neb hi fi dna assembly master mix  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    NEBuilder HiFi DNA Assembly Master Mix
    NEBuilder HiFi DNA Assembly Master Mix 50 rxns
    Catalog Number:
    50 rxns
    Cloning and Expression Systems
    Buy from Supplier

    Structured Review

    New England Biolabs neb hi fi dna assembly master mix
    NEBuilder HiFi DNA Assembly Master Mix
    NEBuilder HiFi DNA Assembly Master Mix 50 rxns hi fi dna assembly master mix/product/New England Biolabs
    Average 84 stars, based on 95 article reviews
    Price from $9.99 to $1999.99
    neb hi fi dna assembly master mix - by Bioz Stars, 2019-07
    84/100 stars


    Related Articles

    Diagnostic Assay:

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions. .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Clone Assay:

    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: This fragment was cloned into pUC18T-mini-Tn7 T-Tp at the Nsi L and Kpn I sites, generating pfixLJ. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha.

    Article Title: Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations
    Article Snippet: To complement the CRISPR1-cas9 deletion in trans, we cloned cas9 into pMSP3535 ( ) at PstI/XhoI. .. To inactivate the native CK111SSp(pCF10-101) CRISPR1 system and simultaneously introduce erythromycin resistance, we created plasmid pGE17 using the HiFi DNA Master Mix (New England Biolabs). pGE17 contains the pGEM origin of replication, and appropriate arms and insert to introduce ermB to interrupt the cas9 locus.

    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB). .. To isolate monoclonal cell lines, cells were subject to limiting dilution after G418 selection.

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions. .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: Paragraph title: Cloning of a Translationally Arrested ano Mutant ... In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol.

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: To generate sfGFP- and Tag-RFP-T-tagged mzt1 alleles, the guide RNA sequence (G)CAGGATAGTGAAGCGATCGT was cloned into the single guide pCFD3 vector, as described in [ ], and the vector was transformed into the attP40 site. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317).

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: For complementation of the knockout mutants, the plasmid pRB473 ( ) was used. .. The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs). .. E. coli transformants were picked and checked by restriction digestion and sequencing.

    Article Title: Near-atomic resolution cryoelectron microscopy structure of the 30-fold homooligomeric SpoIIIAG channel essential to spore formation in Bacillus subtilis
    Article Snippet: spoIIIAG and the proximal promoter (P2spoIIIA ) within the spoIIIAF coding sequence were PCR-amplified with primers prKF141 and prKF142 from PY79 chromosomal DNA. .. The spoIIIAG amplicon and a synthetic gene fragment (gBlock; IDT) containing the spoIIIA terminator were cloned into an XbaI/BamHI-double digested vector fragment of pAH315 ( ) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to generate the wild-type complementation construct of wild-type spoIIIAG , plasmid pKF112. .. Complementation constructs of mutant spoIIIAG were generated similarly by cloning gBlocks or PCR products into pKF112 as follows.

    Article Title: A Vaginal Tract Signal Detected by the Group B Streptococcus SaeRS System Elicits Transcriptomic Changes and Enhances Murine Colonization
    Article Snippet: All samples were run in triplicate technical replicates on a single plate, and triplicate biological replicates were used to determine final statistics. .. Cloning of saeR D53E into the pET21a expression vector containing a 6His tag was done using the NEBuilder HiFi DNA assembly master mix (New England BioLabs). .. A 692-bp gblock fragment of saeR ( sak_0467 ) containing a D53E mutation was ordered from Integrated DNA Technologies.


    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: B . dolosa strain AU0158 fixLJ along with 670 bp upstream was amplified using PCR with primers that generated Nsi L and Kpn I sites at the 5’ and 3’ ends respectively. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha.

    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: To generate the repair template, the SNAP-3xHA sequence followed by a viral 2A peptide and the neomycin resistance gene was synthesized as a gBlock (Integrated DNA Technologies), and 5′ and 3′ homology arms of ∼800 bp each were amplified from DLD-1 genomic DNA by PCR. .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).

    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs). .. All constructs were synthesized as human IgG1, regardless of a given antibody's IgG isotype in the original mouse repertoire.

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: To construct the suicide vector for this deletion, 1000 bp targeting regions 5’ and 3’ of the crc gene (PP_5292, GenBank: AE015451.1:6039987..6040766) were amplified from P. putida KT2440 gDNA using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primer pairs oCJ255 (5’-AACAGCTATGACATGATTACGAATTCGTAGCGTAGTGTGACTTGAAGGGCACAC-3’) & oCJ256 (5’-TTGCGGCCGCAAATGGCCCCATAAATCTCGTGCGTGTATG-3’) and oCJ257 (5’-GGGGCCATTTGCGGCCGCAAGGCCATTGGGGCTGCATTG-3’) & oCJ258 (5’-GCCTGCAGGTCGACTCTAGAGGATCCGCTTCCTCAAAGGCCAGGGC-3’), respectively, synthesized by Integrated DNA Technologies (IDT). .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: The pHA1887 fragment and the selection cassette were amplified by PCR from the plasmid pTS2Cb (either primers pHA5F and pHA3R, or SM5F and SM3R). .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol.

    Article Title: Identification of the S-transferase like superfamily bacillithiol transferases encoded by Bacillus subtilis
    Article Snippet: All strains were constructed using either NEBuilder (New England Biolabs, Inc) or Gibson Assembly (Synthetic Genomics, Inc, [ , ]). .. The integration vector pDG1730 [ ] was used to insert the promoter region ( > 400 base pairs upstream of the gene) of each bst fused to the sfGFP gene at the amyE locus for the bacillithiol transferase promoter fusion strains.

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: For complementation of the knockout mutants, the plasmid pRB473 ( ) was used. .. The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs). .. E. coli transformants were picked and checked by restriction digestion and sequencing.

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: For expression in S. carnosus , vraH was amplified by PCR from genomic DNA of S. aureus JE2 with the primers vraH fwd BamHI and vraH rev AvaI and subsequently ligated into the plasmid pPTX (derivative of pTX30 harboring the E. coli origin of replication ColE1 and an ampicillin resistance cassette [unpublished data]) via the BamHI/AvaI restriction sites, yielding the plasmid pPTX- vraH . .. For the construction of the shuttle vector pPT-tuf- vraH , a 7.3-kb PCR product of the backbone of pPTX- vraH was amplified with the primers pPTX-vraH fwd and pPTX-vraH rev and joined with a PCR product of the tufA promoter of the plasmid pC-tuf-gfp ( ) using NEBuilder HiFi DNA Assembly master mix. pPT-tuf- vraH was also used for the complementation of S. aureus JE2Δ vraH . .. SCA_2035 and SE_2402 were amplified with the respective primers and cloned via the AvaI restriction site into pPT-tuf using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Article Title: A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
    Article Snippet: The genetic sequences encoding the transcription factor based sensor, PcaU, along with the regulatory region from the E. coli -specific sensor-reporter system was PCR amplified from a previously constructed plasmid ( ) using pBTL-2_pcaU_overlap_Fwd/PcaUpromo_sfGFP_overlap_Rev primers (Fragment 2). .. Fragments 1, 2 and 3 were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) to create a circular plasmid , such that sensor-reporter cassette with intergenic regulatory region was bound by bidirectional soxR and tonB transcription terminators in pBTL-2.

    Article Title: Near-atomic resolution cryoelectron microscopy structure of the 30-fold homooligomeric SpoIIIAG channel essential to spore formation in Bacillus subtilis
    Article Snippet: spoIIIAG and the proximal promoter (P2spoIIIA ) within the spoIIIAF coding sequence were PCR-amplified with primers prKF141 and prKF142 from PY79 chromosomal DNA. .. The spoIIIAG amplicon and a synthetic gene fragment (gBlock; IDT) containing the spoIIIA terminator were cloned into an XbaI/BamHI-double digested vector fragment of pAH315 ( ) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to generate the wild-type complementation construct of wild-type spoIIIAG , plasmid pKF112. .. Complementation constructs of mutant spoIIIAG were generated similarly by cloning gBlocks or PCR products into pKF112 as follows.

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: To generate the P dat-1 ::rho-1 cDNA (pRB1348) construct, rho-1 cDNA was first amplified from a cDNA library generated from N2 animals using Superscript III First Strand Synthesis (ThermoFisher). .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).

    Article Title: A Vaginal Tract Signal Detected by the Group B Streptococcus SaeRS System Elicits Transcriptomic Changes and Enhances Murine Colonization
    Article Snippet: Cloning of saeR D53E into the pET21a expression vector containing a 6His tag was done using the NEBuilder HiFi DNA assembly master mix (New England BioLabs). .. A 692-bp gblock fragment of saeR ( sak_0467 ) containing a D53E mutation was ordered from Integrated DNA Technologies.

    Stable Transfection:

    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: Using DLD-1 Flp-In T-Rex cells stably expressing Tir1 (ref. ) with CENP-CAID-EYFP/AID-EYFP (ref. ) as a starting point, endogenous CENP-A was tagged with C-terminal SNAP using CRISPR-Cas9-mediated genome engineering. .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).


    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: To generate the repair template, the SNAP-3xHA sequence followed by a viral 2A peptide and the neomycin resistance gene was synthesized as a gBlock (Integrated DNA Technologies), and 5′ and 3′ homology arms of ∼800 bp each were amplified from DLD-1 genomic DNA by PCR. .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: To construct the suicide vector for this deletion, 1000 bp targeting regions 5’ and 3’ of the crc gene (PP_5292, GenBank: AE015451.1:6039987..6040766) were amplified from P. putida KT2440 gDNA using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primer pairs oCJ255 (5’-AACAGCTATGACATGATTACGAATTCGTAGCGTAGTGTGACTTGAAGGGCACAC-3’) & oCJ256 (5’-TTGCGGCCGCAAATGGCCCCATAAATCTCGTGCGTGTATG-3’) and oCJ257 (5’-GGGGCCATTTGCGGCCGCAAGGCCATTGGGGCTGCATTG-3’) & oCJ258 (5’-GCCTGCAGGTCGACTCTAGAGGATCCGCTTCCTCAAAGGCCAGGGC-3’), respectively, synthesized by Integrated DNA Technologies (IDT). .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Article Title: ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production
    Article Snippet: Primers were designed using primer3 ( , ) and synthesized by IDT. .. Gibson assembly was performed using NEBuilder HiFi DNA Assembly master mix (E2621; New England Biolabs).


    Article Title: Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction
    Article Snippet: New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix. .. New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix.

    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: This fragment was cloned into pUC18T-mini-Tn7 T-Tp at the Nsi L and Kpn I sites, generating pfixLJ. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha. .. B . dolosa AU0158 fixLJ was amplified by PCR with primers that generated Nco I and Hind III sites at the 5’ and 3’ ends respectively.

    Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
    Article Snippet: Paragraph title: B. smithii and P. putida editing and silencing constructs ... All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively.

    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: The vector uses an EF1-alpha promoter to drive light chain expression, followed by a BGH polyA sequence and a CMV promoter to drive expression of the heavy chain, followed by a second BGH polyA sequence (Supplementary Figure S13). .. Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs). .. All constructs were synthesized as human IgG1, regardless of a given antibody's IgG isotype in the original mouse repertoire.

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: To construct the suicide vector for this deletion, 1000 bp targeting regions 5’ and 3’ of the crc gene (PP_5292, GenBank: AE015451.1:6039987..6040766) were amplified from P. putida KT2440 gDNA using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primer pairs oCJ255 (5’-AACAGCTATGACATGATTACGAATTCGTAGCGTAGTGTGACTTGAAGGGCACAC-3’) & oCJ256 (5’-TTGCGGCCGCAAATGGCCCCATAAATCTCGTGCGTGTATG-3’) and oCJ257 (5’-GGGGCCATTTGCGGCCGCAAGGCCATTGGGGCTGCATTG-3’) & oCJ258 (5’-GCCTGCAGGTCGACTCTAGAGGATCCGCTTCCTCAAAGGCCAGGGC-3’), respectively, synthesized by Integrated DNA Technologies (IDT). .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: Because the plasmid pTS2Cb-ano∗ was constructed by Gibson Assembly, the four PCR fragments had to contain overlapping sequences. .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol.

    Article Title: Identification of the S-transferase like superfamily bacillithiol transferases encoded by Bacillus subtilis
    Article Snippet: A list of plasmids, strains and oligonucleotides used in this study can be found in Tables F-H in . .. All strains were constructed using either NEBuilder (New England Biolabs, Inc) or Gibson Assembly (Synthetic Genomics, Inc, [ , ]). .. Either Velocity (Bioline) or Phusion (New England Biolabs, Inc) DNA polymerase was used to PCR amplify all fragments.

    Article Title: A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
    Article Snippet: The genetic sequences encoding the transcription factor based sensor, PcaU, along with the regulatory region from the E. coli -specific sensor-reporter system was PCR amplified from a previously constructed plasmid ( ) using pBTL-2_pcaU_overlap_Fwd/PcaUpromo_sfGFP_overlap_Rev primers (Fragment 2). .. Fragments 1, 2 and 3 were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) to create a circular plasmid , such that sensor-reporter cassette with intergenic regulatory region was bound by bidirectional soxR and tonB transcription terminators in pBTL-2.

    Article Title: Near-atomic resolution cryoelectron microscopy structure of the 30-fold homooligomeric SpoIIIAG channel essential to spore formation in Bacillus subtilis
    Article Snippet: spoIIIAG and the proximal promoter (P2spoIIIA ) within the spoIIIAF coding sequence were PCR-amplified with primers prKF141 and prKF142 from PY79 chromosomal DNA. .. The spoIIIAG amplicon and a synthetic gene fragment (gBlock; IDT) containing the spoIIIA terminator were cloned into an XbaI/BamHI-double digested vector fragment of pAH315 ( ) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to generate the wild-type complementation construct of wild-type spoIIIAG , plasmid pKF112. .. Complementation constructs of mutant spoIIIAG were generated similarly by cloning gBlocks or PCR products into pKF112 as follows.

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: To generate the P dat-1 ::rho-1 cDNA (pRB1348) construct, rho-1 cDNA was first amplified from a cDNA library generated from N2 animals using Superscript III First Strand Synthesis (ThermoFisher). .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).

    Article Title: ZMPSTE24 missense mutations that cause progeroid diseases decrease prelamin A cleavage activity and/or protein stability
    Article Snippet: Plasmid pSM3283 is CEN/HIS3 containing a single Flag epitope at the N terminus of ZMPSTE24 expressed from the PGK1 promoter. .. Plasmid pSM3204 (expressing mCherry-Scs2TM ) was constructed by NEBuilder® HiFi Assembly of a PCR product from Kp173 (a generous gift of Rong Li, JHU School of Medicine, Baltimore, MD) into pRS315 ( CEN/LEU2 ). .. Typically, strains grown overnight in minimal medium (0.67% yeast nitrogen base, 0.5% ammonium sulfate, 2% glucose, supplemented with appropriate amino acids and supplements) were back-diluted in fresh medium for 4-6 h. Cells (1.5-2 OD600 cell equivalents) were pelleted, washed in water and lysed using NaOH pre-treatment and SDS protein sample buffer ( ) at 65°C for 10-15 min. For analysis, lysates were centrifuged at 21,000 g for 2 min and the supernatants (0.3 OD600 cell equivalents per lane) resolved on 10% SDS polyacrylamide gels.


    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: To resolve merodiploidy, conjugants were counterselected against by plating on LB with 15% w/v sucrose and incubated for 2 days at 30°C. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: Because the plasmid pTS2Cb-ano∗ was constructed by Gibson Assembly, the four PCR fragments had to contain overlapping sequences. .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol. .. Next, the mutation cassette was amplified by PCR using pTS2Cb-ano∗ as template and primers HA3F and HA5R.

    Cell Culture:

    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs). .. The purified plasmids were used for transient transfection in the ExpiCHO system (Thermo Fisher Scientific).


    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: This fragment was cloned into pUC18T-mini-Tn7 T-Tp at the Nsi L and Kpn I sites, generating pfixLJ. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha. .. B . dolosa AU0158 fixLJ was amplified by PCR with primers that generated Nco I and Hind III sites at the 5’ and 3’ ends respectively.

    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: Using DLD-1 Flp-In T-Rex cells stably expressing Tir1 (ref. ) with CENP-CAID-EYFP/AID-EYFP (ref. ) as a starting point, endogenous CENP-A was tagged with C-terminal SNAP using CRISPR-Cas9-mediated genome engineering. .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).

    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: The vector uses an EF1-alpha promoter to drive light chain expression, followed by a BGH polyA sequence and a CMV promoter to drive expression of the heavy chain, followed by a second BGH polyA sequence (Supplementary Figure S13). .. Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs). .. All constructs were synthesized as human IgG1, regardless of a given antibody's IgG isotype in the original mouse repertoire.

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: This line was then crossed to nos-Cas9 expressing females and the resulting embryos were injected with a pBluescript plasmid containing either the sfGFP or TagRFP-T tag and linker sequence (4X GlyGlySer) flanked on either side by 1.5kb of DNA homologous to the mzt1 genomic locus surrounding the 5′ end of the coding region. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317).

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs). .. Plasmids with the correct sequences were used for transformation of the respective mutant strains.

    Article Title: A Vaginal Tract Signal Detected by the Group B Streptococcus SaeRS System Elicits Transcriptomic Changes and Enhances Murine Colonization
    Article Snippet: All samples were run in triplicate technical replicates on a single plate, and triplicate biological replicates were used to determine final statistics. .. Cloning of saeR D53E into the pET21a expression vector containing a 6His tag was done using the NEBuilder HiFi DNA assembly master mix (New England BioLabs). .. A 692-bp gblock fragment of saeR ( sak_0467 ) containing a D53E mutation was ordered from Integrated DNA Technologies.

    Article Title: ZMPSTE24 missense mutations that cause progeroid diseases decrease prelamin A cleavage activity and/or protein stability
    Article Snippet: Plasmid pSM3283 is CEN/HIS3 containing a single Flag epitope at the N terminus of ZMPSTE24 expressed from the PGK1 promoter. .. Plasmid pSM3204 (expressing mCherry-Scs2TM ) was constructed by NEBuilder® HiFi Assembly of a PCR product from Kp173 (a generous gift of Rong Li, JHU School of Medicine, Baltimore, MD) into pRS315 ( CEN/LEU2 ). .. Typically, strains grown overnight in minimal medium (0.67% yeast nitrogen base, 0.5% ammonium sulfate, 2% glucose, supplemented with appropriate amino acids and supplements) were back-diluted in fresh medium for 4-6 h. Cells (1.5-2 OD600 cell equivalents) were pelleted, washed in water and lysed using NaOH pre-treatment and SDS protein sample buffer ( ) at 65°C for 10-15 min. For analysis, lysates were centrifuged at 21,000 g for 2 min and the supernatants (0.3 OD600 cell equivalents per lane) resolved on 10% SDS polyacrylamide gels.


    Article Title: Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations
    Article Snippet: Since CK111SSp(pCF10-101) encodes repA on the chromosome, it cannot be modified using derivatives of the previously mentioned plasmids, which rely on a temperature sensitive repA to create chromosomal modifications. .. To inactivate the native CK111SSp(pCF10-101) CRISPR1 system and simultaneously introduce erythromycin resistance, we created plasmid pGE17 using the HiFi DNA Master Mix (New England Biolabs). pGE17 contains the pGEM origin of replication, and appropriate arms and insert to introduce ermB to interrupt the cas9 locus.

    Transformation Assay:

    Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
    Article Snippet: All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively. .. All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively.

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: To construct the suicide vector for this deletion, 1000 bp targeting regions 5’ and 3’ of the crc gene (PP_5292, GenBank: AE015451.1:6039987..6040766) were amplified from P. putida KT2440 gDNA using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primer pairs oCJ255 (5’-AACAGCTATGACATGATTACGAATTCGTAGCGTAGTGTGACTTGAAGGGCACAC-3’) & oCJ256 (5’-TTGCGGCCGCAAATGGCCCCATAAATCTCGTGCGTGTATG-3’) and oCJ257 (5’-GGGGCCATTTGCGGCCGCAAGGCCATTGGGGCTGCATTG-3’) & oCJ258 (5’-GCCTGCAGGTCGACTCTAGAGGATCCGCTTCCTCAAAGGCCAGGGC-3’), respectively, synthesized by Integrated DNA Technologies (IDT). .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions. .. Transformants were selected on LB (Lennox) plates containing 10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl, and 15 g/L agar, supplemented with 50 μg/mL kanamycin and grown at 37 °C.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: Because the plasmid pTS2Cb-ano∗ was constructed by Gibson Assembly, the four PCR fragments had to contain overlapping sequences. .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol. .. Next, the mutation cassette was amplified by PCR using pTS2Cb-ano∗ as template and primers HA3F and HA5R.

    Article Title: ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production
    Article Snippet: PCR for downstream Gibson assembly, transformation, or sequencing applications was performed using Phusion polymerase (E0553; New England Biolabs). .. Gibson assembly was performed using NEBuilder HiFi DNA Assembly master mix (E2621; New England Biolabs).

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: To generate sfGFP- and Tag-RFP-T-tagged mzt1 alleles, the guide RNA sequence (G)CAGGATAGTGAAGCGATCGT was cloned into the single guide pCFD3 vector, as described in [ ], and the vector was transformed into the attP40 site. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317).

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: Colonies harboring the correct plasmid were picked, and the respective plasmids were transformed into electrocompetent S. aureus JE2 cells. .. The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Conjugation Assay:

    Article Title: Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations
    Article Snippet: All plasmids described in this section were mated into the desired strains from CK111(pCF10-101) derivatives, with the exception of pVP31 and pG19, which lack the oriT sequence necessary for conjugation. .. To inactivate the native CK111SSp(pCF10-101) CRISPR1 system and simultaneously introduce erythromycin resistance, we created plasmid pGE17 using the HiFi DNA Master Mix (New England Biolabs). pGE17 contains the pGEM origin of replication, and appropriate arms and insert to introduce ermB to interrupt the cas9 locus.


    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs). .. Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs).


    Article Title: Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations
    Article Snippet: Since CK111SSp(pCF10-101) encodes repA on the chromosome, it cannot be modified using derivatives of the previously mentioned plasmids, which rely on a temperature sensitive repA to create chromosomal modifications. .. To inactivate the native CK111SSp(pCF10-101) CRISPR1 system and simultaneously introduce erythromycin resistance, we created plasmid pGE17 using the HiFi DNA Master Mix (New England Biolabs). pGE17 contains the pGEM origin of replication, and appropriate arms and insert to introduce ermB to interrupt the cas9 locus. .. Additionally, pheS* and cat from pLT06 were included outside the homologous arms to provide appropriate selection and counter-selection.


    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: This fragment was cloned into pUC18T-mini-Tn7 T-Tp at the Nsi L and Kpn I sites, generating pfixLJ. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha. .. B . dolosa AU0158 fixLJ was amplified by PCR with primers that generated Nco I and Hind III sites at the 5’ and 3’ ends respectively.

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: This line was then crossed to nos-Cas9 expressing females and the resulting embryos were injected with a pBluescript plasmid containing either the sfGFP or TagRFP-T tag and linker sequence (4X GlyGlySer) flanked on either side by 1.5kb of DNA homologous to the mzt1 genomic locus surrounding the 5′ end of the coding region. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317). .. F1 and F2 males were screened by PCR using primers specific to sfGFP (forward primer: CTGAAGTTCATCTGCACCACC; reverse primer: GCGGCGGTCACGAACTCCAGC).

    Article Title: A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
    Article Snippet: The genetic sequence of the reporter, superfolder GFP (sfGFP) , was generated as a PCR fragment using sfGFP_Fwd/pBTL-2_sfGFP_overlap_Rev primers (Fragment 3). .. Fragments 1, 2 and 3 were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) to create a circular plasmid , such that sensor-reporter cassette with intergenic regulatory region was bound by bidirectional soxR and tonB transcription terminators in pBTL-2.

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: Overlap sequence for pRB1106 was engineered into the ends of the rho-1 cDNA PCR fragment, and a PCR fragment of pRB1106 containing the dat-1 promoter and unc-54 3′UTR was generated with overlap sequence for the rho-1 cDNA on both ends. .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).

    Polymerase Chain Reaction:

    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: B . dolosa strain AU0158 fixLJ along with 670 bp upstream was amplified using PCR with primers that generated Nsi L and Kpn I sites at the 5’ and 3’ ends respectively. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha.

    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: To generate the repair template, the SNAP-3xHA sequence followed by a viral 2A peptide and the neomycin resistance gene was synthesized as a gBlock (Integrated DNA Technologies), and 5′ and 3′ homology arms of ∼800 bp each were amplified from DLD-1 genomic DNA by PCR. .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: Because the plasmid pTS2Cb-ano∗ was constructed by Gibson Assembly, the four PCR fragments had to contain overlapping sequences. .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol. .. Next, the mutation cassette was amplified by PCR using pTS2Cb-ano∗ as template and primers HA3F and HA5R.

    Article Title: ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production
    Article Snippet: PCR products were purified using silica columns (28106; Qiagen). .. Gibson assembly was performed using NEBuilder HiFi DNA Assembly master mix (E2621; New England Biolabs).

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: This line was then crossed to nos-Cas9 expressing females and the resulting embryos were injected with a pBluescript plasmid containing either the sfGFP or TagRFP-T tag and linker sequence (4X GlyGlySer) flanked on either side by 1.5kb of DNA homologous to the mzt1 genomic locus surrounding the 5′ end of the coding region. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317). .. F1 and F2 males were screened by PCR using primers specific to sfGFP (forward primer: CTGAAGTTCATCTGCACCACC; reverse primer: GCGGCGGTCACGAACTCCAGC).

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs). .. The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: For expression in S. carnosus , vraH was amplified by PCR from genomic DNA of S. aureus JE2 with the primers vraH fwd BamHI and vraH rev AvaI and subsequently ligated into the plasmid pPTX (derivative of pTX30 harboring the E. coli origin of replication ColE1 and an ampicillin resistance cassette [unpublished data]) via the BamHI/AvaI restriction sites, yielding the plasmid pPTX- vraH . .. For the construction of the shuttle vector pPT-tuf- vraH , a 7.3-kb PCR product of the backbone of pPTX- vraH was amplified with the primers pPTX-vraH fwd and pPTX-vraH rev and joined with a PCR product of the tufA promoter of the plasmid pC-tuf-gfp ( ) using NEBuilder HiFi DNA Assembly master mix. pPT-tuf- vraH was also used for the complementation of S. aureus JE2Δ vraH . .. SCA_2035 and SE_2402 were amplified with the respective primers and cloned via the AvaI restriction site into pPT-tuf using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Article Title: A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
    Article Snippet: The genetic sequence of the reporter, superfolder GFP (sfGFP) , was generated as a PCR fragment using sfGFP_Fwd/pBTL-2_sfGFP_overlap_Rev primers (Fragment 3). .. Fragments 1, 2 and 3 were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) to create a circular plasmid , such that sensor-reporter cassette with intergenic regulatory region was bound by bidirectional soxR and tonB transcription terminators in pBTL-2.

    Article Title: Near-atomic resolution cryoelectron microscopy structure of the 30-fold homooligomeric SpoIIIAG channel essential to spore formation in Bacillus subtilis
    Article Snippet: spoIIIAG and the proximal promoter (P2spoIIIA ) within the spoIIIAF coding sequence were PCR-amplified with primers prKF141 and prKF142 from PY79 chromosomal DNA. .. The spoIIIAG amplicon and a synthetic gene fragment (gBlock; IDT) containing the spoIIIA terminator were cloned into an XbaI/BamHI-double digested vector fragment of pAH315 ( ) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to generate the wild-type complementation construct of wild-type spoIIIAG , plasmid pKF112.

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: Overlap sequence for pRB1106 was engineered into the ends of the rho-1 cDNA PCR fragment, and a PCR fragment of pRB1106 containing the dat-1 promoter and unc-54 3′UTR was generated with overlap sequence for the rho-1 cDNA on both ends. .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).

    Article Title: A Vaginal Tract Signal Detected by the Group B Streptococcus SaeRS System Elicits Transcriptomic Changes and Enhances Murine Colonization
    Article Snippet: Cloning of saeR D53E into the pET21a expression vector containing a 6His tag was done using the NEBuilder HiFi DNA assembly master mix (New England BioLabs). .. A 692-bp gblock fragment of saeR ( sak_0467 ) containing a D53E mutation was ordered from Integrated DNA Technologies.

    Article Title: ZMPSTE24 missense mutations that cause progeroid diseases decrease prelamin A cleavage activity and/or protein stability
    Article Snippet: Plasmid pSM3283 is CEN/HIS3 containing a single Flag epitope at the N terminus of ZMPSTE24 expressed from the PGK1 promoter. .. Plasmid pSM3204 (expressing mCherry-Scs2TM ) was constructed by NEBuilder® HiFi Assembly of a PCR product from Kp173 (a generous gift of Rong Li, JHU School of Medicine, Baltimore, MD) into pRS315 ( CEN/LEU2 ). .. Typically, strains grown overnight in minimal medium (0.67% yeast nitrogen base, 0.5% ammonium sulfate, 2% glucose, supplemented with appropriate amino acids and supplements) were back-diluted in fresh medium for 4-6 h. Cells (1.5-2 OD600 cell equivalents) were pelleted, washed in water and lysed using NaOH pre-treatment and SDS protein sample buffer ( ) at 65°C for 10-15 min. For analysis, lysates were centrifuged at 21,000 g for 2 min and the supernatants (0.3 OD600 cell equivalents per lane) resolved on 10% SDS polyacrylamide gels.


    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: This line was then crossed to nos-Cas9 expressing females and the resulting embryos were injected with a pBluescript plasmid containing either the sfGFP or TagRFP-T tag and linker sequence (4X GlyGlySer) flanked on either side by 1.5kb of DNA homologous to the mzt1 genomic locus surrounding the 5′ end of the coding region. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317).

    DNA Extraction:

    Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
    Article Snippet: All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively. .. Single colonies were inoculated in LB medium, plasmid material was isolated using the GeneJet plasmid miniprep kit (Thermo Fisher Scientific) and sequence verified (GATC-biotech) and 1 μg of each construct was transformed to B. smithii ET 138 electro-competent cells .


    Article Title: Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations
    Article Snippet: Electroporation was performed instead for pVP31 and pG19. .. To inactivate the native CK111SSp(pCF10-101) CRISPR1 system and simultaneously introduce erythromycin resistance, we created plasmid pGE17 using the HiFi DNA Master Mix (New England Biolabs). pGE17 contains the pGEM origin of replication, and appropriate arms and insert to introduce ermB to interrupt the cas9 locus.

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions. .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.


    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: To complement the fixLJ deletion mutant, we generated stable chromosomally integrated constructs using the mini-Tn7 system, which integrates into an att Tn7 site [ , ]. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: Paragraph title: Cloning of a Translationally Arrested ano Mutant ... In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol.

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: Mutagenesis of the respective transformants was achieved as reported elsewhere ( ). .. The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Article Title: Near-atomic resolution cryoelectron microscopy structure of the 30-fold homooligomeric SpoIIIAG channel essential to spore formation in Bacillus subtilis
    Article Snippet: The spoIIIAG amplicon and a synthetic gene fragment (gBlock; IDT) containing the spoIIIA terminator were cloned into an XbaI/BamHI-double digested vector fragment of pAH315 ( ) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to generate the wild-type complementation construct of wild-type spoIIIAG , plasmid pKF112. .. Complementation constructs of mutant spoIIIAG were generated similarly by cloning gBlocks or PCR products into pKF112 as follows.

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: To generate the K42R kinase dead mutation in the P dat-1 ::GFP:: swip-13 plasmid (pRB1343), we used a QuikChange II Site-Directed Mutagenesis kit (Agilent) following the manufacturer's protocol. .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).


    Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
    Article Snippet: All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively. .. The assembled plasmids were transformed to chemically competent E. coli DH5α cells (NEB), or to E. coli DH5α λpir (Invitrogen) in the case of P. putida constructs, the latter to facilitate direct vector integration.


    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs). .. All constructs were synthesized as human IgG1, regardless of a given antibody's IgG isotype in the original mouse repertoire.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol. .. Next, the mutation cassette was amplified by PCR using pTS2Cb-ano∗ as template and primers HA3F and HA5R.

    Article Title: ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production
    Article Snippet: PCR products were purified using silica columns (28106; Qiagen). .. Gibson assembly was performed using NEBuilder HiFi DNA Assembly master mix (E2621; New England Biolabs).

    Article Title: A Vaginal Tract Signal Detected by the Group B Streptococcus SaeRS System Elicits Transcriptomic Changes and Enhances Murine Colonization
    Article Snippet: Paragraph title: SaeR D53E protein expression and purification. ... Cloning of saeR D53E into the pET21a expression vector containing a 6His tag was done using the NEBuilder HiFi DNA assembly master mix (New England BioLabs).


    Article Title: Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction
    Article Snippet: New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix. .. New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix.

    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: Resolution and confirmation of fixLJ deletion was confirmed by PCR and Sanger sequencing. .. A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha.

    Article Title: Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations
    Article Snippet: All plasmids described in this section were mated into the desired strains from CK111(pCF10-101) derivatives, with the exception of pVP31 and pG19, which lack the oriT sequence necessary for conjugation. .. To inactivate the native CK111SSp(pCF10-101) CRISPR1 system and simultaneously introduce erythromycin resistance, we created plasmid pGE17 using the HiFi DNA Master Mix (New England Biolabs). pGE17 contains the pGEM origin of replication, and appropriate arms and insert to introduce ermB to interrupt the cas9 locus.

    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: To generate the repair template, the SNAP-3xHA sequence followed by a viral 2A peptide and the neomycin resistance gene was synthesized as a gBlock (Integrated DNA Technologies), and 5′ and 3′ homology arms of ∼800 bp each were amplified from DLD-1 genomic DNA by PCR. .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).

    Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
    Article Snippet: All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively. .. The assembled plasmids were transformed to chemically competent E. coli DH5α cells (NEB), or to E. coli DH5α λpir (Invitrogen) in the case of P. putida constructs, the latter to facilitate direct vector integration.

    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: The vector uses an EF1-alpha promoter to drive light chain expression, followed by a BGH polyA sequence and a CMV promoter to drive expression of the heavy chain, followed by a second BGH polyA sequence (Supplementary Figure S13). .. Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs).

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions. .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: A point mutation leading to a premature stop codon was introduced into the ano sequence by PCR with the oligonucleotides HA3ano -115F and SM5ano mut+19R (3′ mutation fragment), and SM3ano mut-5F and HA5ano +174R (5′ mutation fragment). .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol.

    Article Title: ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production
    Article Snippet: PCR for downstream Gibson assembly, transformation, or sequencing applications was performed using Phusion polymerase (E0553; New England Biolabs). .. Gibson assembly was performed using NEBuilder HiFi DNA Assembly master mix (E2621; New England Biolabs).

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: This line was then crossed to nos-Cas9 expressing females and the resulting embryos were injected with a pBluescript plasmid containing either the sfGFP or TagRFP-T tag and linker sequence (4X GlyGlySer) flanked on either side by 1.5kb of DNA homologous to the mzt1 genomic locus surrounding the 5′ end of the coding region. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317).

    Article Title: A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
    Article Snippet: The genetic sequence of the reporter, superfolder GFP (sfGFP) , was generated as a PCR fragment using sfGFP_Fwd/pBTL-2_sfGFP_overlap_Rev primers (Fragment 3). .. Fragments 1, 2 and 3 were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) to create a circular plasmid , such that sensor-reporter cassette with intergenic regulatory region was bound by bidirectional soxR and tonB transcription terminators in pBTL-2.

    Article Title: Near-atomic resolution cryoelectron microscopy structure of the 30-fold homooligomeric SpoIIIAG channel essential to spore formation in Bacillus subtilis
    Article Snippet: spoIIIAG and the proximal promoter (P2spoIIIA ) within the spoIIIAF coding sequence were PCR-amplified with primers prKF141 and prKF142 from PY79 chromosomal DNA. .. The spoIIIAG amplicon and a synthetic gene fragment (gBlock; IDT) containing the spoIIIA terminator were cloned into an XbaI/BamHI-double digested vector fragment of pAH315 ( ) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to generate the wild-type complementation construct of wild-type spoIIIAG , plasmid pKF112.

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: Overlap sequence for pRB1106 was engineered into the ends of the rho-1 cDNA PCR fragment, and a PCR fragment of pRB1106 containing the dat-1 promoter and unc-54 3′UTR was generated with overlap sequence for the rho-1 cDNA on both ends. .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).


    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: Using DLD-1 Flp-In T-Rex cells stably expressing Tir1 (ref. ) with CENP-CAID-EYFP/AID-EYFP (ref. ) as a starting point, endogenous CENP-A was tagged with C-terminal SNAP using CRISPR-Cas9-mediated genome engineering. .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).

    cDNA Library Assay:

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: To generate the P dat-1 ::rho-1 cDNA (pRB1348) construct, rho-1 cDNA was first amplified from a cDNA library generated from N2 animals using Superscript III First Strand Synthesis (ThermoFisher). .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).

    Polymerase Cycling Assembly:

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317). .. The endogenously tagged γ-Tub23C-sfGFP line was made in the same way, except that the guide RNA sequence (G)AGCGAACTAGGAACCGGCGC was used and the homology vector contained 1.5kb of DNA homologous to the γ-tubulin23c genomic locus surrounding the 3′ end of the coding region.

    Plasmid Preparation:

    Article Title: An Oxygen-Sensing Two-Component System in the Burkholderia cepacia Complex Regulates Biofilm, Intracellular Invasion, and Pathogenicity
    Article Snippet: A rhamnose-inducible FixLJ expression construct was generated by replacing the arabinose operator of pTJ-1 with rhamnose operator of pSCrhaB2 using NEBuilder HiFi DNA Assembly Master Mix (NEB) per manufacturer’s protocol and primers generated using NEBuilder Assembly tool, generating pTJrha. .. B . dolosa AU0158 fixLJ was amplified by PCR with primers that generated Nco I and Hind III sites at the 5’ and 3’ ends respectively.

    Article Title: Exploiting CRISPR-Cas to manipulate Enterococcus faecalis populations
    Article Snippet: Since CK111SSp(pCF10-101) encodes repA on the chromosome, it cannot be modified using derivatives of the previously mentioned plasmids, which rely on a temperature sensitive repA to create chromosomal modifications. .. To inactivate the native CK111SSp(pCF10-101) CRISPR1 system and simultaneously introduce erythromycin resistance, we created plasmid pGE17 using the HiFi DNA Master Mix (New England Biolabs). pGE17 contains the pGEM origin of replication, and appropriate arms and insert to introduce ermB to interrupt the cas9 locus. .. Additionally, pheS* and cat from pLT06 were included outside the homologous arms to provide appropriate selection and counter-selection.

    Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
    Article Snippet: Both plasmids and PCR-linearized DNA substrates were employed for the mismatch tolerance assays. .. All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively. .. The fragments for assembling the plasmids were obtained through PCR with Q5 Polymerase (NEB) or Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific), the PCR products were subjected to 1% agarose gel electrophoresis and they were purified using Zymogen gel DNA recovery kit (Zymo Research).

    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: The vector uses an EF1-alpha promoter to drive light chain expression, followed by a BGH polyA sequence and a CMV promoter to drive expression of the heavy chain, followed by a second BGH polyA sequence (Supplementary Figure S13). .. Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs).

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: To construct the suicide vector for this deletion, 1000 bp targeting regions 5’ and 3’ of the crc gene (PP_5292, GenBank: AE015451.1:6039987..6040766) were amplified from P. putida KT2440 gDNA using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primer pairs oCJ255 (5’-AACAGCTATGACATGATTACGAATTCGTAGCGTAGTGTGACTTGAAGGGCACAC-3’) & oCJ256 (5’-TTGCGGCCGCAAATGGCCCCATAAATCTCGTGCGTGTATG-3’) and oCJ257 (5’-GGGGCCATTTGCGGCCGCAAGGCCATTGGGGCTGCATTG-3’) & oCJ258 (5’-GCCTGCAGGTCGACTCTAGAGGATCCGCTTCCTCAAAGGCCAGGGC-3’), respectively, synthesized by Integrated DNA Technologies (IDT). .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: Because the plasmid pTS2Cb-ano∗ was constructed by Gibson Assembly, the four PCR fragments had to contain overlapping sequences. .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol.

    Article Title: Identification of the S-transferase like superfamily bacillithiol transferases encoded by Bacillus subtilis
    Article Snippet: Paragraph title: Plasmid and strain construction ... All strains were constructed using either NEBuilder (New England Biolabs, Inc) or Gibson Assembly (Synthetic Genomics, Inc, [ , ]).

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: This line was then crossed to nos-Cas9 expressing females and the resulting embryos were injected with a pBluescript plasmid containing either the sfGFP or TagRFP-T tag and linker sequence (4X GlyGlySer) flanked on either side by 1.5kb of DNA homologous to the mzt1 genomic locus surrounding the 5′ end of the coding region. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317). .. F1 and F2 males were screened by PCR using primers specific to sfGFP (forward primer: CTGAAGTTCATCTGCACCACC; reverse primer: GCGGCGGTCACGAACTCCAGC).

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: For complementation of the knockout mutants, the plasmid pRB473 ( ) was used. .. The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: For expression in S. carnosus , vraH was amplified by PCR from genomic DNA of S. aureus JE2 with the primers vraH fwd BamHI and vraH rev AvaI and subsequently ligated into the plasmid pPTX (derivative of pTX30 harboring the E. coli origin of replication ColE1 and an ampicillin resistance cassette [unpublished data]) via the BamHI/AvaI restriction sites, yielding the plasmid pPTX- vraH . .. For the construction of the shuttle vector pPT-tuf- vraH , a 7.3-kb PCR product of the backbone of pPTX- vraH was amplified with the primers pPTX-vraH fwd and pPTX-vraH rev and joined with a PCR product of the tufA promoter of the plasmid pC-tuf-gfp ( ) using NEBuilder HiFi DNA Assembly master mix. pPT-tuf- vraH was also used for the complementation of S. aureus JE2Δ vraH . .. SCA_2035 and SE_2402 were amplified with the respective primers and cloned via the AvaI restriction site into pPT-tuf using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Article Title: A protocatechuate biosensor for Pseudomonas putida KT2440 via promoter and protein evolution
    Article Snippet: The genetic sequence of the reporter, superfolder GFP (sfGFP) , was generated as a PCR fragment using sfGFP_Fwd/pBTL-2_sfGFP_overlap_Rev primers (Fragment 3). .. Fragments 1, 2 and 3 were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) to create a circular plasmid , such that sensor-reporter cassette with intergenic regulatory region was bound by bidirectional soxR and tonB transcription terminators in pBTL-2. .. The construct was named pBTL-2_pcaU_1 (pPcaU1) .

    Article Title: Near-atomic resolution cryoelectron microscopy structure of the 30-fold homooligomeric SpoIIIAG channel essential to spore formation in Bacillus subtilis
    Article Snippet: spoIIIAG and the proximal promoter (P2spoIIIA ) within the spoIIIAF coding sequence were PCR-amplified with primers prKF141 and prKF142 from PY79 chromosomal DNA. .. The spoIIIAG amplicon and a synthetic gene fragment (gBlock; IDT) containing the spoIIIA terminator were cloned into an XbaI/BamHI-double digested vector fragment of pAH315 ( ) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) to generate the wild-type complementation construct of wild-type spoIIIAG , plasmid pKF112. .. Complementation constructs of mutant spoIIIAG were generated similarly by cloning gBlocks or PCR products into pKF112 as follows.

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: To generate the K42R kinase dead mutation in the P dat-1 ::GFP:: swip-13 plasmid (pRB1343), we used a QuikChange II Site-Directed Mutagenesis kit (Agilent) following the manufacturer's protocol. .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).

    Article Title: A Vaginal Tract Signal Detected by the Group B Streptococcus SaeRS System Elicits Transcriptomic Changes and Enhances Murine Colonization
    Article Snippet: All samples were run in triplicate technical replicates on a single plate, and triplicate biological replicates were used to determine final statistics. .. Cloning of saeR D53E into the pET21a expression vector containing a 6His tag was done using the NEBuilder HiFi DNA assembly master mix (New England BioLabs). .. A 692-bp gblock fragment of saeR ( sak_0467 ) containing a D53E mutation was ordered from Integrated DNA Technologies.

    Article Title: ZMPSTE24 missense mutations that cause progeroid diseases decrease prelamin A cleavage activity and/or protein stability
    Article Snippet: Plasmid pSM3283 is CEN/HIS3 containing a single Flag epitope at the N terminus of ZMPSTE24 expressed from the PGK1 promoter. .. Plasmid pSM3204 (expressing mCherry-Scs2TM ) was constructed by NEBuilder® HiFi Assembly of a PCR product from Kp173 (a generous gift of Rong Li, JHU School of Medicine, Baltimore, MD) into pRS315 ( CEN/LEU2 ). .. Typically, strains grown overnight in minimal medium (0.67% yeast nitrogen base, 0.5% ammonium sulfate, 2% glucose, supplemented with appropriate amino acids and supplements) were back-diluted in fresh medium for 4-6 h. Cells (1.5-2 OD600 cell equivalents) were pelleted, washed in water and lysed using NaOH pre-treatment and SDS protein sample buffer ( ) at 65°C for 10-15 min. For analysis, lysates were centrifuged at 21,000 g for 2 min and the supernatants (0.3 OD600 cell equivalents per lane) resolved on 10% SDS polyacrylamide gels.


    Article Title: Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction
    Article Snippet: New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix. .. New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix.

    Article Title: Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition
    Article Snippet: All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB). .. All three pieces were inserted into a pUC19 backbone using HiFi DNA Assembly (NEB).

    Article Title: Eliminating a global regulator of carbon catabolite repression enhances the conversion of aromatic lignin monomers to muconate in Pseudomonas putida KT2440
    Article Snippet: The crc gene was deleted from P. putida KT2440-CJ102 using the antibiotic selection/sucrose counter-selection method ( ). .. These fragments were then assembled into pK18mobsacB (ATCC 87097) ( ) digested with EcoRI and BamHI using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs) and transformed into NEB® 5-alpha F'I q competent Escherichia coli (New England Biolabs) according to the manufacturer's instructions.

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: The pHA1887 fragment and the selection cassette were amplified by PCR from the plasmid pTS2Cb (either primers pHA5F and pHA3R, or SM5F and SM3R). .. In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol.

    Agarose Gel Electrophoresis:

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol. .. Next, the mutation cassette was amplified by PCR using pTS2Cb-ano∗ as template and primers HA3F and HA5R.

    Transgenic Assay:

    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: Paragraph title: Transgenic Drosophila lines ... This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317).


    Article Title: VraH Is the Third Component of the Staphylococcus aureus VraDEH System Involved in Gallidermin and Daptomycin Resistance and Pathogenicity
    Article Snippet: Paragraph title: Construction of plasmids and knockout mutants. ... The respective DNA fragments harboring vraDE or vraDEH and the native braR -regulated promoter were amplified from genomic DNA of S. aureus JE2 and joined into the multiple cloning site of pBR473 (AvaI/EcoRI) using NEBuilder HiFi DNA Assembly master mix (New England BioLabs).

    Direct Antiglobulin Test:

    Article Title: The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism
    Article Snippet: Overlap sequence for pRB1106 was engineered into the ends of the rho-1 cDNA PCR fragment, and a PCR fragment of pRB1106 containing the dat-1 promoter and unc-54 3′UTR was generated with overlap sequence for the rho-1 cDNA on both ends. .. Fusion of these products was performed using NEBuilder HiFi DNA Assembly (New England BioLabs).


    Article Title: γ-TuRC Heterogeneity Revealed by Analysis of Mozart1
    Article Snippet: Balanced lines were produced from those F2 males that had incorporated the deletion allele. .. This “homology” vector was made by HiFi assembly (NEB) of PCR fragments generated from genomic DNA prepared from nos-Cas-9 flies (using MicroLYSIS, Microzone) and a vector containing the sfGFP tag (DGRC, 1314) or the TagRFP-T tag (DGRC, 1317).

    Concentration Assay:

    Article Title: Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction
    Article Snippet: New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix. .. New England Biolabs released a new reagent kit (NEBuilder HiFi DNA Assembly Master Mix, # E2621L) while we were performing the Gibson Assembly studies, and they claimed that this improved assembly reagent mix has higher accuracy and efficiency than the Gibson Assembly Master Mix.

    DNA Purification:

    Article Title: Characterizing a thermostable Cas9 for bacterial genome editing and silencing
    Article Snippet: All the primers and plasmids used for plasmid construction were designed with appropriate overhangs for performing NEBuilder HiFi DNA assembly (NEB), and they are listed in Supplementary Tables , respectively. .. Single colonies were inoculated in LB medium, plasmid material was isolated using the GeneJet plasmid miniprep kit (Thermo Fisher Scientific) and sequence verified (GATC-biotech) and 1 μg of each construct was transformed to B. smithii ET 138 electro-competent cells .

    Gel Extraction:

    Article Title: The Novel Anaerobiosis-Responsive Overlapping Gene ano Is Overlapping Antisense to the Annotated Gene ECs2385 of Escherichia coli O157:H7 Sakai
    Article Snippet: In a total reaction volume of 20 μl, 200 fmol of each PCR fragment and the NEBuilder® HiFi DNA Assembly Master Mix (NEB) were incubated at 50°C for 4 h. Two μl of the reaction were transformed into E. coli Top10 and plated on LB agar with 120 μg/ml ampicillin and 20 μg/ml chloramphenicol. .. Next, the mutation cassette was amplified by PCR using pTS2Cb-ano∗ as template and primers HA3F and HA5R.

    Variant Assay:

    Article Title: Rare, high-affinity mouse anti-PD-1 antibodies that function in checkpoint blockade, discovered using microfluidics and molecular genomics
    Article Snippet: The mAbs were expressed from a variant of the pCDNA5/FRT mammalian expression vector (Thermo Fisher Scientific). .. Antibody expression constructs were built using GeneBlocks (Integrated DNA Technologies) and NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs nebuilder hifi dna assembly master mix
    Nebuilder Hifi Dna Assembly Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 87 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more hifi dna assembly master mix/product/New England Biolabs
    Average 99 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    nebuilder hifi dna assembly master mix - by Bioz Stars, 2019-07
    99/100 stars
      Buy from Supplier

    New England Biolabs neb hi fi dna assembly master mix
    Neb Hi Fi Dna Assembly Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more hi fi dna assembly master mix/product/New England Biolabs
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    neb hi fi dna assembly master mix - by Bioz Stars, 2019-07
    84/100 stars
      Buy from Supplier

    New England Biolabs hi fi dna assembly master mix
    Hi Fi Dna Assembly Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more fi dna assembly master mix/product/New England Biolabs
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hi fi dna assembly master mix - by Bioz Stars, 2019-07
    87/100 stars
      Buy from Supplier

    New England Biolabs nebuilder hifi dna assembly master mix kit
    Nebuilder Hifi Dna Assembly Master Mix Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more hifi dna assembly master mix kit/product/New England Biolabs
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    nebuilder hifi dna assembly master mix kit - by Bioz Stars, 2019-07
    91/100 stars
      Buy from Supplier

    Image Search Results