q5  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Q5 Site Directed Mutagenesis Kit
    Description:
    Q5 Site Directed Mutagenesis Kit 10 rxns
    Catalog Number:
    e0554s
    Price:
    194
    Size:
    10 rxns
    Category:
    PCR Mutagenesis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs q5
    Q5 Site Directed Mutagenesis Kit
    Q5 Site Directed Mutagenesis Kit 10 rxns
    https://www.bioz.com/result/q5/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5 - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: Paragraph title: Cloning of HILPDA, ATGL, and HSL constructs ... N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs).

    Article Title: Imaging pH Dynamics Simultaneously in Two Cellular Compartments Using a Ratiometric pH-Sensitive Mutant of mCherry
    Article Snippet: pRSETb-mCherry(wt) and GW1-mCherry(wt) were mutated using the NEB Q5 site-directed mutagenesis kit to generate the mCherry(I158E/Q160A) mutant. .. Mitochondria-targeted mCherryEA was cloned by fusing a tandem 4xCoxVIII signal sequence to the N-terminus.

    Article Title: The Capsule Polymerase CslB of Neisseria meningitidis Serogroup L Catalyzes the Synthesis of a Complex Trimeric Repeating Unit Comprising Glycosidic and Phosphodiester Linkages *
    Article Snippet: Paragraph title: General Cloning ... Mutations at positions Asp138 and Asp140 in CslB were introduced in pMBP-cslB-His6 ( tac ), and mutations at positions H595, H733 in CslB were introduced in p Δ N37-cslB-His6 (tac ) using the Q5® site-directed mutagenesis kit (New England Biolabs) and the respective primers shown in according to the manufacturer's guidelines.

    Article Title: The PA3177 Gene Encodes an Active Diguanylate Cyclase That Contributes to Biofilm Antimicrobial Tolerance but Not Biofilm Formation by Pseudomonas aeruginosa
    Article Snippet: The tagged constructs were cloned into pJN105 or pMJT-1, and the vectors were subsequently introduced into P. aeruginosa . .. Site-directed mutagenesis of GGEEF domain to GGAAF domain was achieved by utilizing Q5 site-directed mutagenesis kit (NEB) according to the manufacturer's protocol.

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ). .. Both fragments were cloned into pQE30 (Qiagen) using BamHI and HindIII restriction sites introduced into the primers.

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: The PRKCA enhancer region was amplified using PCR from human genomic DNA (F: ATAAAGCTGAGTTGTCGGGC; R: TGTGCACAAACGATACTGTCA) and cloned into a Firefly Luciferase reporter vector (pGL4.23, Promega) upstream of a CMV minimal promoter. .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504).

    Amplification:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs). .. The coding sequence of mouse HSL (mHSL) was amplified by PCR from the pcDNA4/HisMaxA-mHSL construct described in ( ) using the primers listed in .

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: The ORF of P3 was amplified from cDNA with primers 3 and 4 ( ). .. A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ).

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: The PRKCA enhancer region was amplified using PCR from human genomic DNA (F: ATAAAGCTGAGTTGTCGGGC; R: TGTGCACAAACGATACTGTCA) and cloned into a Firefly Luciferase reporter vector (pGL4.23, Promega) upstream of a CMV minimal promoter. .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504).

    Synthesized:

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: Similarly, the PCR product of FgV-ch9-P3 and the synthesized genes were digested using PacI/NotI restriction sites introduced into the termini of the sequences and subsequently ligated into pBJ-1. .. A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ).

    Construct:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: Paragraph title: Cloning of HILPDA, ATGL, and HSL constructs ... N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs).

    Article Title: CRISPR RNA-dependent binding and cleavage of endogenous RNAs by the Campylobacter jejuni Cas9
    Article Snippet: The codon optimized Cas9 backbone also contained this construct, allowing for a single-vector system when utilizing this version of Cas9. .. To form the target for transcriptional repression, recognized PAM sequences were inserted into p66- lacZ using oRL29-32 using Q5 site-directed mutagenesis (NEB CN#E0554S).

    Article Title: The PA3177 Gene Encodes an Active Diguanylate Cyclase That Contributes to Biofilm Antimicrobial Tolerance but Not Biofilm Formation by Pseudomonas aeruginosa
    Article Snippet: The tagged constructs were cloned into pJN105 or pMJT-1, and the vectors were subsequently introduced into P. aeruginosa . .. Site-directed mutagenesis of GGEEF domain to GGAAF domain was achieved by utilizing Q5 site-directed mutagenesis kit (NEB) according to the manufacturer's protocol.

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: Site-directed mutagenesis was used to construct reporters for the four enhancer haplotypes using a single clone of the PRKCA enhancer region. .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504).

    Article Title: Rare variant analysis in multiply affected families, association studies and functional analysis suggest a role for the ITGΒ4 gene in schizophrenia and bipolar disorder
    Article Snippet: Paragraph title: 2.8. ITGB4 plasmid constructs ... The ITGB4 genetic variants rs147480547 allele A and rs145976111 allele T were introduced into the plasmid using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) and following the manufacturer's protocol.

    Article Title: Redefinition and Unification of the SXT/R391 Family of Integrative and Conjugative Elements
    Article Snippet: .. lacZ reporter fusions were constructed by introducing the promoter sequences of int of ICE Vpa S167 and ICE Vch 2012HC25 with primer pairs pOP-VpaS167F/pOP-VpaS167R and pOP-Vch12HCF/pOP-Vch12HCR, respectively , into the PstI restriction site of pOP lacZ using the Q5 site-directed mutagenesis kit (New England BioLabs) according to the manufacturer's instructions. .. The resulting plasmids were confirmed by restriction profiling and DNA sequencing and then integrated in single copy into the chromosomal site attB λ of E. coli BW25113 using pINT-Ts ( , ).

    Luciferase:

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: A reporter vector containing Renilla Luciferase was used as a control for cell number and transfection efficiency. .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504).

    Introduce:

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: The DNA sequences encoding mature STh and STp peptides, and STh mutants were introduced into the plasmid using appropriate primers ( ) and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, UK). .. The primers introduce the ST sequences immediately following the TEV recognition site ENLYFQ and places the first STh and STp peptide residue N1 in the TEV cleavage site P1’ position [ ].

    Expressing:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: The expression cassette was cloned into a modified pSUMO vector ( ) with a 6XHis tag and a TEV cleavage site, following the Gibson assembly cloning protocol ( ) (New England BioLabs, Ipswich, MA) using primers mentioned in . .. N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs).

    Article Title: The Capsule Polymerase CslB of Neisseria meningitidis Serogroup L Catalyzes the Synthesis of a Complex Trimeric Repeating Unit Comprising Glycosidic and Phosphodiester Linkages *
    Article Snippet: To generate the plasmids p Δ N29-cslB-His6 (tac ) and p Δ N37-cslB-His6 (tac ) for the expression of ΔN29-CslB-His6 and ΔN37-CslB-His6 without N-terminal MBP tag under tac promoter control, the truncated cslB sequences were amplified using primers CL5/TF38 and CL6/TF38, respectively, and cloned via NdeI/XhoI into pMBP-cslB-His6 (tac ), thereby replacing the MBP-cslB sequence. .. Mutations at positions Asp138 and Asp140 in CslB were introduced in pMBP-cslB-His6 ( tac ), and mutations at positions H595, H733 in CslB were introduced in p Δ N37-cslB-His6 (tac ) using the Q5® site-directed mutagenesis kit (New England Biolabs) and the respective primers shown in according to the manufacturer's guidelines.

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ). .. For heterologous expression of enhanced green fluorescent protein (eGFP) and Vr1 in E. coli , both ORFs were amplified from cDNA using primers 59 and 60 (Vr1) and 61 and 62 (GFP), respectively.

    Article Title: G-Quadruplexes influence pri-microRNA processing
    Article Snippet: The pEZY miExpress™ Precursor miRNA Expression plasmids (GeneCopoeia) were used to over express the pri-miRNAs. .. The Q5® Site-Directed Mutagenesis Kit (New England BioLabs) was used to generate the G/A mutants (See Table S1 for the primers sequence).

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: Paragraph title: 4.1. Construction of Native and Mutant ST Expression Vectors ... The DNA sequences encoding mature STh and STp peptides, and STh mutants were introduced into the plasmid using appropriate primers ( ) and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, UK).

    Modification:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: The expression cassette was cloned into a modified pSUMO vector ( ) with a 6XHis tag and a TEV cleavage site, following the Gibson assembly cloning protocol ( ) (New England BioLabs, Ipswich, MA) using primers mentioned in . .. N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs).

    Article Title: The Capsule Polymerase CslB of Neisseria meningitidis Serogroup L Catalyzes the Synthesis of a Complex Trimeric Repeating Unit Comprising Glycosidic and Phosphodiester Linkages *
    Article Snippet: The PCR products were subsequently cloned via BamHI/XhoI into the modified p-Mal-c (New England Biolabs) vector pMBP-csxA-His6 ( tac ), thereby replacing the csxA sequence coding for the CP of N. meningitidis serogroup X ( ). .. Mutations at positions Asp138 and Asp140 in CslB were introduced in pMBP-cslB-His6 ( tac ), and mutations at positions H595, H733 in CslB were introduced in p Δ N37-cslB-His6 (tac ) using the Q5® site-directed mutagenesis kit (New England Biolabs) and the respective primers shown in according to the manufacturer's guidelines.

    Article Title: G-Quadruplexes influence pri-microRNA processing
    Article Snippet: The Q5® Site-Directed Mutagenesis Kit (New England BioLabs) was used to generate the G/A mutants (See Table S1 for the primers sequence). .. HEK293 cells were cultured in 100 mm petri dishes (Sarstedt) in Dulbecco's Modified Eagle Medium (DMEM), supplemented with 10% fetal bovine serum (FBS) and 1 mM sodium pyruvate (all purchased from Wisent).

    Transformation Assay:

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: The resulting plasmids were used for transformation of the fungus after linearization with the restriction enzyme XbaI. .. A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ).

    Article Title: Improved synthesis of 4-cyanotryptophan and other tryptophan analogs in aqueous solvent using variants of TrpB from Thermotoga maritima
    Article Snippet: Site saturation libraries were generated using NEB Q5® site directed mutagenesis kit per manufacturer’s instructions using Tm 9D8 as the parent. .. Following PCR, samples were treated with KLD Enzyme Mix for five minutes, and transformed into BL21(DE3) E. cloni® Express cells.

    Over Expression:

    Article Title: The PA3177 Gene Encodes an Active Diguanylate Cyclase That Contributes to Biofilm Antimicrobial Tolerance but Not Biofilm Formation by Pseudomonas aeruginosa
    Article Snippet: Site-directed mutagenesis of GGEEF domain to GGAAF domain was achieved by utilizing Q5 site-directed mutagenesis kit (NEB) according to the manufacturer's protocol. .. Complementation and overexpression was achieved by placing the respective gene under the control of an arabinose-inducible PBAD promoter in the pJN105 or pMJT-1 vectors ( , ).

    Article Title: G-Quadruplexes influence pri-microRNA processing
    Article Snippet: Paragraph title: Cell culture and pri-miRNA overexpression assays ... The Q5® Site-Directed Mutagenesis Kit (New England BioLabs) was used to generate the G/A mutants (See Table S1 for the primers sequence).

    Transfection:

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: A reporter vector containing Renilla Luciferase was used as a control for cell number and transfection efficiency. .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504).

    Cell Culture:

    Article Title: G-Quadruplexes influence pri-microRNA processing
    Article Snippet: Paragraph title: Cell culture and pri-miRNA overexpression assays ... The Q5® Site-Directed Mutagenesis Kit (New England BioLabs) was used to generate the G/A mutants (See Table S1 for the primers sequence).

    Generated:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: .. N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs). .. The coding sequence of mouse HSL (mHSL) was amplified by PCR from the pcDNA4/HisMaxA-mHSL construct described in ( ) using the primers listed in .

    Article Title: Imaging pH Dynamics Simultaneously in Two Cellular Compartments Using a Ratiometric pH-Sensitive Mutant of mCherry
    Article Snippet: pRSETb-mCherry(wt) and GW1-mCherry(wt) were mutated using the NEB Q5 site-directed mutagenesis kit to generate the mCherry(I158E/Q160A) mutant. .. GW1-ratiometric-pHluorin and GW1-SypHer were generated by subcloning ratiometric-pHluorin from VV064: 1xCox8-ratiometric-pHluorin and SypHer from SypHer-mt into GW1 vector using NEB HiFi reactions.

    Article Title: Improved synthesis of 4-cyanotryptophan and other tryptophan analogs in aqueous solvent using variants of TrpB from Thermotoga maritima
    Article Snippet: .. Site saturation libraries were generated using NEB Q5® site directed mutagenesis kit per manufacturer’s instructions using Tm 9D8 as the parent. .. Primers were designed using NEBaseChanger® software and incorporated the degenerate codons NDT (encoding for Ile, Asn, Ser, Gly, Asp, Val, Arg, His, Leu, Phe, Tyr, and Cys), VHG (encoding for Met, Thr, Lys, Glu, Ala, Val, Gln, Pro, and Leu), and TGG (Trp) at the residue of interest ( ).

    DNA Sequencing:

    Article Title: Redefinition and Unification of the SXT/R391 Family of Integrative and Conjugative Elements
    Article Snippet: lacZ reporter fusions were constructed by introducing the promoter sequences of int of ICE Vpa S167 and ICE Vch 2012HC25 with primer pairs pOP-VpaS167F/pOP-VpaS167R and pOP-Vch12HCF/pOP-Vch12HCR, respectively , into the PstI restriction site of pOP lacZ using the Q5 site-directed mutagenesis kit (New England BioLabs) according to the manufacturer's instructions. .. The resulting plasmids were confirmed by restriction profiling and DNA sequencing and then integrated in single copy into the chromosomal site attB λ of E. coli BW25113 using pINT-Ts ( , ).

    Sequencing:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs). .. The coding sequence of mouse HSL (mHSL) was amplified by PCR from the pcDNA4/HisMaxA-mHSL construct described in ( ) using the primers listed in .

    Article Title: Imaging pH Dynamics Simultaneously in Two Cellular Compartments Using a Ratiometric pH-Sensitive Mutant of mCherry
    Article Snippet: pRSETb-mCherry(wt) and GW1-mCherry(wt) were mutated using the NEB Q5 site-directed mutagenesis kit to generate the mCherry(I158E/Q160A) mutant. .. Mitochondria-targeted mCherryEA was cloned by fusing a tandem 4xCoxVIII signal sequence to the N-terminus.

    Article Title: A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs
    Article Snippet: .. To create similar plasmids, use the Q5 Site-Directed Mutagenesis Kit to insert the PAM-library protospacer sequence of the appropriate length (labeled “mut protospacer” in pTJ247) at position 247 in the attached P70a-deGFP plasmid map flanked by a PAM that can be recognized by the Cas nuclease. .. The primers used to create pTJ247 from p70a-deGFP using the Q5 Site-Directed Mutagenesis Kit are listed in the appendix (TJpr373/374).

    Article Title: The PA3177 Gene Encodes an Active Diguanylate Cyclase That Contributes to Biofilm Antimicrobial Tolerance but Not Biofilm Formation by Pseudomonas aeruginosa
    Article Snippet: C-terminal tagging was achieved by introducing the sequence of a V5 tag into the indicated genes via PCR using a primer ( ). .. Site-directed mutagenesis of GGEEF domain to GGAAF domain was achieved by utilizing Q5 site-directed mutagenesis kit (NEB) according to the manufacturer's protocol.

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504). .. Sanger sequencing was performed on all plasmids to confirm mutagenesis efficacy.

    Article Title: G-Quadruplexes influence pri-microRNA processing
    Article Snippet: .. The Q5® Site-Directed Mutagenesis Kit (New England BioLabs) was used to generate the G/A mutants (See Table S1 for the primers sequence). .. HEK293 cells were cultured in 100 mm petri dishes (Sarstedt) in Dulbecco's Modified Eagle Medium (DMEM), supplemented with 10% fetal bovine serum (FBS) and 1 mM sodium pyruvate (all purchased from Wisent).

    Article Title: Redefinition and Unification of the SXT/R391 Family of Integrative and Conjugative Elements
    Article Snippet: lacZ reporter fusions were constructed by introducing the promoter sequences of int of ICE Vpa S167 and ICE Vch 2012HC25 with primer pairs pOP-VpaS167F/pOP-VpaS167R and pOP-Vch12HCF/pOP-Vch12HCR, respectively , into the PstI restriction site of pOP lacZ using the Q5 site-directed mutagenesis kit (New England BioLabs) according to the manufacturer's instructions. .. Sequencing reactions (except PacBio sequencing) were performed by the Plateforme de Séquençage et de Génotypage du Centre de Recherche du CHUL (Québec, QC, Canada).

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: The signal sequence of DsbC has been removed to allow cytoplasmic expression. .. The DNA sequences encoding mature STh and STp peptides, and STh mutants were introduced into the plasmid using appropriate primers ( ) and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, UK).

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: .. To allow for the purification of DsbC alone, a stop codon was introduced after the DsbC coding sequence in the pETDsbCin_1b plasmid using the Q5® Site-Directed Mutagenesis Kit and primers DsbC-TAA-F and DsbC-TAA-R ( ). ..

    Fluorescence:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: Fluorescence microscopy and FRET-FLIM were carried out with mouse HILPDA (mHILPDA). .. N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs).

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: This vector encodes the E. coli thiol:disulfide interchange protein DsbC fused to the yellow fluorescence protein (EYFP), linked by a 6x-histidine tag and a TEV protease site. .. The DNA sequences encoding mature STh and STp peptides, and STh mutants were introduced into the plasmid using appropriate primers ( ) and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, UK).

    Mutagenesis:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: .. N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs). .. The coding sequence of mouse HSL (mHSL) was amplified by PCR from the pcDNA4/HisMaxA-mHSL construct described in ( ) using the primers listed in .

    Article Title: Imaging pH Dynamics Simultaneously in Two Cellular Compartments Using a Ratiometric pH-Sensitive Mutant of mCherry
    Article Snippet: .. pRSETb-mCherry(wt) and GW1-mCherry(wt) were mutated using the NEB Q5 site-directed mutagenesis kit to generate the mCherry(I158E/Q160A) mutant. .. Mitochondria-targeted mCherryEA was cloned by fusing a tandem 4xCoxVIII signal sequence to the N-terminus.

    Article Title: CRISPR RNA-dependent binding and cleavage of endogenous RNAs by the Campylobacter jejuni Cas9
    Article Snippet: .. To form the target for transcriptional repression, recognized PAM sequences were inserted into p66- lacZ using oRL29-32 using Q5 site-directed mutagenesis (NEB CN#E0554S). .. The ACAG PAM in the endogenous cj1321 locus experiment was replaced with a ACAC PAM also using Q5 mutagenesis and oRL33-34.

    Article Title: A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs
    Article Snippet: .. To create similar plasmids, use the Q5 Site-Directed Mutagenesis Kit to insert the PAM-library protospacer sequence of the appropriate length (labeled “mut protospacer” in pTJ247) at position 247 in the attached P70a-deGFP plasmid map flanked by a PAM that can be recognized by the Cas nuclease. .. The primers used to create pTJ247 from p70a-deGFP using the Q5 Site-Directed Mutagenesis Kit are listed in the appendix (TJpr373/374).

    Article Title: The Capsule Polymerase CslB of Neisseria meningitidis Serogroup L Catalyzes the Synthesis of a Complex Trimeric Repeating Unit Comprising Glycosidic and Phosphodiester Linkages *
    Article Snippet: .. Mutations at positions Asp138 and Asp140 in CslB were introduced in pMBP-cslB-His6 ( tac ), and mutations at positions H595, H733 in CslB were introduced in p Δ N37-cslB-His6 (tac ) using the Q5® site-directed mutagenesis kit (New England Biolabs) and the respective primers shown in according to the manufacturer's guidelines. .. For expression of recombinant proteins, Escherichia coli M15[pREP4] were transformed with expression plasmids ( ) and grown overnight in LB medium at 37 °C and 200 rpm in the presence of 200 μg/ml carbenicillin.

    Article Title: The PA3177 Gene Encodes an Active Diguanylate Cyclase That Contributes to Biofilm Antimicrobial Tolerance but Not Biofilm Formation by Pseudomonas aeruginosa
    Article Snippet: .. Site-directed mutagenesis of GGEEF domain to GGAAF domain was achieved by utilizing Q5 site-directed mutagenesis kit (NEB) according to the manufacturer's protocol. ..

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: .. A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ). .. For heterologous expression of enhanced green fluorescent protein (eGFP) and Vr1 in E. coli , both ORFs were amplified from cDNA using primers 59 and 60 (Vr1) and 61 and 62 (GFP), respectively.

    Article Title: Pumilio directs deadenylation-associated translational repression of the cyclin-dependent kinase 1 activator RGC-32
    Article Snippet: .. The Q5® Site Directed Mutagenesis Kit (New England Biolabs) was used to generate the 3′UTR mutants and deletions according to the manufacturer's instructions. .. All primers were designed using NEBaseChanger™ software ( ).

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504). .. Sanger sequencing was performed on all plasmids to confirm mutagenesis efficacy.

    Article Title: Improved synthesis of 4-cyanotryptophan and other tryptophan analogs in aqueous solvent using variants of TrpB from Thermotoga maritima
    Article Snippet: .. Site saturation libraries were generated using NEB Q5® site directed mutagenesis kit per manufacturer’s instructions using Tm 9D8 as the parent. .. Primers were designed using NEBaseChanger® software and incorporated the degenerate codons NDT (encoding for Ile, Asn, Ser, Gly, Asp, Val, Arg, His, Leu, Phe, Tyr, and Cys), VHG (encoding for Met, Thr, Lys, Glu, Ala, Val, Gln, Pro, and Leu), and TGG (Trp) at the residue of interest ( ).

    Article Title: G-Quadruplexes influence pri-microRNA processing
    Article Snippet: .. The Q5® Site-Directed Mutagenesis Kit (New England BioLabs) was used to generate the G/A mutants (See Table S1 for the primers sequence). .. HEK293 cells were cultured in 100 mm petri dishes (Sarstedt) in Dulbecco's Modified Eagle Medium (DMEM), supplemented with 10% fetal bovine serum (FBS) and 1 mM sodium pyruvate (all purchased from Wisent).

    Article Title: Redefinition and Unification of the SXT/R391 Family of Integrative and Conjugative Elements
    Article Snippet: .. lacZ reporter fusions were constructed by introducing the promoter sequences of int of ICE Vpa S167 and ICE Vch 2012HC25 with primer pairs pOP-VpaS167F/pOP-VpaS167R and pOP-Vch12HCF/pOP-Vch12HCR, respectively , into the PstI restriction site of pOP lacZ using the Q5 site-directed mutagenesis kit (New England BioLabs) according to the manufacturer's instructions. .. The resulting plasmids were confirmed by restriction profiling and DNA sequencing and then integrated in single copy into the chromosomal site attB λ of E. coli BW25113 using pINT-Ts ( , ).

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: .. The DNA sequences encoding mature STh and STp peptides, and STh mutants were introduced into the plasmid using appropriate primers ( ) and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, UK). ..

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: .. To allow for the purification of DsbC alone, a stop codon was introduced after the DsbC coding sequence in the pETDsbCin_1b plasmid using the Q5® Site-Directed Mutagenesis Kit and primers DsbC-TAA-F and DsbC-TAA-R ( ). ..

    Subcloning:

    Article Title: Imaging pH Dynamics Simultaneously in Two Cellular Compartments Using a Ratiometric pH-Sensitive Mutant of mCherry
    Article Snippet: pRSETb-mCherry(wt) and GW1-mCherry(wt) were mutated using the NEB Q5 site-directed mutagenesis kit to generate the mCherry(I158E/Q160A) mutant. .. GW1-ratiometric-pHluorin and GW1-SypHer were generated by subcloning ratiometric-pHluorin from VV064: 1xCox8-ratiometric-pHluorin and SypHer from SypHer-mt into GW1 vector using NEB HiFi reactions.

    Microscopy:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: Fluorescence microscopy and FRET-FLIM were carried out with mouse HILPDA (mHILPDA). .. N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs).

    Purification:

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: .. To allow for the purification of DsbC alone, a stop codon was introduced after the DsbC coding sequence in the pETDsbCin_1b plasmid using the Q5® Site-Directed Mutagenesis Kit and primers DsbC-TAA-F and DsbC-TAA-R ( ). ..

    Polymerase Chain Reaction:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs). .. The coding sequence of mouse HSL (mHSL) was amplified by PCR from the pcDNA4/HisMaxA-mHSL construct described in ( ) using the primers listed in .

    Article Title: The Capsule Polymerase CslB of Neisseria meningitidis Serogroup L Catalyzes the Synthesis of a Complex Trimeric Repeating Unit Comprising Glycosidic and Phosphodiester Linkages *
    Article Snippet: The PCR products were subsequently cloned via BamHI/XhoI into the modified p-Mal-c (New England Biolabs) vector pMBP-csxA-His6 ( tac ), thereby replacing the csxA sequence coding for the CP of N. meningitidis serogroup X ( ). .. Mutations at positions Asp138 and Asp140 in CslB were introduced in pMBP-cslB-His6 ( tac ), and mutations at positions H595, H733 in CslB were introduced in p Δ N37-cslB-His6 (tac ) using the Q5® site-directed mutagenesis kit (New England Biolabs) and the respective primers shown in according to the manufacturer's guidelines.

    Article Title: The PA3177 Gene Encodes an Active Diguanylate Cyclase That Contributes to Biofilm Antimicrobial Tolerance but Not Biofilm Formation by Pseudomonas aeruginosa
    Article Snippet: C-terminal tagging was achieved by introducing the sequence of a V5 tag into the indicated genes via PCR using a primer ( ). .. Site-directed mutagenesis of GGEEF domain to GGAAF domain was achieved by utilizing Q5 site-directed mutagenesis kit (NEB) according to the manufacturer's protocol.

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: Similarly, the PCR product of FgV-ch9-P3 and the synthesized genes were digested using PacI/NotI restriction sites introduced into the termini of the sequences and subsequently ligated into pBJ-1. .. A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ).

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504). .. Sanger sequencing was performed on all plasmids to confirm mutagenesis efficacy.

    Article Title: Improved synthesis of 4-cyanotryptophan and other tryptophan analogs in aqueous solvent using variants of TrpB from Thermotoga maritima
    Article Snippet: Site saturation libraries were generated using NEB Q5® site directed mutagenesis kit per manufacturer’s instructions using Tm 9D8 as the parent. .. Following PCR, samples were treated with KLD Enzyme Mix for five minutes, and transformed into BL21(DE3) E. cloni® Express cells.

    Labeling:

    Article Title: A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs
    Article Snippet: .. To create similar plasmids, use the Q5 Site-Directed Mutagenesis Kit to insert the PAM-library protospacer sequence of the appropriate length (labeled “mut protospacer” in pTJ247) at position 247 in the attached P70a-deGFP plasmid map flanked by a PAM that can be recognized by the Cas nuclease. .. The primers used to create pTJ247 from p70a-deGFP using the Q5 Site-Directed Mutagenesis Kit are listed in the appendix (TJpr373/374).

    Plasmid Preparation:

    Article Title: Hypoxia-inducible lipid droplet-associated protein inhibits adipose triglyceride lipase
    Article Snippet: The expression cassette was cloned into a modified pSUMO vector ( ) with a 6XHis tag and a TEV cleavage site, following the Gibson assembly cloning protocol ( ) (New England BioLabs, Ipswich, MA) using primers mentioned in . .. N-terminal truncations were generated following the Gibson assembly protocol, and C-terminal truncations were made using the Q5® site-directed mutagenesis kit (New England BioLabs).

    Article Title: Imaging pH Dynamics Simultaneously in Two Cellular Compartments Using a Ratiometric pH-Sensitive Mutant of mCherry
    Article Snippet: pRSETb-mCherry(wt) and GW1-mCherry(wt) were mutated using the NEB Q5 site-directed mutagenesis kit to generate the mCherry(I158E/Q160A) mutant. .. GW1-ratiometric-pHluorin and GW1-SypHer were generated by subcloning ratiometric-pHluorin from VV064: 1xCox8-ratiometric-pHluorin and SypHer from SypHer-mt into GW1 vector using NEB HiFi reactions.

    Article Title: CRISPR RNA-dependent binding and cleavage of endogenous RNAs by the Campylobacter jejuni Cas9
    Article Snippet: To create targeting vectors for plasmid clearance mimicking the endogenous cj1321 locus, p66- lacZ ( ) was digested with Xho I and Aat II and oRL21-28 were phosphorylated, annealed, and ligated into this backbone. .. To form the target for transcriptional repression, recognized PAM sequences were inserted into p66- lacZ using oRL29-32 using Q5 site-directed mutagenesis (NEB CN#E0554S).

    Article Title: A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs
    Article Snippet: .. To create similar plasmids, use the Q5 Site-Directed Mutagenesis Kit to insert the PAM-library protospacer sequence of the appropriate length (labeled “mut protospacer” in pTJ247) at position 247 in the attached P70a-deGFP plasmid map flanked by a PAM that can be recognized by the Cas nuclease. .. The primers used to create pTJ247 from p70a-deGFP using the Q5 Site-Directed Mutagenesis Kit are listed in the appendix (TJpr373/374).

    Article Title: The Capsule Polymerase CslB of Neisseria meningitidis Serogroup L Catalyzes the Synthesis of a Complex Trimeric Repeating Unit Comprising Glycosidic and Phosphodiester Linkages *
    Article Snippet: The PCR products were subsequently cloned via BamHI/XhoI into the modified p-Mal-c (New England Biolabs) vector pMBP-csxA-His6 ( tac ), thereby replacing the csxA sequence coding for the CP of N. meningitidis serogroup X ( ). .. Mutations at positions Asp138 and Asp140 in CslB were introduced in pMBP-cslB-His6 ( tac ), and mutations at positions H595, H733 in CslB were introduced in p Δ N37-cslB-His6 (tac ) using the Q5® site-directed mutagenesis kit (New England Biolabs) and the respective primers shown in according to the manufacturer's guidelines.

    Article Title: The PA3177 Gene Encodes an Active Diguanylate Cyclase That Contributes to Biofilm Antimicrobial Tolerance but Not Biofilm Formation by Pseudomonas aeruginosa
    Article Snippet: Isogenic mutant for PA3177 was constructed by allelic replacement using sucrose counterselection as previously described ( , ) using the gene replacement vector pEX18Gm ( ). .. Site-directed mutagenesis of GGEEF domain to GGAAF domain was achieved by utilizing Q5 site-directed mutagenesis kit (NEB) according to the manufacturer's protocol.

    Article Title: Expression of a Structural Protein of the Mycovirus FgV-ch9 Negatively Affects the Transcript Level of a Novel Symptom Alleviation Factor and Causes Virus Infection-Like Symptoms in Fusarium graminearum
    Article Snippet: Paragraph title: Vector construction. ... A nontranslatable frameshift mutation (deletion of the A in the translation start site) was introduced into pBJ-P3 by site-directed mutagenesis by following the manufacturer's instructions (Q5 site-directed mutagenesis kit; New England BioLabs) using primers 29 and 30 ( ).

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: A reporter vector containing Renilla Luciferase was used as a control for cell number and transfection efficiency. .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504).

    Article Title: Rare variant analysis in multiply affected families, association studies and functional analysis suggest a role for the ITGΒ4 gene in schizophrenia and bipolar disorder
    Article Snippet: .. The ITGB4 genetic variants rs147480547 allele A and rs145976111 allele T were introduced into the plasmid using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) and following the manufacturer's protocol. .. A plasmid containing both of the genetic variants was also constructed using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, UK).

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: .. The DNA sequences encoding mature STh and STp peptides, and STh mutants were introduced into the plasmid using appropriate primers ( ) and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, UK). ..

    Article Title: Purification and Characterization of Native and Vaccine Candidate Mutant Enterotoxigenic Escherichia coli Heat-Stable Toxins
    Article Snippet: .. To allow for the purification of DsbC alone, a stop codon was introduced after the DsbC coding sequence in the pETDsbCin_1b plasmid using the Q5® Site-Directed Mutagenesis Kit and primers DsbC-TAA-F and DsbC-TAA-R ( ). ..

    Software:

    Article Title: Pumilio directs deadenylation-associated translational repression of the cyclin-dependent kinase 1 activator RGC-32
    Article Snippet: The Q5® Site Directed Mutagenesis Kit (New England Biolabs) was used to generate the 3′UTR mutants and deletions according to the manufacturer's instructions. .. All primers were designed using NEBaseChanger™ software ( ).

    Article Title: Improved synthesis of 4-cyanotryptophan and other tryptophan analogs in aqueous solvent using variants of TrpB from Thermotoga maritima
    Article Snippet: Site saturation libraries were generated using NEB Q5® site directed mutagenesis kit per manufacturer’s instructions using Tm 9D8 as the parent. .. Primers were designed using NEBaseChanger® software and incorporated the degenerate codons NDT (encoding for Ile, Asn, Ser, Gly, Asp, Val, Arg, His, Leu, Phe, Tyr, and Cys), VHG (encoding for Met, Thr, Lys, Glu, Ala, Val, Gln, Pro, and Leu), and TGG (Trp) at the residue of interest ( ).

    Negative Control:

    Article Title: Genetic Reduction in Left Ventricular Protein Kinase C alpha and Adverse Ventricular Remodeling in Human Subjects
    Article Snippet: A similar plasmid with the enhancer region replaced by a random non-coding genomic segment was constructed for use as a negative control. .. This was accomplished using the Q5 Site Directed Mutagenesis kit (New England Biolabs) and back-to-back PCR primers (F: GCAGAGGCGGTCCGGAGCGGC; R: CGCCGCGAGTAGGAAACGCGAG) containing the desired substitutions (major and minor alleles at rs9910355 and rs9303504).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs q5 site directed mutagenesis kit
    Q5 Site Directed Mutagenesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 217 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 site directed mutagenesis kit/product/New England Biolabs
    Average 90 stars, based on 217 article reviews
    Price from $9.99 to $1999.99
    q5 site directed mutagenesis kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results