gibson assembly master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Gibson Assembly Master Mix
    Description:

    Catalog Number:
    E2611L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs gibson assembly master mix

    https://www.bioz.com/result/gibson assembly master mix/product/New England Biolabs
    Average 99 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    gibson assembly master mix - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol. .. Potential off-target binding sites for the gRNAs were predicted using CRISPOR ( http://crispor.tefor.net/crispor.py ).

    Clone Assay:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs). .. The clones were sequenced by Eton Bioscience (San Diego, CA) then packaged into lentivirus by the UNC Lentiviral Core.

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: Each of the guide RNA constructs was generated as a separate gRNA plasmid. .. The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol. .. All gRNA constructs were validated with Sanger sequencing.

    Article Title: Sustained activation of the Aryl hydrocarbon Receptor transcription factor promotes resistance to BRAF-inhibitors in melanoma
    Article Snippet: The pGL3-XRE3-FL construct containing three XRE sequences from CYP1A1 gene has been described previously . .. Luciferase reporter plasmids (pOCA2-pGL4 luciferase) containing proximal promoter region −500b (IDT, Leuven, Belgium) was cloned into the pGL4.10 (Promega, USA) using Gibson Assembly® Master Mix following manufacturer’s recommendations (NEB, UK). .. Plasmid encoding the MEK1 constitutive kinase form was described by ref. .

    Article Title: Evaluation of antibody fragment properties for near-infrared fluorescence imaging of HER3-positive cancer xenografts
    Article Snippet: The CH 3 domain with hinge region (CH 3-hinge) or CH 3-CH 2-hinge (Fc) from human IgG1 were PCR amplified from pFUSEss-CHIg-hG1 mammalian expression vector (InvivoGen, San Diego, CA) using primers that contain overlapping sequences with anti-HER3 scFv and then assembled into scFv-CH 3 or scFv-Fc using gene SOEing . .. Amplicons were cloned into pFUSEss-CHIg-hG1 vector digested with EcoRI and Nsi (Thermo Fisher Scientific) using Gibson Assembly™ master mix (New England Biolabs, Inc., Ipswich, MA). .. Anti-HER3 IgG1 expression vector was constructed by PCR amplifying VH and VL sequences and cloning them into EcoRI/NheI and EcoRI/BsiWI restriction sites in pFUSEss-CHIg-hG1 and pFUSE2ss-CLIg-hk (InvivoGen, San Diego, CA), respectively using Gibson Assembly™ protocol.

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: The 2544 bp AM1_5894 open reading frame was amplified from genomic DNA of Acaryochloris using the following primers to allow In-Fusion® (Clontech, CA, USA) cloning (forward: 5′-CGCGCGGCAGCCATATGGAAATTAGAGAACTAGCGATTT-3′, reverse: 5′-GTTAGCAGCCGGATCCTTAGGCTAAGAGTTGATGAATG-3′). .. The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: To construct the Crz1-mCherry fused strains for the site-directed mutagenesis, the Crz1 ORF was PCR amplified and fused with the mCherry fusion protein by splice overlap PCR, cloned into pCR2.1-TOPO (Invitrogen) to yield plasmid pXW15 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: TPX2 RNAi was conducted by transfecting siRNA (4427037, assay ID s22745, Silencer select predesigned siRNA; Life Technologies), following the manufacturer’s protocol, with 48 h of incubation. pEGFP-Ran and pEGFP-RanQ69L were gifts from P. Clarke, University of Dundee, Dundee, United Kingdom. pEGFP-TPX2 was a gift from T. Mitchison, Harvard Medical School, Boston. pEGFP-HURP was a gift from M. Koffa, Democritus University of Thrace, Alexandroupolis, Greece. pEGFP-HSET was a gift from C. Walczak, Indiana University, Bloomington, IN. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs). .. Similarly, pEGFP-HSET without NLS region was created by the Gibson protocol. pSG8-mTFP1-RBP-dsREACh (pSG8 RBP-4) was constructed by assembly reaction of mTFP1-RBP-dsREACh sequence amplified from pLenti-RBP-4 (pK234), a gift from P. Kaláb, National Institutes of Health, Bethesda, into pSG8 vector fragment amplified from pSG8-mTFP1-linker-dsREACh (pK364), a gift from P. Kaláb by in-fusion protocol (638916, In-Fusion HD cloning plus CE; Clontech Laboratories).

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: For generating constructs, two oligos 5′-ATAACAGGGTAATGAGGGCCGTAGCCCAAGAGTTTCTTC-3′ and 5′-CCTCGAGGATATCGAGCTCGGGAGCTGAGTCTTCATCTTC-3′ were used as forward and reverse primers to amplify a 1,711-bp region 3′ of Hoxa1 from mouse genomic DNA. .. PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs). .. Correct inserts were confirmed by sequencing.

    Article Title: Increasing the performance of pooled CRISPR–Cas9 drop-out screening
    Article Snippet: This backbone was then mutagenised to adapt the tracrRNA sequence in the plasmid to match that used for GFP labelling with dCas9 fusions , yielding pLentiCRISPR_HZD01. .. Each pooled sgRNA library was cloned into either vector backbone, using a Gibson Assembly Master Mix kit (New England BioLabs, NEB #E2611S/L) in accordance with the manufacturer’s instructions. .. Library plasmids were purified using a Qiagen Plasmid Plus purification system in accordance with the manufacturer’s instructions.

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: The 5′(about 500 bp)- and 3′(about 500 bp)- flanks of the ORF of each genes were amplified from genomic DNA of the wild type strain CH-1 by PCR with primer pairs (Supplementary Table ). .. The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions. .. Then, the 5′ fragment-hph -3′ fragment cassettes of each gene were cloned into pNeoP3300 (Wei et al., ), resulting in gene replacement vectors, which had the selective marker hph gene flanked by the ORF flanking sequences from each of the genes (Supplementary Figure ).

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: To study Celf1 mediated regulation of Dnase2b mRNA, reporter constructs of (a) Dnase2b 3’UTR and (b) Celf1 ORF (Celf1 over-expression) were generated. .. To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’. .. The nucleotides corresponding to the target vector for the Gibson assembly are in lowercase.

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: Paragraph title: CRISPRa and orthogonal sgRNA library cloning ... Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosirupto
    Article Snippet: Parameters of association ( Ka ) and maximal binding capacity ( B max ) were estimated using JMP (version 9, SAS, Cary, NC). .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. The cloning strategy excluded signal peptides and/or transmembrane domains; oligonucleotide primers used for cloning are listed in .

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: All primers referred to are listed in Table . pUCG3.8Bgl: the Thermus thermophilus β-glucosidase gene (bgl ) was codon harmonised utilising EuGene Genetic Optimisation software, synthesised by Life technologies GeneArt® , and supplied in the vector, pBAD. .. The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. For the ‘5′3′ flank’ region, two 600 bp regions upstream and downstream of the pduAB genes were PCR-amplified using Pdu-5′_F, Pdu-5′_R, Pdu-3′_F and Pdu-3′_R primers, and then joined by overlap extension PCR using Pdu-5′_F and Pdu-3′_R primers.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® .

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: The wild type SHANK2 -3′UTR was cloned into the psiCHECK™-2 vector (Promega, Mannheim, Germany) after PCR amplification on human genomic DNA from a healthy individual. .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany).

    Amplification:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: We amplified dCas9-P300 out of the vector using primers designed with 20 bp overhangs for a Gibson assembly using PCR, then we extracted using PCR cleanup kits. .. The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs).

    Article Title: Evaluation of antibody fragment properties for near-infrared fluorescence imaging of HER3-positive cancer xenografts
    Article Snippet: The CH 3 domain with hinge region (CH 3-hinge) or CH 3-CH 2-hinge (Fc) from human IgG1 were PCR amplified from pFUSEss-CHIg-hG1 mammalian expression vector (InvivoGen, San Diego, CA) using primers that contain overlapping sequences with anti-HER3 scFv and then assembled into scFv-CH 3 or scFv-Fc using gene SOEing . .. Amplicons were cloned into pFUSEss-CHIg-hG1 vector digested with EcoRI and Nsi (Thermo Fisher Scientific) using Gibson Assembly™ master mix (New England Biolabs, Inc., Ipswich, MA).

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: To improve the protein overexpression yield, the 1524 bp N-terminal photosensory domain (AM1_5894 ΔHK, lacking its histidine kinase and receiver domains) was amplified from Acaryochloris genomic DNA, using Phusion polymerase (New England Biolabs Ltd., UK) and the primer pair AmBph_ITA_FW (GCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGAAATTAGAGAACTAGCGATTTCT) and AmBph_ITA_RV (CCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGTTATTCCTGCTGCTGGTTTTCTCC). .. The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: To construct the Crz1-mCherry fused strains for the site-directed mutagenesis, the Crz1 ORF was PCR amplified and fused with the mCherry fusion protein by splice overlap PCR, cloned into pCR2.1-TOPO (Invitrogen) to yield plasmid pXW15 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: The 5′(about 500 bp)- and 3′(about 500 bp)- flanks of the ORF of each genes were amplified from genomic DNA of the wild type strain CH-1 by PCR with primer pairs (Supplementary Table ). .. The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions.

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: The library vector sgLenti was preapred by restriction digest with AarI (Thermo-Fischer) at 37C overnight, followed by 1% agarose gel excision of the digested band and purification via NucleoSpin columns (Macherey-Nagel). .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume. .. The reaction was purified using P-30 buffer exchange columns (Biorad) that were equilibrated 5x with H2 O and the total eluted volume was transformed into three vials of Electromax DH5α (ThermoFisher).

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: All primers referred to are listed in Table . pUCG3.8Bgl: the Thermus thermophilus β-glucosidase gene (bgl ) was codon harmonised utilising EuGene Genetic Optimisation software, synthesised by Life technologies GeneArt® , and supplied in the vector, pBAD. .. The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. For the ‘5′3′ flank’ region, two 600 bp regions upstream and downstream of the pduAB genes were PCR-amplified using Pdu-5′_F, Pdu-5′_R, Pdu-3′_F and Pdu-3′_R primers, and then joined by overlap extension PCR using Pdu-5′_F and Pdu-3′_R primers.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® .

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: The wild type SHANK2 -3′UTR was cloned into the psiCHECK™-2 vector (Promega, Mannheim, Germany) after PCR amplification on human genomic DNA from a healthy individual. .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany).

    Reporter Assay:

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: Paragraph title: Zebrafish Transgenic Reporter Assay. ... PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs).

    Synthesized:

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: Each of the guide RNA constructs was generated as a separate gRNA plasmid. .. The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol. .. All gRNA constructs were validated with Sanger sequencing.

    Construct:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: The dCas9-P300 construct was in a vector driven by the CMV promoter, which has poor expression in neurons, so we subcloned the dCas9-P300 constructs (Addgene 61357 and 61358, a generous gift from Dr. Charles Gersbach) into a lentiviral expression vector with an RFP promoter (Addgene 17619). .. The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs).

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: Each of the guide RNA constructs was generated as a separate gRNA plasmid. .. The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol.

    Article Title: Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)
    Article Snippet: Here, we report improvements to a C. thermocellum expression plasmid, and use this improved plasmid to screen a variety of different adhE s for improved ethanol production in the C. thermocellum adhE deletion strain, LL1111. .. Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611). .. DNA purification was performed using commercially available kits from Qiagen (Qiagen catalog number 27,106) or Zymo Research (Zymo Research catalog numbers D4002 and D4006).

    Article Title: Simplified Footprint-Free Cas9/CRISPR Editing of Cardiac-Associated Genes in Human Pluripotent Stem Cells
    Article Snippet: The ADRB2 targeting vector was constructed via Gibson assembly by using Gibson Assembly Master Mix (E2611S NEB). .. A 20 μL reaction containing 0.24 pmol of each insert, 0.08 pM of Bluescript backbone, and 1 × Gibson Assembly® Master Mix (NEB) was heated at 50°C for 60 min.

    Article Title: Sustained activation of the Aryl hydrocarbon Receptor transcription factor promotes resistance to BRAF-inhibitors in melanoma
    Article Snippet: The pGL3-XRE3-FL construct containing three XRE sequences from CYP1A1 gene has been described previously . .. Luciferase reporter plasmids (pOCA2-pGL4 luciferase) containing proximal promoter region −500b (IDT, Leuven, Belgium) was cloned into the pGL4.10 (Promega, USA) using Gibson Assembly® Master Mix following manufacturer’s recommendations (NEB, UK).

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs). .. The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: To construct the Crz1-mCherry fused strains for the site-directed mutagenesis, the Crz1 ORF was PCR amplified and fused with the mCherry fusion protein by splice overlap PCR, cloned into pCR2.1-TOPO (Invitrogen) to yield plasmid pXW15 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: TPX2 RNAi was conducted by transfecting siRNA (4427037, assay ID s22745, Silencer select predesigned siRNA; Life Technologies), following the manufacturer’s protocol, with 48 h of incubation. pEGFP-Ran and pEGFP-RanQ69L were gifts from P. Clarke, University of Dundee, Dundee, United Kingdom. pEGFP-TPX2 was a gift from T. Mitchison, Harvard Medical School, Boston. pEGFP-HURP was a gift from M. Koffa, Democritus University of Thrace, Alexandroupolis, Greece. pEGFP-HSET was a gift from C. Walczak, Indiana University, Bloomington, IN. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs). .. Similarly, pEGFP-HSET without NLS region was created by the Gibson protocol. pSG8-mTFP1-RBP-dsREACh (pSG8 RBP-4) was constructed by assembly reaction of mTFP1-RBP-dsREACh sequence amplified from pLenti-RBP-4 (pK234), a gift from P. Kaláb, National Institutes of Health, Bethesda, into pSG8 vector fragment amplified from pSG8-mTFP1-linker-dsREACh (pK364), a gift from P. Kaláb by in-fusion protocol (638916, In-Fusion HD cloning plus CE; Clontech Laboratories).

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: For generating constructs, two oligos 5′-ATAACAGGGTAATGAGGGCCGTAGCCCAAGAGTTTCTTC-3′ and 5′-CCTCGAGGATATCGAGCTCGGGAGCTGAGTCTTCATCTTC-3′ were used as forward and reverse primers to amplify a 1,711-bp region 3′ of Hoxa1 from mouse genomic DNA. .. PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs).

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions. .. Then, the 5′ fragment-hph -3′ fragment cassettes of each gene were cloned into pNeoP3300 (Wei et al., ), resulting in gene replacement vectors, which had the selective marker hph gene flanked by the ORF flanking sequences from each of the genes (Supplementary Figure ).

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: To study Celf1 mediated regulation of Dnase2b mRNA, reporter constructs of (a) Dnase2b 3’UTR and (b) Celf1 ORF (Celf1 over-expression) were generated. .. To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’.

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: Paragraph title: P . tricornutum POR1 and POR2 heterologous expression constructs ... Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h.

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany). .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany).

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: Further, most tagged proteins expressed by one partner are transferred to the mating partner, where a (sometimes weaker) signal is produced. .. For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. The linearized construct was introduced into strains of both mating types by biolistic transformation to replace the ZHP3 ORF in the macronuclear genome by homologous recombination between the flanking fragments.

    Microarray:

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: For the CRISPRa library, the designed 20 nt target specific sgRNA sequences were synthesised as a pool, on microarray surfaces (CustomArray, Inc.), flanked by overhangs compatible with Gibson Assembly into the pSico based sgLenti sgRNA library vector (see for vector map). .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Incubation:

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: TPX2 RNAi was conducted by transfecting siRNA (4427037, assay ID s22745, Silencer select predesigned siRNA; Life Technologies), following the manufacturer’s protocol, with 48 h of incubation. pEGFP-Ran and pEGFP-RanQ69L were gifts from P. Clarke, University of Dundee, Dundee, United Kingdom. pEGFP-TPX2 was a gift from T. Mitchison, Harvard Medical School, Boston. pEGFP-HURP was a gift from M. Koffa, Democritus University of Thrace, Alexandroupolis, Greece. pEGFP-HSET was a gift from C. Walczak, Indiana University, Bloomington, IN. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs).

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: The linearized vector and PCR inserts were each purified with the QIAquick PCR Purification kit (Qiagen). .. Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h. .. A reaction containing 50μL competent Escherichia coli DH5α (Life Technologies) and 5μL of the Gibson Assembly product were incubated on ice for 30min, heat shocked at 42°C for 45sec, then cooled on ice for 2min.

    Luciferase:

    Article Title: Sustained activation of the Aryl hydrocarbon Receptor transcription factor promotes resistance to BRAF-inhibitors in melanoma
    Article Snippet: The pGL3-XRE3-FL construct containing three XRE sequences from CYP1A1 gene has been described previously . .. Luciferase reporter plasmids (pOCA2-pGL4 luciferase) containing proximal promoter region −500b (IDT, Leuven, Belgium) was cloned into the pGL4.10 (Promega, USA) using Gibson Assembly® Master Mix following manufacturer’s recommendations (NEB, UK). .. Plasmid encoding the MEK1 constitutive kinase form was described by ref. .

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: To study Celf1 mediated regulation of Dnase2b mRNA, reporter constructs of (a) Dnase2b 3’UTR and (b) Celf1 ORF (Celf1 over-expression) were generated. .. To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’. .. The nucleotides corresponding to the target vector for the Gibson assembly are in lowercase.

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: Paragraph title: Luciferase assays ... PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany).

    Introduce:

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: The wild type SHANK2 -3′UTR was cloned into the psiCHECK™-2 vector (Promega, Mannheim, Germany) after PCR amplification on human genomic DNA from a healthy individual. .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany). .. Mutagenesis of the miR-137 binding site was performed on the wild type construct by PCR with the original cloning primers and mutagenesis primers, assembled using the SLiCE cloning system [ ].

    Expressing:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Paragraph title: Subcloning dCas9-P300 into the Lentiviral Expression Vector ... The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs).

    Article Title: Evaluation of antibody fragment properties for near-infrared fluorescence imaging of HER3-positive cancer xenografts
    Article Snippet: The CH 3 domain with hinge region (CH 3-hinge) or CH 3-CH 2-hinge (Fc) from human IgG1 were PCR amplified from pFUSEss-CHIg-hG1 mammalian expression vector (InvivoGen, San Diego, CA) using primers that contain overlapping sequences with anti-HER3 scFv and then assembled into scFv-CH 3 or scFv-Fc using gene SOEing . .. Amplicons were cloned into pFUSEss-CHIg-hG1 vector digested with EcoRI and Nsi (Thermo Fisher Scientific) using Gibson Assembly™ master mix (New England Biolabs, Inc., Ipswich, MA).

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: Paragraph title: Expression and purification of recombinant Amr BphP ... The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: Paragraph title: Generation of strains expressing mCherry-tagged calcineurin target proteins and Crz1-mCherry phosphosite mutants ... Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: Cells were transfected with the expression clones by FuGENE HD protocol (E2311, FuGENE HD transfection reagent; Promega Corp.). .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs).

    Article Title: Increasing the performance of pooled CRISPR–Cas9 drop-out screening
    Article Snippet: An all-in-one lentivirus plasmid vector was built comprising a selection marker (puromycin resistance), the expression cassette for SpCas9 expression and the sgRNA sequence (based on pLentiCRISPRv2 ). .. Each pooled sgRNA library was cloned into either vector backbone, using a Gibson Assembly Master Mix kit (New England BioLabs, NEB #E2611S/L) in accordance with the manufacturer’s instructions.

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: Paragraph title: P . tricornutum POR1 and POR2 heterologous expression constructs ... Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h.

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosirupto
    Article Snippet: Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: All primers referred to are listed in Table . pUCG3.8Bgl: the Thermus thermophilus β-glucosidase gene (bgl ) was codon harmonised utilising EuGene Genetic Optimisation software, synthesised by Life technologies GeneArt® , and supplied in the vector, pBAD. .. The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. For the ‘5′3′ flank’ region, two 600 bp regions upstream and downstream of the pduAB genes were PCR-amplified using Pdu-5′_F, Pdu-5′_R, Pdu-3′_F and Pdu-3′_R primers, and then joined by overlap extension PCR using Pdu-5′_F and Pdu-3′_R primers.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® .

    Modification:

    Article Title: Increasing the performance of pooled CRISPR–Cas9 drop-out screening
    Article Snippet: Each sgRNA was synthesised twice (Custom Array Inc); once to allow compatibility with the tracrRNA sequence used in the original GeCKOv2 library (5′-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC-3′) and once to allow compatibility with the modified tracrRNA sequence as described in Chen et al ., 2013 (5′-GTTTAAGAGCTATGCTG GAAACAGCA TAGCAAGTT-3′) . .. Each pooled sgRNA library was cloned into either vector backbone, using a Gibson Assembly Master Mix kit (New England BioLabs, NEB #E2611S/L) in accordance with the manufacturer’s instructions.

    RNA Binding Assay:

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: For EpCAM, a selection of twelve unique guide RNA binding sites was chosen to cover the region with 100–200 bp in between the gRNAs (shown in ). .. The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol.

    Over Expression:

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: To improve the protein overexpression yield, the 1524 bp N-terminal photosensory domain (AM1_5894 ΔHK, lacking its histidine kinase and receiver domains) was amplified from Acaryochloris genomic DNA, using Phusion polymerase (New England Biolabs Ltd., UK) and the primer pair AmBph_ITA_FW (GCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGAAATTAGAGAACTAGCGATTTCT) and AmBph_ITA_RV (CCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGTTATTCCTGCTGCTGGTTTTCTCC). .. The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: Paragraph title: Celf1 over-expression assays ... To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’.

    Transformation Assay:

    Article Title: Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)
    Article Snippet: Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611). .. Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611).

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. Plasmid clones of each mutagenic Crz1 allele were sequenced to ensure they contained the mutations.

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions. .. Finally, the PtrpC -cDNA-TtrpC cassette was cloned into pNeoP3300, resulting in complementation vector.

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h. .. Luria Broth medium (500μL) was added to the reaction mixtures prior to incubation at 37°C for 1h with shaking at 200rpm.

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume. .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosirupto
    Article Snippet: Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® . .. The PCR product and pUCG3.8Bgl+start+5′3′ flank were digested with Nhe I and Xma I, gel purified and ligated with T4 ligase to create pUCG3.8Bgl-pdu.

    Hybridization:

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. Clones carrying the deletion cassette were selected with increasing paromomycin concentrations ( ).

    Flow Cytometry:

    Article Title: Evaluation of antibody fragment properties for near-infrared fluorescence imaging of HER3-positive cancer xenografts
    Article Snippet: The CH 3 domain with hinge region (CH 3-hinge) or CH 3-CH 2-hinge (Fc) from human IgG1 were PCR amplified from pFUSEss-CHIg-hG1 mammalian expression vector (InvivoGen, San Diego, CA) using primers that contain overlapping sequences with anti-HER3 scFv and then assembled into scFv-CH 3 or scFv-Fc using gene SOEing . .. Amplicons were cloned into pFUSEss-CHIg-hG1 vector digested with EcoRI and Nsi (Thermo Fisher Scientific) using Gibson Assembly™ master mix (New England Biolabs, Inc., Ipswich, MA).

    Transgenic Assay:

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: Paragraph title: Zebrafish Transgenic Reporter Assay. ... PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs).

    Ligation:

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosirupto
    Article Snippet: Parameters of association ( Ka ) and maximal binding capacity ( B max ) were estimated using JMP (version 9, SAS, Cary, NC). .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. The cloning strategy excluded signal peptides and/or transmembrane domains; oligonucleotide primers used for cloning are listed in .

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® . .. The PCR product and pUCG3.8Bgl+start+5′3′ flank were digested with Nhe I and Xma I, gel purified and ligated with T4 ligase to create pUCG3.8Bgl-pdu.

    Cell Culture:

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume. .. The reaction was purified using P-30 buffer exchange columns (Biorad) that were equilibrated 5x with H2 O and the total eluted volume was transformed into three vials of Electromax DH5α (ThermoFisher).

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: Paragraph title: Cell culture, meiosis induction, and strain construction ... For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany).

    Generated:

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: Each of the guide RNA constructs was generated as a separate gRNA plasmid. .. The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol.

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: To characterize ChPKA1, ChPKA2 , and ChAC genes, the genes replacement vectors pChPKA1-3300, pChPKA2-3300, and pChAC-3300 were generated as described (Ma et al., ). .. The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions.

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: To study Celf1 mediated regulation of Dnase2b mRNA, reporter constructs of (a) Dnase2b 3’UTR and (b) Celf1 ORF (Celf1 over-expression) were generated. .. To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’.

    Polymerase Chain Reaction:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: We amplified dCas9-P300 out of the vector using primers designed with 20 bp overhangs for a Gibson assembly using PCR, then we extracted using PCR cleanup kits. .. The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs).

    Article Title: Simplified Footprint-Free Cas9/CRISPR Editing of Cardiac-Associated Genes in Human Pluripotent Stem Cells
    Article Snippet: Overlapping fragments were produced by polymerase chain reaction (PCR) (GoTaq polymerase; Promega) for three inserts: Dual drug selection cassette (Puro-ΔTK) flanked by PiggyBac recombination sites and the left and right homology regions for ADRB2 (∼1 kb upstream and ∼1 kb downstream of the locus cut site). .. A 20 μL reaction containing 0.24 pmol of each insert, 0.08 pM of Bluescript backbone, and 1 × Gibson Assembly® Master Mix (NEB) was heated at 50°C for 60 min.

    Article Title: Evaluation of antibody fragment properties for near-infrared fluorescence imaging of HER3-positive cancer xenografts
    Article Snippet: The CH 3 domain with hinge region (CH 3-hinge) or CH 3-CH 2-hinge (Fc) from human IgG1 were PCR amplified from pFUSEss-CHIg-hG1 mammalian expression vector (InvivoGen, San Diego, CA) using primers that contain overlapping sequences with anti-HER3 scFv and then assembled into scFv-CH 3 or scFv-Fc using gene SOEing . .. Amplicons were cloned into pFUSEss-CHIg-hG1 vector digested with EcoRI and Nsi (Thermo Fisher Scientific) using Gibson Assembly™ master mix (New England Biolabs, Inc., Ipswich, MA).

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: To improve the protein overexpression yield, the 1524 bp N-terminal photosensory domain (AM1_5894 ΔHK, lacking its histidine kinase and receiver domains) was amplified from Acaryochloris genomic DNA, using Phusion polymerase (New England Biolabs Ltd., UK) and the primer pair AmBph_ITA_FW (GCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGAAATTAGAGAACTAGCGATTTCT) and AmBph_ITA_RV (CCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGTTATTCCTGCTGCTGGTTTTCTCC). .. The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs). .. A Cys11Ser mutant of AM1_5894 ΔHK (C11S-AM1_5894ΔHK) was synthesized as a gBlock (Integrated DNA Technologies, Corlaville, IA, USA), with the overlapping pET15b sequence.

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: The 7.96 kb BamHI Crz1-mCherry fusion fragment was subcloned into the BamHI site of the safe haven plasmid pSDMA25, to generate plasmid pEC13 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. Plasmid clones of each mutagenic Crz1 allele were sequenced to ensure they contained the mutations.

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: For generating constructs, two oligos 5′-ATAACAGGGTAATGAGGGCCGTAGCCCAAGAGTTTCTTC-3′ and 5′-CCTCGAGGATATCGAGCTCGGGAGCTGAGTCTTCATCTTC-3′ were used as forward and reverse primers to amplify a 1,711-bp region 3′ of Hoxa1 from mouse genomic DNA. .. PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs). .. Correct inserts were confirmed by sequencing.

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: The 5′(about 500 bp)- and 3′(about 500 bp)- flanks of the ORF of each genes were amplified from genomic DNA of the wild type strain CH-1 by PCR with primer pairs (Supplementary Table ). .. The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions.

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’. .. To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’.

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: The linearized vector and PCR inserts were each purified with the QIAquick PCR Purification kit (Qiagen). .. Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h. .. A reaction containing 50μL competent Escherichia coli DH5α (Life Technologies) and 5μL of the Gibson Assembly product were incubated on ice for 30min, heat shocked at 42°C for 45sec, then cooled on ice for 2min.

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: PCR products were purified using Minelute columns (Qiagen). .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: All primers referred to are listed in Table . pUCG3.8Bgl: the Thermus thermophilus β-glucosidase gene (bgl ) was codon harmonised utilising EuGene Genetic Optimisation software, synthesised by Life technologies GeneArt® , and supplied in the vector, pBAD. .. The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. For the ‘5′3′ flank’ region, two 600 bp regions upstream and downstream of the pduAB genes were PCR-amplified using Pdu-5′_F, Pdu-5′_R, Pdu-3′_F and Pdu-3′_R primers, and then joined by overlap extension PCR using Pdu-5′_F and Pdu-3′_R primers.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: For the ‘5′3′ flank’ region, two 600 bp regions upstream and downstream of the pduAB genes were PCR-amplified using Pdu-5′_F, Pdu-5′_R, Pdu-3′_F and Pdu-3′_R primers, and then joined by overlap extension PCR using Pdu-5′_F and Pdu-3′_R primers. .. The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® .

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: The wild type SHANK2 -3′UTR was cloned into the psiCHECK™-2 vector (Promega, Mannheim, Germany) after PCR amplification on human genomic DNA from a healthy individual. .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany). .. Mutagenesis of the miR-137 binding site was performed on the wild type construct by PCR with the original cloning primers and mutagenesis primers, assembled using the SLiCE cloning system [ ].

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. Clones carrying the deletion cassette were selected with increasing paromomycin concentrations ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions. .. Then, the 5′ fragment-hph -3′ fragment cassettes of each gene were cloned into pNeoP3300 (Wei et al., ), resulting in gene replacement vectors, which had the selective marker hph gene flanked by the ORF flanking sequences from each of the genes (Supplementary Figure ).

    Injection:

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs). .. PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs).

    Binding Assay:

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol. .. All gRNA constructs were validated with Sanger sequencing.

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosirupto
    Article Snippet: Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. Transformed yeast cells were directly plated on selective SDCAA medium (per 1 liter of medium: 5 g of casamino acids, 6.7 g of yeast nitrogen base (Difco), 20 g of d -glucose, 7.45 g of monobasic sodium phosphate, 5.4 g dibasic sodium phosphate, 15 g of agar, 182 g of sorbitol).

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: To validate a predicted miR-137 binding site in SHANK2 , luciferase reporter assays were carried out in human SH-SY5Y cells and mouse primary hippocampal neurons. .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany).

    Gene Knockout:

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: Further, most tagged proteins expressed by one partner are transferred to the mating partner, where a (sometimes weaker) signal is produced. .. For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. The linearized construct was introduced into strains of both mating types by biolistic transformation to replace the ZHP3 ORF in the macronuclear genome by homologous recombination between the flanking fragments.

    Methylation:

    Article Title: Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)
    Article Snippet: Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611). .. Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611).

    Mutagenesis:

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs). .. The resulting three constructs were used to transform DH5α E. coli cells.

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: The 7.96 kb BamHI Crz1-mCherry fusion fragment was subcloned into the BamHI site of the safe haven plasmid pSDMA25, to generate plasmid pEC13 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. Plasmid clones of each mutagenic Crz1 allele were sequenced to ensure they contained the mutations.

    Subcloning:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Paragraph title: Subcloning dCas9-P300 into the Lentiviral Expression Vector ... The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs).

    Transfection:

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: Transfected cells were selected by 2 µg/mL blasticidin (R210-01, Blasticidin S HCl; Life Technologies) for at least 3 wk. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs).

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany). .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany).

    Purification:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: The lentiviral vector was cut using EcoRV (cat. no. R0195S; New England Biolabs), and the resultant fragments were purified using Qiagen Gel Extract kit (cat. no. 28704; Qiagen). .. The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs).

    Article Title: Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)
    Article Snippet: Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611). .. Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611).

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: Paragraph title: Expression and purification of recombinant Amr BphP ... The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: The linearized vector and PCR inserts were each purified with the QIAquick PCR Purification kit (Qiagen). .. Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h.

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: The library vector sgLenti was preapred by restriction digest with AarI (Thermo-Fischer) at 37C overnight, followed by 1% agarose gel excision of the digested band and purification via NucleoSpin columns (Macherey-Nagel). .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® . .. To do this, the LDH promoter was PCR-amplified from G. thermoglucosidasius NCIMB 11955 with ldhF and ldhR primers containing flanking Nhe I and Xma I restriction sites.

    Sequencing:

    Article Title: Simplified Footprint-Free Cas9/CRISPR Editing of Cardiac-Associated Genes in Human Pluripotent Stem Cells
    Article Snippet: An EcoRV-digested pBluescript backbone plasmid sequence was used as the fourth DNA fragment in the Gibson assembly. .. A 20 μL reaction containing 0.24 pmol of each insert, 0.08 pM of Bluescript backbone, and 1 × Gibson Assembly® Master Mix (NEB) was heated at 50°C for 60 min.

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: The 5’ (an ~1 kb region of the sequence immediately upstream of the start codon) and 3’ (an ~1 kb fragment of the sequence immediately downstream of the stop codon) flanking regions of the target genes were amplified using primers 5CF and 5CR and primers 3CF and 3R, respectively. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: TPX2 RNAi was conducted by transfecting siRNA (4427037, assay ID s22745, Silencer select predesigned siRNA; Life Technologies), following the manufacturer’s protocol, with 48 h of incubation. pEGFP-Ran and pEGFP-RanQ69L were gifts from P. Clarke, University of Dundee, Dundee, United Kingdom. pEGFP-TPX2 was a gift from T. Mitchison, Harvard Medical School, Boston. pEGFP-HURP was a gift from M. Koffa, Democritus University of Thrace, Alexandroupolis, Greece. pEGFP-HSET was a gift from C. Walczak, Indiana University, Bloomington, IN. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs). .. Similarly, pEGFP-HSET without NLS region was created by the Gibson protocol. pSG8-mTFP1-RBP-dsREACh (pSG8 RBP-4) was constructed by assembly reaction of mTFP1-RBP-dsREACh sequence amplified from pLenti-RBP-4 (pK234), a gift from P. Kaláb, National Institutes of Health, Bethesda, into pSG8 vector fragment amplified from pSG8-mTFP1-linker-dsREACh (pK364), a gift from P. Kaláb by in-fusion protocol (638916, In-Fusion HD cloning plus CE; Clontech Laboratories).

    Article Title: Increasing the performance of pooled CRISPR–Cas9 drop-out screening
    Article Snippet: This backbone was then mutagenised to adapt the tracrRNA sequence in the plasmid to match that used for GFP labelling with dCas9 fusions , yielding pLentiCRISPR_HZD01. .. Each pooled sgRNA library was cloned into either vector backbone, using a Gibson Assembly Master Mix kit (New England BioLabs, NEB #E2611S/L) in accordance with the manufacturer’s instructions.

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’. .. To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’.

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany). .. Mutagenesis of the miR-137 binding site was performed on the wild type construct by PCR with the original cloning primers and mutagenesis primers, assembled using the SLiCE cloning system [ ].

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. Clones carrying the deletion cassette were selected with increasing paromomycin concentrations ( ).

    shRNA:

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: The U2OS cell lines with RanGAP1 RNAi were produced by harnessing shRNA. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs).

    Blocking Assay:

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: Four sets of DNA oligonucleotide sequence targeting human RanGAP1 gene were purchased (Hmi414528, Hmi414529, Hmi414530, and Hmi414531, Block-iT miRNA RNAi select oligos; Life Technologies) and cloned into pcDNA6.2-GW/miR vector following the manufacturer’s protocol (4935-00, Block-iT Pol II miR RNAi expression vector kit; Life Technologies). .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs).

    Plasmid Preparation:

    Article Title: Ethanol Exposure Regulates Gabra1 Expression via Histone Deacetylation at the Promoter in Cultured Cortical Neurons
    Article Snippet: Paragraph title: Subcloning dCas9-P300 into the Lentiviral Expression Vector ... The two fragments were incorporated using the Gibson assembly following the manufacturer’s instructions (cat. no. E2611S; New England Biolabs).

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: Each of the guide RNA constructs was generated as a separate gRNA plasmid. .. The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol. .. All gRNA constructs were validated with Sanger sequencing.

    Article Title: Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)
    Article Snippet: Paragraph title: Plasmid and strain construction ... Plasmids were constructed via the isothermal assembly method , using a commercial kit sold by New England Biolabs (Gibson Assembly® Master Mix, product catalog number E2611).

    Article Title: Simplified Footprint-Free Cas9/CRISPR Editing of Cardiac-Associated Genes in Human Pluripotent Stem Cells
    Article Snippet: Paragraph title: Targeting vector construction ... A 20 μL reaction containing 0.24 pmol of each insert, 0.08 pM of Bluescript backbone, and 1 × Gibson Assembly® Master Mix (NEB) was heated at 50°C for 60 min.

    Article Title: Evaluation of antibody fragment properties for near-infrared fluorescence imaging of HER3-positive cancer xenografts
    Article Snippet: The CH 3 domain with hinge region (CH 3-hinge) or CH 3-CH 2-hinge (Fc) from human IgG1 were PCR amplified from pFUSEss-CHIg-hG1 mammalian expression vector (InvivoGen, San Diego, CA) using primers that contain overlapping sequences with anti-HER3 scFv and then assembled into scFv-CH 3 or scFv-Fc using gene SOEing . .. Amplicons were cloned into pFUSEss-CHIg-hG1 vector digested with EcoRI and Nsi (Thermo Fisher Scientific) using Gibson Assembly™ master mix (New England Biolabs, Inc., Ipswich, MA). .. Anti-HER3 IgG1 expression vector was constructed by PCR amplifying VH and VL sequences and cloning them into EcoRI/NheI and EcoRI/BsiWI restriction sites in pFUSEss-CHIg-hG1 and pFUSE2ss-CLIg-hk (InvivoGen, San Diego, CA), respectively using Gibson Assembly™ protocol.

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: The underlined sequences are 5′ overhangs specific to the E. coli expression vector pET15b, which introduces a hexa-histidine tag to the expressed protein. .. The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: The 7.96 kb BamHI Crz1-mCherry fusion fragment was subcloned into the BamHI site of the safe haven plasmid pSDMA25, to generate plasmid pEC13 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: TPX2 RNAi was conducted by transfecting siRNA (4427037, assay ID s22745, Silencer select predesigned siRNA; Life Technologies), following the manufacturer’s protocol, with 48 h of incubation. pEGFP-Ran and pEGFP-RanQ69L were gifts from P. Clarke, University of Dundee, Dundee, United Kingdom. pEGFP-TPX2 was a gift from T. Mitchison, Harvard Medical School, Boston. pEGFP-HURP was a gift from M. Koffa, Democritus University of Thrace, Alexandroupolis, Greece. pEGFP-HSET was a gift from C. Walczak, Indiana University, Bloomington, IN. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs). .. Similarly, pEGFP-HSET without NLS region was created by the Gibson protocol. pSG8-mTFP1-RBP-dsREACh (pSG8 RBP-4) was constructed by assembly reaction of mTFP1-RBP-dsREACh sequence amplified from pLenti-RBP-4 (pK234), a gift from P. Kaláb, National Institutes of Health, Bethesda, into pSG8 vector fragment amplified from pSG8-mTFP1-linker-dsREACh (pK364), a gift from P. Kaláb by in-fusion protocol (638916, In-Fusion HD cloning plus CE; Clontech Laboratories).

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: For generating constructs, two oligos 5′-ATAACAGGGTAATGAGGGCCGTAGCCCAAGAGTTTCTTC-3′ and 5′-CCTCGAGGATATCGAGCTCGGGAGCTGAGTCTTCATCTTC-3′ were used as forward and reverse primers to amplify a 1,711-bp region 3′ of Hoxa1 from mouse genomic DNA. .. PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs). .. Correct inserts were confirmed by sequencing.

    Article Title: Increasing the performance of pooled CRISPR–Cas9 drop-out screening
    Article Snippet: This backbone was then mutagenised to adapt the tracrRNA sequence in the plasmid to match that used for GFP labelling with dCas9 fusions , yielding pLentiCRISPR_HZD01. .. Each pooled sgRNA library was cloned into either vector backbone, using a Gibson Assembly Master Mix kit (New England BioLabs, NEB #E2611S/L) in accordance with the manufacturer’s instructions. .. Library plasmids were purified using a Qiagen Plasmid Plus purification system in accordance with the manufacturer’s instructions.

    Article Title: The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum
    Article Snippet: The 5′- and 3′- fragments of each genes were then cloned into the upstream and downstream of hph cassette respectively, using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA) according to the manufacturer's instructions. .. Then, the 5′ fragment-hph -3′ fragment cassettes of each gene were cloned into pNeoP3300 (Wei et al., ), resulting in gene replacement vectors, which had the selective marker hph gene flanked by the ORF flanking sequences from each of the genes (Supplementary Figure ).

    Article Title: The RNA-binding protein Celf1 post-transcriptionally regulates p27Kip1 and Dnase2b to control fiber cell nuclear degradation in lens development
    Article Snippet: To study Celf1 mediated regulation of Dnase2b mRNA, reporter constructs of (a) Dnase2b 3’UTR and (b) Celf1 ORF (Celf1 over-expression) were generated. .. To generate the Dnase2b 3’UTR plasmid, wild-type Dnase2b 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, Madision, WI) using the Gibson Assembly Master Mix kit (New England Biolabs, Ipswich, MA, NEB#E2611S/L) with the following primers: Forward-5’-tagttgtttaaacgagctCACACCCTCTGTCCTTGAA-3’ and Reverse-5’-atgcctgcaggtcgactCCTATATTTATTCACTTCCTTTACTGTC-3’. .. The nucleotides corresponding to the target vector for the Gibson assembly are in lowercase.

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: The linearized vector and PCR inserts were each purified with the QIAquick PCR Purification kit (Qiagen). .. Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h. .. A reaction containing 50μL competent Escherichia coli DH5α (Life Technologies) and 5μL of the Gibson Assembly product were incubated on ice for 30min, heat shocked at 42°C for 45sec, then cooled on ice for 2min.

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: The library vector sgLenti was preapred by restriction digest with AarI (Thermo-Fischer) at 37C overnight, followed by 1% agarose gel excision of the digested band and purification via NucleoSpin columns (Macherey-Nagel). .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosirupto
    Article Snippet: Parameters of association ( Ka ) and maximal binding capacity ( B max ) were estimated using JMP (version 9, SAS, Cary, NC). .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. The cloning strategy excluded signal peptides and/or transmembrane domains; oligonucleotide primers used for cloning are listed in .

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: All primers referred to are listed in Table . pUCG3.8Bgl: the Thermus thermophilus β-glucosidase gene (bgl ) was codon harmonised utilising EuGene Genetic Optimisation software, synthesised by Life technologies GeneArt® , and supplied in the vector, pBAD. .. The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start. .. For the ‘5′3′ flank’ region, two 600 bp regions upstream and downstream of the pduAB genes were PCR-amplified using Pdu-5′_F, Pdu-5′_R, Pdu-3′_F and Pdu-3′_R primers, and then joined by overlap extension PCR using Pdu-5′_F and Pdu-3′_R primers.

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: Paragraph title: Plasmid construction ... The 5′3′ flank was then inserted into pUCG3.8Bgl+start region at the bglI site downstream of the kanamycin resistance gene, utilizing the NEB Gibson Mastermix® .

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: The wild type SHANK2 -3′UTR was cloned into the psiCHECK™-2 vector (Promega, Mannheim, Germany) after PCR amplification on human genomic DNA from a healthy individual. .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany). .. Mutagenesis of the miR-137 binding site was performed on the wild type construct by PCR with the original cloning primers and mutagenesis primers, assembled using the SLiCE cloning system [ ].

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: Further, most tagged proteins expressed by one partner are transferred to the mating partner, where a (sometimes weaker) signal is produced. .. For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. The linearized construct was introduced into strains of both mating types by biolistic transformation to replace the ZHP3 ORF in the macronuclear genome by homologous recombination between the flanking fragments.

    Software:

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.
    Article Snippet: All primers referred to are listed in Table . pUCG3.8Bgl: the Thermus thermophilus β-glucosidase gene (bgl ) was codon harmonised utilising EuGene Genetic Optimisation software, synthesised by Life technologies GeneArt® , and supplied in the vector, pBAD. .. The bgl gene was amplified from the pBAD vector using primers Bgl_F and Bgl_R and then cloned into the Geobacillus expression vector pUCG3.8 [ ], digested with SmaI , utilizing NEB Gibson Mastermix® to create pUCG3.8Bgl. pduAB deletion plasmid: for the ‘start region’, a 600 bp region was PCR-amplified from pduA bp 1 to pduB bp 311 using Pdu-start_F and Pdu-start_R primers, and then cloned into a ZraI digested pUCG3.8Bgl vector using the NEB Gibson Mastermix® 140 bp upstream of the kanamycin resistance gene, creating pUCG3.8Bgl+start.

    Negative Control:

    Article Title: A direct regulatory link between microRNA-137 and SHANK2: implications for neuropsychiatric disorders
    Article Snippet: PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany). .. PCR primers introduced the restriction sites (XhoI) which were used to introduce the PCR product into the psiCHECK™-2 vector via Gibson® Assembly (New England BioLabs, Frankfurt, Germany).

    Recombinant:

    Article Title: Spectral properties of bacteriophytochrome AM1_5894 in the chlorophyll d-containing cyanobacterium Acaryochloris marina
    Article Snippet: Paragraph title: Expression and purification of recombinant Amr BphP ... The underlined 3′ sequences correspond to pET15b sequences, which allowed assembly of the PCR product into pET15b, using a Gibson Assembly® master mix (New England Biolabs).

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. Plasmid clones of each mutagenic Crz1 allele were sequenced to ensure they contained the mutations.

    Agarose Gel Electrophoresis:

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: The library vector sgLenti was preapred by restriction digest with AarI (Thermo-Fischer) at 37C overnight, followed by 1% agarose gel excision of the digested band and purification via NucleoSpin columns (Macherey-Nagel). .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Size-exclusion Chromatography:

    Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks
    Article Snippet: Template pools were PCR amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific) according to the manufacturers protocol with 1 ng/uL sgRNA template DNA, 1 uM forward primer (5′-GGAGAACCACCTTGTTGG-3′), 1 uM reverse primer (5′-GTTTCCAGCATAGCTCTTAAAC-3′) and the following cycle numbers: 1x (98C for 3 min), 15x (98C for 1 sec, 55C for 15 sec, 72C for 20 sec) and 1x (72C for 5 min). .. Using Gibson Assmbly Master Mix (NEB), 1000 ng digested sgLenti and 100 ng amplified sgRNA library insert were assembled in a total 200 uL reaction volume.

    Selection:

    Article Title: Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase
    Article Snippet: For EpCAM, a selection of twelve unique guide RNA binding sites was chosen to cover the region with 100–200 bp in between the gRNAs (shown in ). .. The gRNA plasmids were synthesized using overlapping ssDNA oligonucleotides which were cloned into the empty gRNA plasmid (Addgene plasmid # 41824) ( ) using Gibson Assembly® Master Mix (NEB) following the manufacturer protocol.

    Article Title: Simplified Footprint-Free Cas9/CRISPR Editing of Cardiac-Associated Genes in Human Pluripotent Stem Cells
    Article Snippet: Overlapping fragments were produced by polymerase chain reaction (PCR) (GoTaq polymerase; Promega) for three inserts: Dual drug selection cassette (Puro-ΔTK) flanked by PiggyBac recombination sites and the left and right homology regions for ADRB2 (∼1 kb upstream and ∼1 kb downstream of the locus cut site). .. A 20 μL reaction containing 0.24 pmol of each insert, 0.08 pM of Bluescript backbone, and 1 × Gibson Assembly® Master Mix (NEB) was heated at 50°C for 60 min.

    Article Title: Increasing the performance of pooled CRISPR–Cas9 drop-out screening
    Article Snippet: An all-in-one lentivirus plasmid vector was built comprising a selection marker (puromycin resistance), the expression cassette for SpCas9 expression and the sgRNA sequence (based on pLentiCRISPRv2 ). .. Each pooled sgRNA library was cloned into either vector backbone, using a Gibson Assembly Master Mix kit (New England BioLabs, NEB #E2611S/L) in accordance with the manufacturer’s instructions.

    Knock-Out:

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. Southern hybridization with a PCR-amplified probe from within the wild-type ZHP3 sequence was used to estimate the degree of replacement of the ∼50 copies of the wild-type gene by the truncated version (Supplemental Figure S5).

    Produced:

    Article Title: Simplified Footprint-Free Cas9/CRISPR Editing of Cardiac-Associated Genes in Human Pluripotent Stem Cells
    Article Snippet: Overlapping fragments were produced by polymerase chain reaction (PCR) (GoTaq polymerase; Promega) for three inserts: Dual drug selection cassette (Puro-ΔTK) flanked by PiggyBac recombination sites and the left and right homology regions for ADRB2 (∼1 kb upstream and ∼1 kb downstream of the locus cut site). .. A 20 μL reaction containing 0.24 pmol of each insert, 0.08 pM of Bluescript backbone, and 1 × Gibson Assembly® Master Mix (NEB) was heated at 50°C for 60 min.

    Article Title: Spatial organization of the Ran pathway by microtubules in mitosis
    Article Snippet: The U2OS cell lines with RanGAP1 RNAi were produced by harnessing shRNA. .. These constructs have been previously validated ( , , , ) and TIMMA measurements indicate that they were expressed at concentrations of ∼20 nM, far below the endogenous concentrations of these proteins, which range from 100 nM to 6 μM. pEGFP-NLS(HSET) was created by amplifying NLS (AAGAGGAGGCCTGACCAGATGGAAGATGGCCTGGAGCCTGAGAAGAAACGG)-containing sequence from the pEGFP-HSET plasmid and cloned into a linearized vector fragment prepared from the pEGFP-HSET plasmid by Gibson assembly protocol (E2611S, Gibson assembly master mix; New England Biolabs).

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany).

    Concentration Assay:

    Article Title: Dynamic regulation of Nanog and stem cell-signaling pathways by Hoxa1 during early neuro-ectodermal differentiation of ES cells
    Article Snippet: PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs). .. PCR-purified putative enhancer elements were cloned into the HLC vector ( ) using the Gibson Assembly Master Mix kit (New England Biolabs).

    Marker:

    Article Title: Increasing the performance of pooled CRISPR–Cas9 drop-out screening
    Article Snippet: An all-in-one lentivirus plasmid vector was built comprising a selection marker (puromycin resistance), the expression cassette for SpCas9 expression and the sgRNA sequence (based on pLentiCRISPRv2 ). .. Each pooled sgRNA library was cloned into either vector backbone, using a Gibson Assembly Master Mix kit (New England BioLabs, NEB #E2611S/L) in accordance with the manufacturer’s instructions.

    Article Title: A Zip3-like protein plays a role in crossover formation in the SC-less meiosis of the protist Tetrahymena
    Article Snippet: For ZHP3 gene knockout, a plasmid comprising a pBluescript (Agilent Technologies, Santa Clara, CA) backbone and two ∼500–base pair fragments from either side of the ZHP3 open reading frame (ORF; TTHERM_00049220) surrounding the NEO4 resistance gene under the control of a Cd2+ -inducible MTT1 metallothionein promoter was constructed using the Gibson DNA assembly system (New England Biolabs, Frankfurt, Germany). .. Southern hybridization with a PCR-amplified probe from within the wild-type ZHP3 sequence was used to estimate the degree of replacement of the ∼50 copies of the wild-type gene by the truncated version (Supplemental Figure S5).

    Positron Emission Tomography:

    Article Title: Differential Regulation of Duplicate Light-Dependent Protochlorophyllide Oxidoreductases in the Diatom Phaeodactylum tricornutum
    Article Snippet: The pET-15-HE vector (obtained from Dr. Stoddard, Seattle Children’s Hospital, Seattle, WA) was digested by incubation at 37°C for 2h in a 40μL reaction containing 3μg vector, 7.5U each of NcoI, NotI enzymes and 1X NE Buffer 3 (New England Biolabs). .. Digested vector (50ng) and either por 1 or por 2 PCR inserts (50ng) at a ratio of ~1M vector:3M insert were incubated with 20μL Gibson Assembly MasterMix (New England Biolabs) at 50°C for 1h.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs gibson assembly master mix
    Gibson Assembly Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gibson assembly master mix/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    gibson assembly master mix - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs gibson assembly kit
    Gibson Assembly Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gibson assembly kit/product/New England Biolabs
    Average 99 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    gibson assembly kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results