a one-step qRT-PCR (Luna Universal One-Step RT-qPCR Kit, NEB) and performed on a Roche LightCycler 96 system. .. See table S1 for primer sequences.

    Article Title: Expression profiles of long noncoding RNAs and mRNAs in peripheral blood mononuclear cells of patients with acute myocardial infarction
    Article Snippet: Total RNA were extracted from the PBMCs using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. .. And qRT-PCR reactions were performed by using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA). .. The PCR reactions were carried out by the conditions: 15 s at 55 °C and 1 minute at 95 °C, followed with 40 cycles for 10 seconds at 95 °C and 30 seconds at 60 °C, and 30 seconds at 50 °C.

    Real-time Polymerase Chain Reaction:

    Article Title: Differential expression of circulating long non-coding RNAs in patients with acute myocardial infarction
    Article Snippet: Significance is judged when P value is < .05. .. 2.6 cDNA was synthesized and Real-Time Quantitative PCR (RT-qPCR) of lncRNAs expression level was performed using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA) according to the manufacturer's protocol. .. The PCR were performed on the LightCycler 480/II machine (Roche, Mannheim, Germany) and the PCR conditions were set as follow: 1 cycle of 10 minutes at 55 °C, 1 cycle of 1 minute at 95 °C, 45 cycles of 10 second at 95 °C and 30 seconds at 60 °C, and 1 cycle of 1 minute at 60 °C finally.

    Article Title: LncRNA HAND2-AS1 inhibits non-small cell lung cancer migration, invasion and maintains cell stemness through the interactions with TGF-β1
    Article Snippet: Paragraph title: Real-time quantitative PCR (qRT-PCR) ... Luna® Universal One-Step RT-qPCR Kit (NEB) was used to prepare all PCR reaction systems.

    Article Title: Development of a Dual-Vector System Utilizing MicroRNA Mimics of the Autographa californica miR-1 for an Inducible Knockdown in Insect Cells
    Article Snippet: Paragraph title: 3.6. Real-Time Quantitative PCR ... Reverse transcription and subsequent RT-qPCR was carried out in a single reaction with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s instructions.

    Article Title: Expression profiles of long noncoding RNAs and mRNAs in peripheral blood mononuclear cells of patients with acute myocardial infarction
    Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction (qRT-PCR) ... And qRT-PCR reactions were performed by using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA).

    Concentration Assay:

    Article Title: CBX2 identified as driver of anoikis escape and dissemination in high grade serous ovarian cancer
    Article Snippet: NanoDrop spectrophotometry was performed to confirm the concentration of extracted RNA. .. RT-qPCR was performed using the Luna Universal One-step RT-qPCR kit (New England BioLabs, Ipswich, MA) on a BioRad CFX96 or Applied Biosystems QuantStudio 6 Flex thermocycler using primers for specific target transcripts; 18s rRNA was examined as a housekeeping gene (Supplementary Table ).

    Polymerase Chain Reaction:

    Article Title: The lncRNA MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating miRNA-487a
    Article Snippet: Reverse transcription was performed using a gb Reverse Transcription Kit (Generi Biotech). .. PCR systems were prepared using a Luna Universal One-Step RT-qPCR Kit (NEB). .. To detect the expression of miRNA-487a, an miRNeasy Mini Kit (QIAGEN) was used to extract miRNA.

    Article Title: LncRNA HAND2-AS1 inhibits non-small cell lung cancer migration, invasion and maintains cell stemness through the interactions with TGF-β1
    Article Snippet: Total RNA samples were subjected to reverse transcription using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). .. Luna® Universal One-Step RT-qPCR Kit (NEB) was used to prepare all PCR reaction systems. .. Sequences of primers used in PCR reactions were: 5′-GGGTGTTTACGTAGACCAGAACC-3′ (forward) and 5′-CTTCCAAAAGCCTTCTGCCTTAG-3′ (reverse) for human lncRNA HAND2-AS1; 5′- GACCTCTATGCCAACACAGT3′ (forward) and 5′- AGTACTTGCGCTCAGGAGGA3′ (reverse) for β-actin.

    Infection:

    Article Title: Growth enhancement of porcine epidemic diarrhea virus (PEDV) in Vero E6 cells expressing PEDV nucleocapsid protein
    Article Snippet: For analysis of viral RNA synthesis, total RNA was extracted from Vero E6 or Vero E6-N cells infected with PEDV-AVCT12-mCherry (MOI = 0.0001) at indicated time points using the RNA extraction kit (Thermo Scientific). .. One-step RT-qPCR was performed as described above, except with Luna Universal One-Step RT-qPCR mix (New England Biolabs).

    Expressing:

    Article Title: The lncRNA MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating miRNA-487a
    Article Snippet: To detect the expression of MIR4435-2HG, total RNA was extracted using an MPure Total RNA Extraction Kit (117,022,160, MP Biomedicals). .. PCR systems were prepared using a Luna Universal One-Step RT-qPCR Kit (NEB).

    Article Title: Differential expression of circulating long non-coding RNAs in patients with acute myocardial infarction
    Article Snippet: Significance is judged when P value is < .05. .. 2.6 cDNA was synthesized and Real-Time Quantitative PCR (RT-qPCR) of lncRNAs expression level was performed using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA) according to the manufacturer's protocol. .. The PCR were performed on the LightCycler 480/II machine (Roche, Mannheim, Germany) and the PCR conditions were set as follow: 1 cycle of 10 minutes at 55 °C, 1 cycle of 1 minute at 95 °C, 45 cycles of 10 second at 95 °C and 30 seconds at 60 °C, and 1 cycle of 1 minute at 60 °C finally.

    Article Title: Expression profiles of long noncoding RNAs and mRNAs in peripheral blood mononuclear cells of patients with acute myocardial infarction
    Article Snippet: 2.6 To validate the reliability of RNA sequencing data, differentially expressed lncRNAs were randomly selected and qRT-PCR was employed to examine the expression level of lncRNAs. .. And qRT-PCR reactions were performed by using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Paragraph title: Quantitative reverse transcription polymerase chain reaction ... qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system.

    Article Title: CBX2 identified as driver of anoikis escape and dissemination in high grade serous ovarian cancer
    Article Snippet: Paragraph title: Quantitative reverse transcription polymerase chain reaction (RT-qPCR) ... RT-qPCR was performed using the Luna Universal One-step RT-qPCR kit (New England BioLabs, Ipswich, MA) on a BioRad CFX96 or Applied Biosystems QuantStudio 6 Flex thermocycler using primers for specific target transcripts; 18s rRNA was examined as a housekeeping gene (Supplementary Table ).

    Injection:

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. .. Briefly, untagged irg1l and mCherry-irg1l were subcloned into pCS2+ vectors and used as templates for in vitro transcription.

    Article Title: Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis
    Article Snippet: Equimolar amounts of each RNA were injected into one-cell–staged embryos, and total RNA was extracted from 50 embryos at 28 hpf using TRIzol reagent (catalog no. 15596026, Invitrogen) following the manufacturer’s recommendations. .. Total RNA (100 ng) was used in a one-step qRT-PCR (Luna Universal One-Step RT-qPCR Kit, NEB) and performed on a Roche LightCycler 96 system.

    Spectrophotometry:

    Article Title: CBX2 identified as driver of anoikis escape and dissemination in high grade serous ovarian cancer
    Article Snippet: NanoDrop spectrophotometry was performed to confirm the concentration of extracted RNA. .. RT-qPCR was performed using the Luna Universal One-step RT-qPCR kit (New England BioLabs, Ipswich, MA) on a BioRad CFX96 or Applied Biosystems QuantStudio 6 Flex thermocycler using primers for specific target transcripts; 18s rRNA was examined as a housekeeping gene (Supplementary Table ).

    Software:

    Article Title: Growth enhancement of porcine epidemic diarrhea virus (PEDV) in Vero E6 cells expressing PEDV nucleocapsid protein
    Article Snippet: Data were analyzed with CFX Manager software. .. One-step RT-qPCR was performed as described above, except with Luna Universal One-Step RT-qPCR mix (New England Biolabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs luna universal one step rt qpcr kits
    Expression level of differentially expressed <t>lncRNAs</t> in NSTEMI and STEMI patients. ENST00000508020.2, LNC_002011, LNC_000303 LNC_000898, ENST00000573866.2, and ENST00000562710.1 was detected by <t>qPCR</t> and normalized by GAPHD expression in STEMI patients and NSTEMI patients (All P values were less than .05). lncRNAs = long noncoding RNAs, NSTEMI = non-ST-elevation myocardial infarction, STEMI = ST-elevation myocardial infarction.
    Luna Universal One Step Rt Qpcr Kits, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/luna universal one step rt qpcr kits/product/New England Biolabs
    Average 98 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    luna universal one step rt qpcr kits - by Bioz Stars, 2019-09
    98/100 stars
      Buy from Supplier

    Image Search Results


    Expression level of differentially expressed lncRNAs in NSTEMI and STEMI patients. ENST00000508020.2, LNC_002011, LNC_000303 LNC_000898, ENST00000573866.2, and ENST00000562710.1 was detected by qPCR and normalized by GAPHD expression in STEMI patients and NSTEMI patients (All P values were less than .05). lncRNAs = long noncoding RNAs, NSTEMI = non-ST-elevation myocardial infarction, STEMI = ST-elevation myocardial infarction.

    Journal: Medicine

    Article Title: Differential expression of circulating long non-coding RNAs in patients with acute myocardial infarction

    doi: 10.1097/MD.0000000000013066

    Figure Lengend Snippet: Expression level of differentially expressed lncRNAs in NSTEMI and STEMI patients. ENST00000508020.2, LNC_002011, LNC_000303 LNC_000898, ENST00000573866.2, and ENST00000562710.1 was detected by qPCR and normalized by GAPHD expression in STEMI patients and NSTEMI patients (All P values were less than .05). lncRNAs = long noncoding RNAs, NSTEMI = non-ST-elevation myocardial infarction, STEMI = ST-elevation myocardial infarction.

    Article Snippet: 2.6 cDNA was synthesized and Real-Time Quantitative PCR (RT-qPCR) of lncRNAs expression level was performed using Luna Universal One-Step RT-qPCR kits (New England Biolabs, MA) according to the manufacturer's protocol.

    Techniques: Expressing, Real-time Polymerase Chain Reaction