hi scribe t7 transcription kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    HiScribe T7 High Yield RNA Synthesis Kit
    Description:
    HiScribe T7 High Yield RNA Synthesis Kit 50 rxns
    Catalog Number:
    e2040s
    Price:
    223
    Size:
    50 rxns
    Category:
    Transcription Kits
    Buy from Supplier


    Structured Review

    New England Biolabs hi scribe t7 transcription kit
    HiScribe T7 High Yield RNA Synthesis Kit
    HiScribe T7 High Yield RNA Synthesis Kit 50 rxns
    https://www.bioz.com/result/hi scribe t7 transcription kit/product/New England Biolabs
    Average 90 stars, based on 198 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 transcription kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). ..

    Amplification:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: The PCR amplification profile was as follows: 95 °C for 15 min, followed by six cycles at 95 °C for 20 s, 63 °C for 30 s, and 72 °C for one minute, then 28 cycles at 95 °C for 20 s, 77 °C for 30 s, and 72 °C for one minute, with a final extension at 72 °C for five minutes. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: In vitro transcription DNA templates of HHR variants were generated by PCR-mediated amplification from a pUC57 backbone (Piscataway NJ/US) using ODF98 and ODF99 (see Table ) and subsequent blunt-end restriction. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). .. AaCas12b sgRNA (AasgRNA) and SpCas9 sgRNA templates for in vitro RNA transcription were PCR amplified using primers bearing a T7 promoter (Additional file : Table S1).

    DNA Synthesis:

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: The DNA template (5′- TG AGGTGC TATA GTGAGTCGTATTAACG-3′), and its DNA complement containing the T7 promoter sequence (5′-CGTTAATACGACTCAC TATA GCACCTCA -3′), were prepared by solid-phase DNA synthesis. .. HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide.

    Synthesized:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). ..

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: .. For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment. ..

    Article Title: RAN translation at C9orf72-associated repeat expansions is selectively enhanced by the integrated stress response
    Article Snippet: Linearized DNA was in vitro transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB), with 3′-O-Me-m7 GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at eight times the concentration of GTP, for a capping efficiency of ~ 90%. .. Synthesized mRNAs were clean and concentrated with RNA Clean and Concentrator-25 Kit from Zymo Research.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol. .. The concentration of dsRNA was measured using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Proton‐independent activation of acid‐sensing ion channel 3 by an alkaloid, lindoldhamine, from Laurus nobilis) Proton‐independent activation of acid‐sensing ion channel 3 by an alkaloid, lindoldhamine, from Laurus nobilis
    Article Snippet: .. Oocytes were defolliculated and injected with 2.5–10 ng of cRNA. cRNA transcripts were synthesized from the linearized cDNA templates using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, USA) according to the protocol for capped transcripts supplied by the manufacturer. .. Human ASIC3 (hASIC3) cDNA ( ) was subcloned from EX‐Q0260‐B02 (GeneCopoeia, Inc., Rockville, USA) to pcDNA3.1 and linearized by NaeI (Promega, Madison, USA).

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: .. For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago. ..

    Construct:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: Paragraph title: Plasmid construct and in vitro transcription ... Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research).

    Incubation:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: These were then briefly centrifuged at 3000 g , resuspended in TE buffer at 10 ng µl−1 concentration and incubated at 50 ˚C for 20 min. gBlocks (200 pg per reaction) were amplified using Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and 0.5 µM of T7 tail Fw and SP6 tail Rev primers according to the manufacturer’s instructions, using the following cycling conditions: denaturation at 98 ˚C for 30 s, followed by the amplification stage consisting of 35 cycles of denaturation at 98 ˚C for 10 s, primer annealing at 65 ˚C for 30 s and an extension at 72 ˚C for 1 min. .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide. .. The reaction was initiated by addition of the polymerase solution (provided within the kit; 60 μL of polymerase solution per 1 mL of transcription reaction), and the mixture was incubated at 37 °C for 16 h in a BioRad T100 thermocycler (Hercules, CA).

    Expressing:

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: The plasmids expressing various transgenes were transfected with Effectene transfection reagent (Qiagen, Cat No-301425), following manufacturer’s protocol. .. For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago.

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Unless stated explicitly, the plasmid concentrations used for transfection were as follows: For pRNAe and plasmid expressing target gene co-transfection, 0.2 μg expression plasmid and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates; for the expression of the light-chain and heavy-chain of anti-HIV antibody 10E8, 0.2 μg of each and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates. .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Knock-In:

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: NSG-IDUAX/X mice We used CRISPR-Cas9 to knock-in the W401X mutation (UniProtKB - Q8BMG0), analogous to the W402X mutation commonly found in patients with severe MPSI, into NSG mouse embryos. .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction.

    High Performance Liquid Chromatography:

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide. .. The purified oligonucleotide was analyzed by LC–MS on an Agilent 1200 HPLC coupled to an Agilent 6230 TOF-MS equipped with an auto sampler and diode array detector.

    Transfection:

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: .. For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment. ..

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: .. For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago. ..

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Paragraph title: Cell transfection ... RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Cell Culture:

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: Paragraph title: Cell culture ... For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment.

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: Paragraph title: Cell culture, RNAi, and transfection ... For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago.

    Generated:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: The generated fragments were resolved on a 1 % agarose gel and gel-extracted using a QIAquick Gel Extraction kit (QIAgen). .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: Template RNA was generated from 10 ovaries with an RNA Isolation Kit (Thermo Fisher), and reverse transcription to cDNA was performed by the PrimeScript 1st strand cDNA synthesis kit (Takara, Japan). .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research).

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: In vitro transcription DNA templates of HHR variants were generated by PCR-mediated amplification from a pUC57 backbone (Piscataway NJ/US) using ODF98 and ODF99 (see Table ) and subsequent blunt-end restriction. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. The ssODN donor DNA contained an intended point mutation leading to a STOP codon (TGG to TAG): 5′-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA/CTCT A GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA/CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3′ (lower case is intron, upper case is exon, guide cut sites marked by “/” and the mutation in bold).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: In vitro transcription of HCV PAMP and Sendai virus DI RNA HCV PAMP in vitro transcription template [ ] was generated by annealing HCV fwd and rev (5 μM each) oligos ( ). .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs).

    DNA Sequencing:

    Article Title: Proton‐independent activation of acid‐sensing ion channel 3 by an alkaloid, lindoldhamine, from Laurus nobilis) Proton‐independent activation of acid‐sensing ion channel 3 by an alkaloid, lindoldhamine, from Laurus nobilis
    Article Snippet: Oocytes were defolliculated and injected with 2.5–10 ng of cRNA. cRNA transcripts were synthesized from the linearized cDNA templates using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, USA) according to the protocol for capped transcripts supplied by the manufacturer. .. Integrity of ASIC genes was confirmed by DNA sequencing of the entire inserted fragments.

    Sequencing:

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: A T7 promoter sequence was added, as described elsewhere [ ]. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: Blunt-end restriction using Msc I (New England Biolabs, Ipswich MA/US) resulted in a dsDNA fragment containing the promoter sequence for phage T7 RNA polymerase, the HHR-coding sequence and a 578-bp untranscribed region upstream of the promoter. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: The guide RNA target sequence was searched using crispr.mit.edu and six shortlisted guides close to the target site were first screened by using an in vivo assay in NIH 3T3 cells. .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: The DNA template (5′- TG AGGTGC TATA GTGAGTCGTATTAACG-3′), and its DNA complement containing the T7 promoter sequence (5′-CGTTAATACGACTCAC TATA GCACCTCA -3′), were prepared by solid-phase DNA synthesis. .. HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide.

    Injection:

    Article Title: Proton‐independent activation of acid‐sensing ion channel 3 by an alkaloid, lindoldhamine, from Laurus nobilis) Proton‐independent activation of acid‐sensing ion channel 3 by an alkaloid, lindoldhamine, from Laurus nobilis
    Article Snippet: .. Oocytes were defolliculated and injected with 2.5–10 ng of cRNA. cRNA transcripts were synthesized from the linearized cDNA templates using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Ipswich, USA) according to the protocol for capped transcripts supplied by the manufacturer. .. Human ASIC3 (hASIC3) cDNA ( ) was subcloned from EX‐Q0260‐B02 (GeneCopoeia, Inc., Rockville, USA) to pcDNA3.1 and linearized by NaeI (Promega, Madison, USA).

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. Female NSG mice 3–4 weeks of age (JAX Laboratories, stock number 005557) were super-ovulated by intraperitoneal injection with 2.5IU pregnant mare serum gonadotropin (National Hormone & Peptide Program, NIDDK), followed 48 hours later by injection of 2.5 IU human chorionic gonadotropin (hCG, National Hormone & Peptide Program, NIDDK).

    Nucleic Acid Electrophoresis:

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide. .. The transcribed product was extracted by DNase I digestion, RNA ethanol precipitation, and 25% polyacrylamide denaturing gel electrophoresis purification.

    In Vivo:

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: The guide RNA target sequence was searched using crispr.mit.edu and six shortlisted guides close to the target site were first screened by using an in vivo assay in NIH 3T3 cells. .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction.

    Mutagenesis:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). ..

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: NSG-IDUAX/X mice We used CRISPR-Cas9 to knock-in the W401X mutation (UniProtKB - Q8BMG0), analogous to the W402X mutation commonly found in patients with severe MPSI, into NSG mouse embryos. .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction.

    Isolation:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: Template RNA was generated from 10 ovaries with an RNA Isolation Kit (Thermo Fisher), and reverse transcription to cDNA was performed by the PrimeScript 1st strand cDNA synthesis kit (Takara, Japan). .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research).

    Labeling:

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: Cyanine 3 labeled RNA was purchased from Integrated DNA Technologies (Coralville, IA). .. HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide.

    Purification:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). ..

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: PCR products were purified by EZ-Pure™ PCR Purification Kit ver. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. Both HCV PAMP and SeV DI RNA were purified by treatment with a 5X volume of homemade SPRI beads (comparable to Beckman-Coulter AMPure beads) and elution in RNAse-free water.

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide. .. The transcribed product was extracted by DNase I digestion, RNA ethanol precipitation, and 25% polyacrylamide denaturing gel electrophoresis purification.

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: .. Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). ..

    Polymerase Chain Reaction:

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: PCR products were purified by EZ-Pure™ PCR Purification Kit ver. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: In vitro transcription DNA templates of HHR variants were generated by PCR-mediated amplification from a pUC57 backbone (Piscataway NJ/US) using ODF98 and ODF99 (see Table ) and subsequent blunt-end restriction. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. The ssODN donor DNA contained an intended point mutation leading to a STOP codon (TGG to TAG): 5′-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA/CTCT A GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA/CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3′ (lower case is intron, upper case is exon, guide cut sites marked by “/” and the mutation in bold).

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: PCR primers and ssDNA templates were listed in Additional file : Table S1. .. Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega).

    Blocking Assay:

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: For knock down experiments, dsRNA was synthesized overnight at 37 °C using Hi-Scribe T7 transcription kit (NEB, Cat No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated three times and cells were harvested 7 days after the first treatment for Mago. .. S2R+ cells were treated with 50 µg/ml of α-amanitin for 7 h to block transcription.

    Cotransfection:

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Unless stated explicitly, the plasmid concentrations used for transfection were as follows: For pRNAe and plasmid expressing target gene co-transfection, 0.2 μg expression plasmid and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates; for the expression of the light-chain and heavy-chain of anti-HIV antibody 10E8, 0.2 μg of each and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates. .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    CRISPR:

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: The guide RNA target sequence was searched using crispr.mit.edu and six shortlisted guides close to the target site were first screened by using an in vivo assay in NIH 3T3 cells. .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction.

    IA:

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: Cyanine 3 labeled RNA was purchased from Integrated DNA Technologies (Coralville, IA). .. HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, CatT111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). ..

    Article Title: Quantifying post-transcriptional regulation in the development of Drosophila melanogaster
    Article Snippet: .. For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment. ..

    Mouse Assay:

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: Paragraph title: NSG-IDUAX/X mice ... The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction.

    Plasmid Preparation:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). ..

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: For pRNAe-Plus experiments, the amount of pRNAe-Plus plasmid was as listed in the figure, while the total DNA amount per well was kept constant by supplementing to 1.5 μg with an appropriate amount of pRNAe-Mock plasmid. .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Agarose Gel Electrophoresis:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: The generated fragments were resolved on a 1 % agarose gel and gel-extracted using a QIAquick Gel Extraction kit (QIAgen). .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: PCR bands were checked with a 1% agarose gel electrophoresis. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    In Vitro:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: Paragraph title: Plasmid construct and in vitro transcription ... Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research).

    Article Title: RAN translation at C9orf72-associated repeat expansions is selectively enhanced by the integrated stress response
    Article Snippet: .. Linearized DNA was in vitro transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB), with 3′-O-Me-m7 GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at eight times the concentration of GTP, for a capping efficiency of ~ 90%. .. 10 μL T7 reactions were carried out at 37 °C for 2 h. Reactions were then treated with 2 U RNase-free DNaseI (NEB) for 15 min at 37 °C to remove DNA template, and then polyadenylated with 5 U E. coli Poly-A Polymerase, 10× buffer, and 10 mM ATP (NEB) for 1 h at 37 °C.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA). .. The composition of the reaction mix differed from the manufacturers suggestions by using 0.5x NEB transcription buffer and adding 1.25 mM EDTA as well as addition of 60 μM of a DNA 21-mer (see Table ) reverse complementary to the HHR catalytic core resulting in an optimized protocol with increased yield of cis- cleaving full-length HHRs.

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. The ssODN donor DNA contained an intended point mutation leading to a STOP codon (TGG to TAG): 5′-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA/CTCT A GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA/CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3′ (lower case is intron, upper case is exon, guide cut sites marked by “/” and the mutation in bold).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: .. HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide. .. The reaction was initiated by addition of the polymerase solution (provided within the kit; 60 μL of polymerase solution per 1 mL of transcription reaction), and the mixture was incubated at 37 °C for 16 h in a BioRad T100 thermocycler (Hercules, CA).

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK). .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: .. Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). ..

    Ethanol Precipitation:

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide. .. The transcribed product was extracted by DNase I digestion, RNA ethanol precipitation, and 25% polyacrylamide denaturing gel electrophoresis purification.

    Spectrophotometry:

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol. .. The concentration of dsRNA was measured using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

    Produced:

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA). .. Supplementary Table S1 lists all RNA oligonucleotides produced in this study.

    Concentration Assay:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: These were then briefly centrifuged at 3000 g , resuspended in TE buffer at 10 ng µl−1 concentration and incubated at 50 ˚C for 20 min. gBlocks (200 pg per reaction) were amplified using Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and 0.5 µM of T7 tail Fw and SP6 tail Rev primers according to the manufacturer’s instructions, using the following cycling conditions: denaturation at 98 ˚C for 30 s, followed by the amplification stage consisting of 35 cycles of denaturation at 98 ˚C for 10 s, primer annealing at 65 ˚C for 30 s and an extension at 72 ˚C for 1 min. .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: RAN translation at C9orf72-associated repeat expansions is selectively enhanced by the integrated stress response
    Article Snippet: .. Linearized DNA was in vitro transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB), with 3′-O-Me-m7 GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at eight times the concentration of GTP, for a capping efficiency of ~ 90%. .. 10 μL T7 reactions were carried out at 37 °C for 2 h. Reactions were then treated with 2 U RNase-free DNaseI (NEB) for 15 min at 37 °C to remove DNA template, and then polyadenylated with 5 U E. coli Poly-A Polymerase, 10× buffer, and 10 mM ATP (NEB) for 1 h at 37 °C.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol. .. The concentration of dsRNA was measured using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

    Liquid Chromatography with Mass Spectroscopy:

    Article Title: Structural Rationale for the Enhanced Catalysis of Nonenzymatic RNA Primer Extension by a Downstream Oligonucleotide
    Article Snippet: HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc.) was used for the in vitro transcription of oligonucleotides; the DNA template (0.1 mM) was transcribed in a polymerase-containing cocktail with 10 mM ATP, CTP, UTP, and ICG monomers or GpppG dinucleotide. .. The purified oligonucleotide was analyzed by LC–MS on an Agilent 1200 HPLC coupled to an Agilent 6230 TOF-MS equipped with an auto sampler and diode array detector.

    Gel Extraction:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: The generated fragments were resolved on a 1 % agarose gel and gel-extracted using a QIAquick Gel Extraction kit (QIAgen). .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs hi scribe t7 transcription kit
    Hi Scribe T7 Transcription Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi scribe t7 transcription kit/product/New England Biolabs
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 transcription kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results