hi scribe t7 transcription kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    Name:
    HiScribe T7 High Yield RNA Synthesis Kit
    Description:

    Catalog Number:
    E2040S
    Price:
    None
    Buy from Supplier


    Structured Review

    New England Biolabs hi scribe t7 transcription kit

    https://www.bioz.com/result/hi scribe t7 transcription kit/product/New England Biolabs
    Average 84 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 transcription kit - by Bioz Stars, 2019-09
    84/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. Electroporation conditions used were 1500V, 30ms, 1 pulse for HEK293 and 1350V, 35ms, 1 pulse for MOLM13, OCI-AMl2, and OCI-AML3.

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: To facilitate sequence analysis, PCR products were cloned into pENTR/D-TOPO vectors prior to sequencing. .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Amplification:

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions. .. Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions.

    Article Title: Single-cell gene expression reveals a landscape of regulatory T cell phenotypes shaped by the TCR
    Article Snippet: After purification of the DNA/RNA duplex with 1.2X AMPure beads (Beckman), second-strand cDNA synthesis was performed (NEB) for 2.5 h at 16°C. .. The library was then amplified using T7 in vitro transcription for 15h at 37°C (HiScribe T7 High Yield RNA Synthesis Kit, NEB). .. After purification, half of the amplified RNA was used for further processing.

    Article Title: Disabling Cas9 by an anti-CRISPR DNA mimic
    Article Snippet: A substrate template for T7 RNA polymerase was assembled by PCR with Phusion High-Fidelity DNA polymerase (NEB) from a variable 57- to 59-nucleotide (nt) primer containing the T7 promoter, variable sgRNA guide sequence, and the first 15 nt of the nonvariable region of the sgRNA (T7FwdVar primers, 10 nM; table S2) and an 83-nt primer containing the reverse complement of the invariant region of the sgRNA (T7RevLong, 10 nM), along with amplification primers (T7FwdAmp and T7RevAmp, 200 nM each). .. Assembled template was used as a substrate for IVT by T7 RNA polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: The plasmid vectors described above were used as a template for PCR amplification together with forward primers incorporating T7 promoter sequences and a universal reverse primer (see ). .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Filtration:

    Article Title: Single-cell gene expression reveals a landscape of regulatory T cell phenotypes shaped by the TCR
    Article Snippet: Excess primers and hydrogels beads were removed by filtration through a nucleic acid purification column and enzyme digestion (ExoI, HinfI). .. The library was then amplified using T7 in vitro transcription for 15h at 37°C (HiScribe T7 High Yield RNA Synthesis Kit, NEB).

    Synthesized:

    Article Title: Controllable molecular motors engineered from myosin and RNA
    Article Snippet: To prepare for run-off transcription, ktL and ktRS plasmids were linearized using PstI, phenol/chloroform extracted, ethanol precipitated, dried down on a vacuum concentrator, and reconstituted in water or 1X TE buffer. .. RNA was synthesized from these templates using the NEB HiScribe T7 High Yield RNA Synthesis Kit, following standard kit protocols, using .025 μg/μl of linearized template along with the high molecular weight mix provided with the kit, in a 100 μl reaction volume. .. Reactions were incubated for 3 to 4 hours at 37 C, ethanol precipitated, dried down on a vacuum concentrator, and gel purified on 8 % denaturing PAGE gels containing 8M Urea and 1X TBE.

    Article Title: Homozygous frameshift mutations in FAT1 cause a syndrome characterized by colobomatous-microphthalmia, ptosis, nephropathy and syndactyly
    Article Snippet: The oligonucleotides containing T7 promoter, target, guide RNA scaffold, and termination signal sequences were purchased from IDT (Coralville, IA) in the form of gBlocks® fragments. .. Guide RNA were synthesized in vitro by driving transcription mediated by T7 promoter using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA). .. For targeting the cytoplasmic tail of zebrafish fat1a , ~1 nL of in vitro synthesized guide RNA (200 ng/µL) and Cas9 protein (500 ng/µL) were injected in one-cell stage embryos (F0 embryos).

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: We generated the PPM1D mutant cell lines in MOLM13, HEK293, OCI-AML2, and OCI-AML3 using the RNP-based CRISPR/Cas9 delivery method, and sgRNAs were synthesized as previously described ( , ). .. For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: gRNA was synthesized by assembly PCR and in vitro transcription as previously described [ ]. .. Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions.

    Article Title: Disabling Cas9 by an anti-CRISPR DNA mimic
    Article Snippet: Briefly, sgRNA was synthesized by assembly polymerase chain reaction (PCR) and in vitro transcription (IVT). .. Assembled template was used as a substrate for IVT by T7 RNA polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: The plasmids expressing various transgenes were transfected with Effectene transfection reagent (Qiagen, Cat No-301425), following manufacturer’s protocol. .. For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago. .. For knockdown of other pre-EJC components and Btz, the treatment was repeated two times and cells were harvested 5 days after the first treatment.

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: Drosophila S2R+ cells were cultured at 25 °C in Schneider’s Drosophila Medium (GIBCO, Cat-No 21720) supplemented with 10% FBS and 2% penicillin/streptomycin. .. For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment. .. Primer sequences to amplify dsRNA templates are listed in Supplementary Table .

    Blocking Assay:

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago. .. For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago.

    Incubation:

    Article Title: Disabling Cas9 by an anti-CRISPR DNA mimic
    Article Snippet: Assembled template was used as a substrate for IVT by T7 RNA polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. Thirty picomoles of Cas9-NLS (nuclear localization sequence) (UC Berkeley QB3 MacroLab, Berkeley, CA) was mixed slowly into Cas9 buffer [20 mM Hepes (pH 7.5), 150 mM KCl, 1 mM MgCl2 , 10% glycerol, and 1 mM tris(2-carboxyethyl)phosphine] containing 36 pmol of sgRNA.

    Article Title: NmeCas9 is an intrinsically high-fidelity genome-editing platform
    Article Snippet: PCR reactions were performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the following thermal cycling conditions: 98 °C for 2 min, 30 cycles of 20 s at 98 °C, 20 s at 52 °C, 15 s at 72 °C, and a final extension at 72 °C for 2 min. sgRNAs were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol. .. Transcription reactions were digested with 2 units RNase-free DNase I (New England Biolabs) at 37 °C for 10 min; the reaction was stopped by adding EDTA to a final concentration of 35 mM and incubating at 75 °C for 10 min. All guides were purified with RNAClean beads (Beckman Coulter) and quantified with the Quant-IT Ribogreen RNA Assay kit (ThermoFisher) according to the manufacturers’ protocols.

    Stripping Membranes:

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: Briefly, prepare the following reaction mixture in an RNase-free 8-well PCR strip tube, and mix the reagents by gentle pipetting. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit.

    Expressing:

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Unless stated explicitly, the plasmid concentrations used for transfection were as follows: For pRNAe and plasmid expressing target gene co-transfection, 0.2 μg expression plasmid and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates; for the expression of the light-chain and heavy-chain of anti-HIV antibody 10E8, 0.2 μg of each and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates. .. RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK).

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: The plasmids expressing various transgenes were transfected with Effectene transfection reagent (Qiagen, Cat No-301425), following manufacturer’s protocol. .. For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago.

    Western Blot:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions. .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Electroporation:

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. The in vitro transcription products were purified using the RNA Clean & Concentrator-25 and eluted in nuclease-free water, following the manufacturer’s instructions.

    Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA
    Article Snippet: Paragraph title: RNA electroporation ... 5′ triphosphate RNAs were generated as described above using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and specific primers for sfRNA (forward: 5′ GATAATACGACTCACTATAGGGT GTTGTCAGGCCTGCTAGTCAGCCACAGC 3′; reverse: 5′ AGAAACCATGGATTTCCCCACACCGGCCGCCGCT 3′) and the DBSLIII mutant (forward: 5′ GATAATACGACTCACTATAGGGCCCCTCAGAGGACACTGAGTCAAAAAA 3′).

    Transfection:

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. The in vitro transcription products were purified using the RNA Clean & Concentrator-25 and eluted in nuclease-free water, following the manufacturer’s instructions.

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: For pRNAe-Plus experiments, the amount of pRNAe-Plus plasmid was as listed in the figure, while the total DNA amount per well was kept constant by supplementing to 1.5 μg with an appropriate amount of pRNAe-Mock plasmid. .. RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK). .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: The plasmids expressing various transgenes were transfected with Effectene transfection reagent (Qiagen, Cat No-301425), following manufacturer’s protocol. .. For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago. .. For knockdown of other pre-EJC components and Btz, the treatment was repeated two times and cells were harvested 5 days after the first treatment.

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: Drosophila S2R+ cells were cultured at 25 °C in Schneider’s Drosophila Medium (GIBCO, Cat-No 21720) supplemented with 10% FBS and 2% penicillin/streptomycin. .. For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment. .. Primer sequences to amplify dsRNA templates are listed in Supplementary Table .

    Cell Culture:

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: Paragraph title: Cell culture, RNAi, and transfection ... For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago.

    Article Title: NmeCas9 is an intrinsically high-fidelity genome-editing platform
    Article Snippet: In 50-mL conical tubes, high molecular weight genomic DNA (gDNA) was extracted from HEK293T cells using the Blood and Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s protocol. sgRNAs for both NmeCas9 and SpyCas9 RNP assembly were transcribed from PCR-assembled DNA templates containing T7 promoters. .. PCR reactions were performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the following thermal cycling conditions: 98 °C for 2 min, 30 cycles of 20 s at 98 °C, 20 s at 52 °C, 15 s at 72 °C, and a final extension at 72 °C for 2 min. sgRNAs were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol.

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: Paragraph title: Cell culture ... For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment.

    Generated:

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: Briefly, prepare the following reaction mixture in an RNase-free 8-well PCR strip tube, and mix the reagents by gentle pipetting. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit. .. The in vitro transcription reaction is highly sensitive to RNase contamination.

    Article Title: RIG-I like receptor sensing of host RNAs facilitates the cell-intrinsic immune response to KSHV infection
    Article Snippet: vtRNA in vitro transcription templates were generated by overlapping PCR of two DNA oligonucleotides (Supplementary Table ). .. In vitro transcription was carried out at 37 °C overnight using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), followed by DNase I digestion.

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: We generated the PPM1D mutant cell lines in MOLM13, HEK293, OCI-AML2, and OCI-AML3 using the RNP-based CRISPR/Cas9 delivery method, and sgRNAs were synthesized as previously described ( , ). .. For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: HCV PAMP in vitro transcription template [ ] was generated by annealing HCV fwd and rev (5 μM each) oligos ( ). .. In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs).

    Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA
    Article Snippet: After incubation, beads were washed four times with NT2 buffer and processed for WB and RNA isolation as in the RIP for HeLa cells. qPCR was performed using ZIKV ORF primers described above and specific primers that amplify ZIKV 3′ UTR (nucleotides 10623 to 10722 of ZIKV-Cambodia: forward 5′ CCTGAACTGGAGATCAGCTGTG 3′; reverse 5′ GGTCTTTCCCAGCGTCAATA 3′). .. 5′ triphosphate RNAs were generated as described above using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and specific primers for sfRNA (forward: 5′ GATAATACGACTCACTATAGGGT GTTGTCAGGCCTGCTAGTCAGCCACAGC 3′; reverse: 5′ AGAAACCATGGATTTCCCCACACCGGCCGCCGCT 3′) and the DBSLIII mutant (forward: 5′ GATAATACGACTCACTATAGGGCCCCTCAGAGGACACTGAGTCAAAAAA 3′). .. 5′ monophosphate RNAs were by generated by synthesis of capped RNAs followed by treatment with Tobacco Acid Pyrophosphatase (Thermo Fisher Scientific).

    Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
    Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. Next, a 100 μL in vitro transcription reaction was carried out using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: Briefly, prepare the following reaction mixture in an RNase-free 8-well PCR strip tube, and mix the reagents by gentle pipetting. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit.

    Article Title: RIG-I like receptor sensing of host RNAs facilitates the cell-intrinsic immune response to KSHV infection
    Article Snippet: vtRNA in vitro transcription templates were generated by overlapping PCR of two DNA oligonucleotides (Supplementary Table ). .. In vitro transcription was carried out at 37 °C overnight using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), followed by DNase I digestion.

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: We selected a pair of sgRNAs that creates an out-of-frame deletion in exon 6 (guide sequences from 5′ to 3′ are GGGTCCTTAGAATTCACCCT and GGAAGGCATTGCTACGAACC). .. For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. The in vitro transcription products were purified using the RNA Clean & Concentrator-25 and eluted in nuclease-free water, following the manufacturer’s instructions.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions. .. Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions.

    Article Title: Single-cell gene expression reveals a landscape of regulatory T cell phenotypes shaped by the TCR
    Article Snippet: The library was then amplified using T7 in vitro transcription for 15h at 37°C (HiScribe T7 High Yield RNA Synthesis Kit, NEB). .. The library was then amplified using T7 in vitro transcription for 15h at 37°C (HiScribe T7 High Yield RNA Synthesis Kit, NEB).

    Article Title: Disabling Cas9 by an anti-CRISPR DNA mimic
    Article Snippet: A substrate template for T7 RNA polymerase was assembled by PCR with Phusion High-Fidelity DNA polymerase (NEB) from a variable 57- to 59-nucleotide (nt) primer containing the T7 promoter, variable sgRNA guide sequence, and the first 15 nt of the nonvariable region of the sgRNA (T7FwdVar primers, 10 nM; table S2) and an 83-nt primer containing the reverse complement of the invariant region of the sgRNA (T7RevLong, 10 nM), along with amplification primers (T7FwdAmp and T7RevAmp, 200 nM each). .. Assembled template was used as a substrate for IVT by T7 RNA polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: The plasmid vectors described above were used as a template for PCR amplification together with forward primers incorporating T7 promoter sequences and a universal reverse primer (see ). .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
    Article Snippet: The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo Research) following the manufacturer’s instructions. .. Next, a 100 μL in vitro transcription reaction was carried out using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs).

    Article Title: NmeCas9 is an intrinsically high-fidelity genome-editing platform
    Article Snippet: Oligo sequences used in DNA template assembly can be found in Additional file : Table S8. .. PCR reactions were performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the following thermal cycling conditions: 98 °C for 2 min, 30 cycles of 20 s at 98 °C, 20 s at 52 °C, 15 s at 72 °C, and a final extension at 72 °C for 2 min. sgRNAs were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol. .. Transcription reactions were digested with 2 units RNase-free DNase I (New England Biolabs) at 37 °C for 10 min; the reaction was stopped by adding EDTA to a final concentration of 35 mM and incubating at 75 °C for 10 min. All guides were purified with RNAClean beads (Beckman Coulter) and quantified with the Quant-IT Ribogreen RNA Assay kit (ThermoFisher) according to the manufacturers’ protocols.

    Injection:

    Article Title: Homozygous frameshift mutations in FAT1 cause a syndrome characterized by colobomatous-microphthalmia, ptosis, nephropathy and syndactyly
    Article Snippet: The zebrafish fat4 morpholino (CCGGGTTTTCCCGAGCCTCATACAT) which has been previously reported , and the injection control morpholino (CCTCTTACCTCAGTTACAATTTATA), were used as described above for the fat1a morpholino. .. Guide RNA were synthesized in vitro by driving transcription mediated by T7 promoter using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA).

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: Cytoplasmic zygotic injection of wild-type Cas9 mRNA together with in vitro transcribed gRNAs was used to generate Itpa -null mouse embryos. .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Nucleic Acid Purification:

    Article Title: Single-cell gene expression reveals a landscape of regulatory T cell phenotypes shaped by the TCR
    Article Snippet: Excess primers and hydrogels beads were removed by filtration through a nucleic acid purification column and enzyme digestion (ExoI, HinfI). .. The library was then amplified using T7 in vitro transcription for 15h at 37°C (HiScribe T7 High Yield RNA Synthesis Kit, NEB).

    Molecular Weight:

    Article Title: Controllable molecular motors engineered from myosin and RNA
    Article Snippet: To prepare for run-off transcription, ktL and ktRS plasmids were linearized using PstI, phenol/chloroform extracted, ethanol precipitated, dried down on a vacuum concentrator, and reconstituted in water or 1X TE buffer. .. RNA was synthesized from these templates using the NEB HiScribe T7 High Yield RNA Synthesis Kit, following standard kit protocols, using .025 μg/μl of linearized template along with the high molecular weight mix provided with the kit, in a 100 μl reaction volume. .. Reactions were incubated for 3 to 4 hours at 37 C, ethanol precipitated, dried down on a vacuum concentrator, and gel purified on 8 % denaturing PAGE gels containing 8M Urea and 1X TBE.

    Article Title: NmeCas9 is an intrinsically high-fidelity genome-editing platform
    Article Snippet: In 50-mL conical tubes, high molecular weight genomic DNA (gDNA) was extracted from HEK293T cells using the Blood and Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s protocol. sgRNAs for both NmeCas9 and SpyCas9 RNP assembly were transcribed from PCR-assembled DNA templates containing T7 promoters. .. PCR reactions were performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the following thermal cycling conditions: 98 °C for 2 min, 30 cycles of 20 s at 98 °C, 20 s at 52 °C, 15 s at 72 °C, and a final extension at 72 °C for 2 min. sgRNAs were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol.

    Mutagenesis:

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: Paragraph title: Generation of PPM1D mutant cell lines ... For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol.

    Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA
    Article Snippet: After incubation, beads were washed four times with NT2 buffer and processed for WB and RNA isolation as in the RIP for HeLa cells. qPCR was performed using ZIKV ORF primers described above and specific primers that amplify ZIKV 3′ UTR (nucleotides 10623 to 10722 of ZIKV-Cambodia: forward 5′ CCTGAACTGGAGATCAGCTGTG 3′; reverse 5′ GGTCTTTCCCAGCGTCAATA 3′). .. 5′ triphosphate RNAs were generated as described above using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and specific primers for sfRNA (forward: 5′ GATAATACGACTCACTATAGGGT GTTGTCAGGCCTGCTAGTCAGCCACAGC 3′; reverse: 5′ AGAAACCATGGATTTCCCCACACCGGCCGCCGCT 3′) and the DBSLIII mutant (forward: 5′ GATAATACGACTCACTATAGGGCCCCTCAGAGGACACTGAGTCAAAAAA 3′). .. 5′ monophosphate RNAs were by generated by synthesis of capped RNAs followed by treatment with Tobacco Acid Pyrophosphatase (Thermo Fisher Scientific).

    Isolation:

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. Electroporation conditions used were 1500V, 30ms, 1 pulse for HEK293 and 1350V, 35ms, 1 pulse for MOLM13, OCI-AMl2, and OCI-AML3.

    Purification:

    Article Title: Controllable molecular motors engineered from myosin and RNA
    Article Snippet: Paragraph title: Transcription and RNA purification ... RNA was synthesized from these templates using the NEB HiScribe T7 High Yield RNA Synthesis Kit, following standard kit protocols, using .025 μg/μl of linearized template along with the high molecular weight mix provided with the kit, in a 100 μl reaction volume.

    Article Title: RIG-I like receptor sensing of host RNAs facilitates the cell-intrinsic immune response to KSHV infection
    Article Snippet: In vitro transcription was carried out at 37 °C overnight using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), followed by DNase I digestion. .. In vitro transcription reactions were purified using Biospin 6 columns (BioRad) and fractionated on 7 M urea 8% polyacrylamide gels.

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: We selected a pair of sgRNAs that creates an out-of-frame deletion in exon 6 (guide sequences from 5′ to 3′ are GGGTCCTTAGAATTCACCCT and GGAAGGCATTGCTACGAACC). .. For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. The in vitro transcription products were purified using the RNA Clean & Concentrator-25 and eluted in nuclease-free water, following the manufacturer’s instructions.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the SeV DI is highlighted in boldface.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Phusion high-fidelity DNA polymerase was used for assembly (New England Biolabs). .. Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions. .. Resulting transcription reactions were treated with DNAse I (New England Biolabs), and RNA was purified by treatment with a 5X volume of homemade SPRI beads (comparable to Beckman-Coulter AMPure beads) and elution in RNAse-free water.

    Article Title: Single-cell gene expression reveals a landscape of regulatory T cell phenotypes shaped by the TCR
    Article Snippet: After purification of the DNA/RNA duplex with 1.2X AMPure beads (Beckman), second-strand cDNA synthesis was performed (NEB) for 2.5 h at 16°C. .. The library was then amplified using T7 in vitro transcription for 15h at 37°C (HiScribe T7 High Yield RNA Synthesis Kit, NEB).

    Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA
    Article Snippet: 5′ triphosphate RNAs were generated as described above using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and specific primers for sfRNA (forward: 5′ GATAATACGACTCACTATAGGGT GTTGTCAGGCCTGCTAGTCAGCCACAGC 3′; reverse: 5′ AGAAACCATGGATTTCCCCACACCGGCCGCCGCT 3′) and the DBSLIII mutant (forward: 5′ GATAATACGACTCACTATAGGGCCCCTCAGAGGACACTGAGTCAAAAAA 3′). .. 5′ triphosphate RNAs were generated as described above using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) and specific primers for sfRNA (forward: 5′ GATAATACGACTCACTATAGGGT GTTGTCAGGCCTGCTAGTCAGCCACAGC 3′; reverse: 5′ AGAAACCATGGATTTCCCCACACCGGCCGCCGCT 3′) and the DBSLIII mutant (forward: 5′ GATAATACGACTCACTATAGGGCCCCTCAGAGGACACTGAGTCAAAAAA 3′).

    Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
    Article Snippet: The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo Research) following the manufacturer’s instructions. .. Next, a 100 μL in vitro transcription reaction was carried out using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs).

    Sequencing:

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Briefly, a T7 RNA polymerase substrate template was assembled by PCR from a variable 58–59 nt primer containing T7 promoter, variable gRNA guide sequence, the first 15 nt of the nonvariable region of the gRNA (T7FwdVar primers, 10 nM, and Tables for gRNA sequences), and an 83 nt primer containing the reverse complement of the invariant region of the gRNA (T7RevLong, 10 nM), along with amplification primers (T7FwdAmp, T7RevAmp, 200 nM each). .. Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions.

    Article Title: Disabling Cas9 by an anti-CRISPR DNA mimic
    Article Snippet: A substrate template for T7 RNA polymerase was assembled by PCR with Phusion High-Fidelity DNA polymerase (NEB) from a variable 57- to 59-nucleotide (nt) primer containing the T7 promoter, variable sgRNA guide sequence, and the first 15 nt of the nonvariable region of the sgRNA (T7FwdVar primers, 10 nM; table S2) and an 83-nt primer containing the reverse complement of the invariant region of the sgRNA (T7RevLong, 10 nM), along with amplification primers (T7FwdAmp and T7RevAmp, 200 nM each). .. Assembled template was used as a substrate for IVT by T7 RNA polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: To facilitate sequence analysis, PCR products were cloned into pENTR/D-TOPO vectors prior to sequencing. .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Article Title: Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast
    Article Snippet: Only high quality CRISPR guide sequences were considered for use. .. As an in-vitro transcription kit (New England BioLabs, cat. number # E2040S) based on the T7 RNA polymerase was later used, the CRISPR guide sequence had to conform to the rules governing efficient and precise initiation of the T7 promoter. .. Hence, the CRISPR guide must start with a ‘G’ (guanine), followed by a purine (G/A), with ‘G’ being significantly more preferred, and finally followed by an optional third ‘G’ ( ).

    Cotransfection:

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Unless stated explicitly, the plasmid concentrations used for transfection were as follows: For pRNAe and plasmid expressing target gene co-transfection, 0.2 μg expression plasmid and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates; for the expression of the light-chain and heavy-chain of anti-HIV antibody 10E8, 0.2 μg of each and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates. .. RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK).

    CRISPR:

    Article Title: Homozygous frameshift mutations in FAT1 cause a syndrome characterized by colobomatous-microphthalmia, ptosis, nephropathy and syndactyly
    Article Snippet: CRISPR targets and primers spanning the targets were selected using the online tool CHOPCHOP . .. Guide RNA were synthesized in vitro by driving transcription mediated by T7 promoter using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA).

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: We generated the PPM1D mutant cell lines in MOLM13, HEK293, OCI-AML2, and OCI-AML3 using the RNP-based CRISPR/Cas9 delivery method, and sgRNAs were synthesized as previously described ( , ). .. For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol.

    Article Title: Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast
    Article Snippet: Only high quality CRISPR guide sequences were considered for use. .. As an in-vitro transcription kit (New England BioLabs, cat. number # E2040S) based on the T7 RNA polymerase was later used, the CRISPR guide sequence had to conform to the rules governing efficient and precise initiation of the T7 promoter. .. Hence, the CRISPR guide must start with a ‘G’ (guanine), followed by a purine (G/A), with ‘G’ being significantly more preferred, and finally followed by an optional third ‘G’ ( ).

    Article Title: Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast
    Article Snippet: The column was then spun at 14 000 rpm to elute the minigene DNA solution. .. Next, between 60 ng and 100 ng of minigene DNA was used as a template to transcribe CRISPR gRNA, using an in-vitro transcription kit (New England BioLabs, cat. number # E2040S). .. The buffer composition was: 2 μl ATP (100 mM), 2 μl GTP (100 mM), 2 μl CTP (100 mM), 2 μl UTP (100 mM), 2 μl reaction buffer, 2 μl T7 RNA polymerase mix, 5 μl minigene template, 10 μl RNAse/DNAse free water.

    IA:

    Article Title: Homozygous frameshift mutations in FAT1 cause a syndrome characterized by colobomatous-microphthalmia, ptosis, nephropathy and syndactyly
    Article Snippet: The oligonucleotides containing T7 promoter, target, guide RNA scaffold, and termination signal sequences were purchased from IDT (Coralville, IA) in the form of gBlocks® fragments. .. Guide RNA were synthesized in vitro by driving transcription mediated by T7 promoter using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: Drosophila S2R+ cells were cultured at 25 °C in Schneider’s Drosophila Medium (GIBCO, Cat-No 21720) supplemented with 10% FBS and 2% penicillin/streptomycin. .. For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment. .. Primer sequences to amplify dsRNA templates are listed in Supplementary Table .

    Polymerase Cycling Assembly:

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: gRNA was synthesized by assembly PCR and in vitro transcription as previously described [ ]. .. Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions.

    Plasmid Preparation:

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York. .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: For pRNAe-Plus experiments, the amount of pRNAe-Plus plasmid was as listed in the figure, while the total DNA amount per well was kept constant by supplementing to 1.5 μg with an appropriate amount of pRNAe-Mock plasmid. .. RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK).

    Article Title: Disabling Cas9 by an anti-CRISPR DNA mimic
    Article Snippet: Assembled template was used as a substrate for IVT by T7 RNA polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB). .. The resulting 5-μl mixture was incubated for 10 min to allow RNP formation.

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: The plasmid vectors described above were used as a template for PCR amplification together with forward primers incorporating T7 promoter sequences and a universal reverse primer (see ). .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Negative Control:

    Article Title: NmeCas9 is an intrinsically high-fidelity genome-editing platform
    Article Snippet: PCR reactions were performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the following thermal cycling conditions: 98 °C for 2 min, 30 cycles of 20 s at 98 °C, 20 s at 52 °C, 15 s at 72 °C, and a final extension at 72 °C for 2 min. sgRNAs were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol. .. PCR reactions were performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the following thermal cycling conditions: 98 °C for 2 min, 30 cycles of 20 s at 98 °C, 20 s at 52 °C, 15 s at 72 °C, and a final extension at 72 °C for 2 min. sgRNAs were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol.

    Agarose Gel Electrophoresis:

    Article Title: Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast
    Article Snippet: Next, between 60 ng and 100 ng of minigene DNA was used as a template to transcribe CRISPR gRNA, using an in-vitro transcription kit (New England BioLabs, cat. number # E2040S). .. Next, between 60 ng and 100 ng of minigene DNA was used as a template to transcribe CRISPR gRNA, using an in-vitro transcription kit (New England BioLabs, cat. number # E2040S).

    Article Title: hnRNPK Recruits PCGF3/5-PRC1 to the Xist RNA B-Repeat to Establish Polycomb-Mediated Chromosomal Silencing
    Article Snippet: 1 μg of DNA was in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB), according to the manufacturer’s guidelines. .. In the reaction 1 μL of Biotin-16-dUTP (Sigma) was added, at a concentration of 50 μM.

    In Vitro:

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology
    Article Snippet: For T7 in vitro transcription, follow manufacturer’s instructions. .. All components except DNA template (generated in Step 3) are provided by the NEB HiScribe T7 high yield RNA synthesis kit.

    Article Title: Homozygous frameshift mutations in FAT1 cause a syndrome characterized by colobomatous-microphthalmia, ptosis, nephropathy and syndactyly
    Article Snippet: The oligonucleotides containing T7 promoter, target, guide RNA scaffold, and termination signal sequences were purchased from IDT (Coralville, IA) in the form of gBlocks® fragments. .. Guide RNA were synthesized in vitro by driving transcription mediated by T7 promoter using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA). .. For targeting the cytoplasmic tail of zebrafish fat1a , ~1 nL of in vitro synthesized guide RNA (200 ng/µL) and Cas9 protein (500 ng/µL) were injected in one-cell stage embryos (F0 embryos).

    Article Title: RIG-I like receptor sensing of host RNAs facilitates the cell-intrinsic immune response to KSHV infection
    Article Snippet: vtRNA in vitro transcription templates were generated by overlapping PCR of two DNA oligonucleotides (Supplementary Table ). .. In vitro transcription was carried out at 37 °C overnight using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs), followed by DNase I digestion. .. In vitro transcription reactions were purified using Biospin 6 columns (BioRad) and fractionated on 7 M urea 8% polyacrylamide gels.

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: We selected a pair of sgRNAs that creates an out-of-frame deletion in exon 6 (guide sequences from 5′ to 3′ are GGGTCCTTAGAATTCACCCT and GGAAGGCATTGCTACGAACC). .. For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. The in vitro transcription products were purified using the RNA Clean & Concentrator-25 and eluted in nuclease-free water, following the manufacturer’s instructions.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: HCV PAMP in vitro transcription template [ ] was generated by annealing HCV fwd and rev (5 μM each) oligos ( ). .. In the subsequent in vitro transcription reaction, 2 μl of the annealed product was used as DNA template, using HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: The plasmid containing the SeV DI RNA[ ] was a gift from Prof. Peter Palese, Icahn School of Medicine at Mount Sinai, New York. .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Phusion high-fidelity DNA polymerase was used for assembly (New England Biolabs). .. Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase, using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs) following the manufacturer’s instructions. .. Resulting transcription reactions were treated with DNAse I (New England Biolabs), and RNA was purified by treatment with a 5X volume of homemade SPRI beads (comparable to Beckman-Coulter AMPure beads) and elution in RNAse-free water.

    Article Title: Single-cell gene expression reveals a landscape of regulatory T cell phenotypes shaped by the TCR
    Article Snippet: After purification of the DNA/RNA duplex with 1.2X AMPure beads (Beckman), second-strand cDNA synthesis was performed (NEB) for 2.5 h at 16°C. .. The library was then amplified using T7 in vitro transcription for 15h at 37°C (HiScribe T7 High Yield RNA Synthesis Kit, NEB). .. After purification, half of the amplified RNA was used for further processing.

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: For pRNAe-Plus experiments, the amount of pRNAe-Plus plasmid was as listed in the figure, while the total DNA amount per well was kept constant by supplementing to 1.5 μg with an appropriate amount of pRNAe-Mock plasmid. .. RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK). .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Article Title: Disabling Cas9 by an anti-CRISPR DNA mimic
    Article Snippet: Briefly, sgRNA was synthesized by assembly polymerase chain reaction (PCR) and in vitro transcription (IVT). .. Assembled template was used as a substrate for IVT by T7 RNA polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB).

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: Cytoplasmic zygotic injection of wild-type Cas9 mRNA together with in vitro transcribed gRNAs was used to generate Itpa -null mouse embryos. .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
    Article Snippet: The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo Research) following the manufacturer’s instructions. .. Next, a 100 μL in vitro transcription reaction was carried out using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs). .. The sgRNA product was then purified on RNA Clean and Concentrator-5 columns (Zymo Research) and eluted in 15 μL of RNase-free RNA buffer (10 mM Tris pH 7.0 in DEPC-treated H2 O). sgRNA quality was examined by running 3 pg of the purified sgRNA on a 10% polyacrylamide gel containing 7 M urea (Novex TBE-urea gels, ThermoFisher Scientific).

    Article Title: NmeCas9 is an intrinsically high-fidelity genome-editing platform
    Article Snippet: Oligo sequences used in DNA template assembly can be found in Additional file : Table S8. .. PCR reactions were performed using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the following thermal cycling conditions: 98 °C for 2 min, 30 cycles of 20 s at 98 °C, 20 s at 52 °C, 15 s at 72 °C, and a final extension at 72 °C for 2 min. sgRNAs were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol. .. Transcription reactions were digested with 2 units RNase-free DNase I (New England Biolabs) at 37 °C for 10 min; the reaction was stopped by adding EDTA to a final concentration of 35 mM and incubating at 75 °C for 10 min. All guides were purified with RNAClean beads (Beckman Coulter) and quantified with the Quant-IT Ribogreen RNA Assay kit (ThermoFisher) according to the manufacturers’ protocols.

    Article Title: Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast
    Article Snippet: Only high quality CRISPR guide sequences were considered for use. .. As an in-vitro transcription kit (New England BioLabs, cat. number # E2040S) based on the T7 RNA polymerase was later used, the CRISPR guide sequence had to conform to the rules governing efficient and precise initiation of the T7 promoter. .. Hence, the CRISPR guide must start with a ‘G’ (guanine), followed by a purine (G/A), with ‘G’ being significantly more preferred, and finally followed by an optional third ‘G’ ( ).

    Article Title: Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast
    Article Snippet: The column was then spun at 14 000 rpm to elute the minigene DNA solution. .. Next, between 60 ng and 100 ng of minigene DNA was used as a template to transcribe CRISPR gRNA, using an in-vitro transcription kit (New England BioLabs, cat. number # E2040S). .. The buffer composition was: 2 μl ATP (100 mM), 2 μl GTP (100 mM), 2 μl CTP (100 mM), 2 μl UTP (100 mM), 2 μl reaction buffer, 2 μl T7 RNA polymerase mix, 5 μl minigene template, 10 μl RNAse/DNAse free water.

    Article Title: hnRNPK Recruits PCGF3/5-PRC1 to the Xist RNA B-Repeat to Establish Polycomb-Mediated Chromosomal Silencing
    Article Snippet: RNAs were transcribed from a T7 promoter, following linearization with excess of PvuI-HF (NEB). .. 1 μg of DNA was in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB), according to the manufacturer’s guidelines. .. In the reaction 1 μL of Biotin-16-dUTP (Sigma) was added, at a concentration of 50 μM.

    Transgenic Assay:

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: This approach was also used to produce heterozygous-null animals used to establish transgenic mouse lines. .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Cellular Antioxidant Activity Assay:

    Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
    Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. Next, a 100 μL in vitro transcription reaction was carried out using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs).

    CCK-8 Assay:

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK). .. RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK).

    Produced:

    Article Title: PPM1D Mutations Drive Clonal Hematopoiesis in Response to Cytotoxic Chemotherapy
    Article Snippet: We selected a pair of sgRNAs that creates an out-of-frame deletion in exon 6 (guide sequences from 5′ to 3′ are GGGTCCTTAGAATTCACCCT and GGAAGGCATTGCTACGAACC). .. For synthesis of sgRNAs, full-length DNA templates were produced by overlap PCR, and the PCR products were purified with the MinElute PCR purification kit (QIAGEN), followed by in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (NEB) per manufacturer’s protocol. .. The in vitro transcription products were purified using the RNA Clean & Concentrator-25 and eluted in nuclease-free water, following the manufacturer’s instructions.

    Article Title: ITPase deficiency causes a Martsolf-like syndrome with a lethal infantile dilated cardiomyopathy
    Article Snippet: RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions. .. RNA was synthesised using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions.

    Concentration Assay:

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK). .. RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK).

    CTG Assay:

    Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
    Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. Next, a 100 μL in vitro transcription reaction was carried out using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs).

    Staining:

    Article Title: Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast
    Article Snippet: Next, between 60 ng and 100 ng of minigene DNA was used as a template to transcribe CRISPR gRNA, using an in-vitro transcription kit (New England BioLabs, cat. number # E2040S). .. Next, between 60 ng and 100 ng of minigene DNA was used as a template to transcribe CRISPR gRNA, using an in-vitro transcription kit (New England BioLabs, cat. number # E2040S).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    New England Biolabs hi scribe t7 transcription kit
    Hi Scribe T7 Transcription Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi scribe t7 transcription kit/product/New England Biolabs
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 transcription kit - by Bioz Stars, 2019-09
    84/100 stars
      Buy from Supplier

    88
    New England Biolabs hi scribe t7 kit
    Hi Scribe T7 Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi scribe t7 kit/product/New England Biolabs
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 kit - by Bioz Stars, 2019-09
    88/100 stars
      Buy from Supplier

    99
    New England Biolabs hiscribe t7 high yield rna synthesis kit
    Hiscribe T7 High Yield Rna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiscribe t7 high yield rna synthesis kit/product/New England Biolabs
    Average 99 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    hiscribe t7 high yield rna synthesis kit - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results