sphtp3  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    Q5 Site Directed Mutagenesis Kit
    Description:
    Q5 Site Directed Mutagenesis Kit 10 rxns
    Catalog Number:
    e0554s
    Price:
    197
    Size:
    10 rxns
    Category:
    PCR Mutagenesis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs sphtp3
    Q5 Site Directed Mutagenesis Kit
    Q5 Site Directed Mutagenesis Kit 10 rxns
    https://www.bioz.com/result/sphtp3/product/New England Biolabs
    Average 94 stars, based on 1131 article reviews
    Price from $9.99 to $1999.99
    sphtp3 - by Bioz Stars, 2020-04
    94/100 stars

    Images

    1) Product Images from "Cell entry of a host-targeting protein of oomycetes requires gp96"

    Article Title: Cell entry of a host-targeting protein of oomycetes requires gp96

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04796-3

    Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Translocation Assay, Nuclear Magnetic Resonance, Mutagenesis, Titration, Binding Assay

    SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)
    Figure Legend Snippet: SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)

    Techniques Used: Sequencing, Activity Assay, Negative Control, Functional Assay, Mutagenesis, Translocation Assay, Recombinant

    SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Inhibition, Incubation

    2) Product Images from "The R148.3 Gene Modulates Caenorhabditis elegans Lifespan and Fat Metabolism"

    Article Title: The R148.3 Gene Modulates Caenorhabditis elegans Lifespan and Fat Metabolism

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.117.041681

    Loss of R148.3 shortens lifespan. Representative population survival curve of (A and B) N2 worms, or (C) sbp-1 mutants fed either empty L4440 vector (control RNAi) or R148.3 RNAi. RNAi was initiated at either (A and C) stage L1 or at (B) stage L4/young adult. For all panels, P
    Figure Legend Snippet: Loss of R148.3 shortens lifespan. Representative population survival curve of (A and B) N2 worms, or (C) sbp-1 mutants fed either empty L4440 vector (control RNAi) or R148.3 RNAi. RNAi was initiated at either (A and C) stage L1 or at (B) stage L4/young adult. For all panels, P

    Techniques Used: Plasmid Preparation

    Loss of R148.3 increases susceptibility to oxidative stress. (A) Representative survival curve of adult N2 worms fed either empty vector or R148.3 RNAi, and treated with 100 mM paraquat. See Table S6 in File S2 for additional data on replicate experiments. (B) mRNA levels of genes involved in oxidative stress resistance in adult worms fed either empty vector or R148.3 RNAi. (C) mRNA levels of genes involved in autophagy in control ( RNAi ) and R148.3 ( RNAi ) worms described in (B). For all panels, * P
    Figure Legend Snippet: Loss of R148.3 increases susceptibility to oxidative stress. (A) Representative survival curve of adult N2 worms fed either empty vector or R148.3 RNAi, and treated with 100 mM paraquat. See Table S6 in File S2 for additional data on replicate experiments. (B) mRNA levels of genes involved in oxidative stress resistance in adult worms fed either empty vector or R148.3 RNAi. (C) mRNA levels of genes involved in autophagy in control ( RNAi ) and R148.3 ( RNAi ) worms described in (B). For all panels, * P

    Techniques Used: Plasmid Preparation

    Loss of R148.3 blunts the long-lived phenotype of eat-2 and daf-2 mutants. (A) Representative population survival curve of N2 worms and eat-2 mutants fed either empty vector or R148.3 RNAi ( P
    Figure Legend Snippet: Loss of R148.3 blunts the long-lived phenotype of eat-2 and daf-2 mutants. (A) Representative population survival curve of N2 worms and eat-2 mutants fed either empty vector or R148.3 RNAi ( P

    Techniques Used: Plasmid Preparation

    Expression of R148.3 in C. elegans . (A) Expression levels of R148.3 were measured by qPCR in N2 worms at different stages of their life; bars represent average ± SEM ( n = 3). (B) Expression of a R148 p ::GFP reporter in the pharynx, neurons, vulva, and body wall muscles. Top panels: head is oriented up; lower panels: head is oriented down. (C) Representative images of mCherry fluorescence in muscle and coelomocytes in myo-3p :: mCherry- vs. myo-3P :: ssR148.3 :: mCherry -expressing worms. Exposure: 20 msec. Bar, 200 µm. (D) Representative image of myo-3P :: ssR148.3 :: mCherry expression in coelomocytes. → indicates coelomocyte nuclei. Exposure: 1 msec. Bar, 10 µm. Similar findings were obtained with a second independent transgenic line.
    Figure Legend Snippet: Expression of R148.3 in C. elegans . (A) Expression levels of R148.3 were measured by qPCR in N2 worms at different stages of their life; bars represent average ± SEM ( n = 3). (B) Expression of a R148 p ::GFP reporter in the pharynx, neurons, vulva, and body wall muscles. Top panels: head is oriented up; lower panels: head is oriented down. (C) Representative images of mCherry fluorescence in muscle and coelomocytes in myo-3p :: mCherry- vs. myo-3P :: ssR148.3 :: mCherry -expressing worms. Exposure: 20 msec. Bar, 200 µm. (D) Representative image of myo-3P :: ssR148.3 :: mCherry expression in coelomocytes. → indicates coelomocyte nuclei. Exposure: 1 msec. Bar, 10 µm. Similar findings were obtained with a second independent transgenic line.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Fluorescence, Transgenic Assay

    Loss of R148.3 increases triglyceride accumulation. (A) Oil red O and Nile Red staining of N2 worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L1. Animals were assessed at all developmental stages and in adulthood. (B and C) Quantitative analysis of Oil Red O staining (B), and whole-body triglyceride content (C) of worms described in (A) and studied at L4 and adult stages. (D) Whole-body triglyceride content of worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L4/young adult and studied 8 d later. (E) Metabolomic analysis of lipid species of worms described in (C). (F–I) Pharyngeal pumping rates (F), twitching rates (G), oxygen consumption (H), and mRNA expression levels of lipid metabolism genes (I) of L4 worms described in (C). For all panels, * P
    Figure Legend Snippet: Loss of R148.3 increases triglyceride accumulation. (A) Oil red O and Nile Red staining of N2 worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L1. Animals were assessed at all developmental stages and in adulthood. (B and C) Quantitative analysis of Oil Red O staining (B), and whole-body triglyceride content (C) of worms described in (A) and studied at L4 and adult stages. (D) Whole-body triglyceride content of worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L4/young adult and studied 8 d later. (E) Metabolomic analysis of lipid species of worms described in (C). (F–I) Pharyngeal pumping rates (F), twitching rates (G), oxygen consumption (H), and mRNA expression levels of lipid metabolism genes (I) of L4 worms described in (C). For all panels, * P

    Techniques Used: Staining, Plasmid Preparation, Expressing

    3) Product Images from "HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission"

    Article Title: HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission

    Journal: Cell host & microbe

    doi: 10.1016/j.chom.2018.12.008

    Actin cytoskeletal disruption restrains initial viral dissemination (A) ORF diagrams of HIV Nef WT and HIV Nef F191A . (B) 10 4 IUs each of each clone were intravaginally co-inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured at week two, followed the next day by tissue harvest or, in non-viremic animals, repeat intravaginal inoculation and tissue harvest at week three. (C) Plasma viremia. Dashed line and grey-shaded area indicate mean and range of background signals in three uninfected control animals. (D) Ratio of nef WT (red) or nef F191A (green) NGS reads (~2 × 10 4 total reads/sample) from plasma vRNA obtained at the time of initial viremia. Numbers indicate individual animals. HIV nef WT vRNA was undetectable at any time in plasma or any tissue analyzed in the four animals grouped on the left. (E) ORF diagrams of HIV Nef WT and HIV ΔNef. (F) 10 4 IUs each of HIV Nef WT and HIV ΔNef were intravaginally inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured weekly starting at week 2. Non-viremic animals received repeat intravaginal inoculations the next day. (G) Plasma viremia. Dotted line and grey-shaded area indicate mean and range of background signals. (H, I) Ratio of NGS reads (~2 × 10 4 total reads/sample) for nef WT (red) or Δ nef (green) from plasma vRNA obtained at the time of initial viremia (H) or at the time of sacrifice (I). Numbers indicate individual animals. Either nef WT or Δ nef vRNA were undetectable in any samples in the animals grouped on the left (n=1) or on the right (n=2), respectively.
    Figure Legend Snippet: Actin cytoskeletal disruption restrains initial viral dissemination (A) ORF diagrams of HIV Nef WT and HIV Nef F191A . (B) 10 4 IUs each of each clone were intravaginally co-inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured at week two, followed the next day by tissue harvest or, in non-viremic animals, repeat intravaginal inoculation and tissue harvest at week three. (C) Plasma viremia. Dashed line and grey-shaded area indicate mean and range of background signals in three uninfected control animals. (D) Ratio of nef WT (red) or nef F191A (green) NGS reads (~2 × 10 4 total reads/sample) from plasma vRNA obtained at the time of initial viremia. Numbers indicate individual animals. HIV nef WT vRNA was undetectable at any time in plasma or any tissue analyzed in the four animals grouped on the left. (E) ORF diagrams of HIV Nef WT and HIV ΔNef. (F) 10 4 IUs each of HIV Nef WT and HIV ΔNef were intravaginally inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured weekly starting at week 2. Non-viremic animals received repeat intravaginal inoculations the next day. (G) Plasma viremia. Dotted line and grey-shaded area indicate mean and range of background signals. (H, I) Ratio of NGS reads (~2 × 10 4 total reads/sample) for nef WT (red) or Δ nef (green) from plasma vRNA obtained at the time of initial viremia (H) or at the time of sacrifice (I). Numbers indicate individual animals. Either nef WT or Δ nef vRNA were undetectable in any samples in the animals grouped on the left (n=1) or on the right (n=2), respectively.

    Techniques Used: Mouse Assay, Next-Generation Sequencing

    Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.
    Figure Legend Snippet: Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.

    Techniques Used: Migration, Expressing, Infection, Injection, Mutagenesis, Mouse Assay

    The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .
    Figure Legend Snippet: The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .

    Techniques Used: Infection, Expressing, Fluorescence

    4) Product Images from "Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas"

    Article Title: Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04128-5

    Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Mutagenesis, Expressing, Transformation Assay, Growth Assay, Stable Transfection, Plasmid Preparation, MTT Assay, Proliferation Assay, Wound Healing Assay

    Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation

    Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P
    Figure Legend Snippet: Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P

    Techniques Used: Inhibition, Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation, Proliferation Assay

    5) Product Images from "Cell entry of a host-targeting protein of oomycetes requires gp96"

    Article Title: Cell entry of a host-targeting protein of oomycetes requires gp96

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04796-3

    Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Translocation Assay, Nuclear Magnetic Resonance, Mutagenesis, Titration, Binding Assay

    Model for the self-translocation of SpHtp3 into host cells and its vesicle release. The fish-pathogenic oomycete S. parasitica secretes several effector proteins during different stages of infection. The nuclease SpHtp3 is secreted in the later stages of infection. S. parasitica acidifies the pH of its environment, which likely leads to the exposure of a gp96-like protein to the host cell surface. The gp96-like protein is working as a receptor and mediates the translocation of SpHtp3 via lipid rafts into the cell. Finally, SpHtp3 is released from vesicles with the help of other effector proteins, as SpHtp1, into the cytosol where it is functionally active as a nuclease
    Figure Legend Snippet: Model for the self-translocation of SpHtp3 into host cells and its vesicle release. The fish-pathogenic oomycete S. parasitica secretes several effector proteins during different stages of infection. The nuclease SpHtp3 is secreted in the later stages of infection. S. parasitica acidifies the pH of its environment, which likely leads to the exposure of a gp96-like protein to the host cell surface. The gp96-like protein is working as a receptor and mediates the translocation of SpHtp3 via lipid rafts into the cell. Finally, SpHtp3 is released from vesicles with the help of other effector proteins, as SpHtp1, into the cytosol where it is functionally active as a nuclease

    Techniques Used: Translocation Assay, Fluorescence In Situ Hybridization, Infection

    SpHtp3 is released from vesicles with the help of SpHtp1 from S. parasitica . a RTG-2 cells in direct contact with S. parasitica are shrunk with a condensed nucleus. In these cells, no cytosolic RNA (SytoRNA) can be detected and infected cells contain a high amount of vesicles (membrane stain FM4-64FX, see also Fig. 1b ). In contrast, cells in close proximity but no direct contact do not show any morphological abnormalities (*). Scale bar: 20 µm ( n = 3). b RTG-2 cells (c) were challenged with S. parasitica (h) after 1 h incubation with SpHtp3-mRFP. A hyphal tip (arrowhead, DIC) is attacking an RTG-2 cell. Magnification of the infected cell (red square) at different time points (bottom) show vesicles disappearing within a minute (arrowheads). See also Supplementary Movie 1 . In contrast, cells in close proximity but no direct contact to S. parasitica contain less disappearing vesicles (*). Scale bar: 20 µm ( n = 3). c Quantification of SpHtp3-mRFP containing vesicles of RTG-2 cells from b over time. d Vesicle release of SpHtp3-mRFP into the cytosol of RTG-2 cells after pre-incubation with SpHtp1 21–198 -His 6 at pH 7.5. SpHtp3 accumulates in vesicles of RTG-2 cells after self-translocation (see also Fig. 2d ). However, after co-incubation of SpHtp1 with SpHtp3, the number of vesicles in the periphery of the cells is reduced and the cytosolic fluorescence of RFP increased. Pictures were taken with a Zeiss Imager M2. Scale bar: 20 µm ( n = 2). e Fluorescence intensity of SpHtp3-mRFP across the cell as indicated by dashed lines in d . f In vitro complex formation of recombinant SpHtp1-His 6 and SpHtp3-His 6 after cross-link verified by LC-MS/MS (Supplementary Table 2 ). An additional band, which only appears in the sample with both proteins is highlighted (Complex)
    Figure Legend Snippet: SpHtp3 is released from vesicles with the help of SpHtp1 from S. parasitica . a RTG-2 cells in direct contact with S. parasitica are shrunk with a condensed nucleus. In these cells, no cytosolic RNA (SytoRNA) can be detected and infected cells contain a high amount of vesicles (membrane stain FM4-64FX, see also Fig. 1b ). In contrast, cells in close proximity but no direct contact do not show any morphological abnormalities (*). Scale bar: 20 µm ( n = 3). b RTG-2 cells (c) were challenged with S. parasitica (h) after 1 h incubation with SpHtp3-mRFP. A hyphal tip (arrowhead, DIC) is attacking an RTG-2 cell. Magnification of the infected cell (red square) at different time points (bottom) show vesicles disappearing within a minute (arrowheads). See also Supplementary Movie 1 . In contrast, cells in close proximity but no direct contact to S. parasitica contain less disappearing vesicles (*). Scale bar: 20 µm ( n = 3). c Quantification of SpHtp3-mRFP containing vesicles of RTG-2 cells from b over time. d Vesicle release of SpHtp3-mRFP into the cytosol of RTG-2 cells after pre-incubation with SpHtp1 21–198 -His 6 at pH 7.5. SpHtp3 accumulates in vesicles of RTG-2 cells after self-translocation (see also Fig. 2d ). However, after co-incubation of SpHtp1 with SpHtp3, the number of vesicles in the periphery of the cells is reduced and the cytosolic fluorescence of RFP increased. Pictures were taken with a Zeiss Imager M2. Scale bar: 20 µm ( n = 2). e Fluorescence intensity of SpHtp3-mRFP across the cell as indicated by dashed lines in d . f In vitro complex formation of recombinant SpHtp1-His 6 and SpHtp3-His 6 after cross-link verified by LC-MS/MS (Supplementary Table 2 ). An additional band, which only appears in the sample with both proteins is highlighted (Complex)

    Techniques Used: Infection, Staining, Incubation, Translocation Assay, Fluorescence, In Vitro, Recombinant, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)
    Figure Legend Snippet: SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)

    Techniques Used: Sequencing, Activity Assay, Negative Control, Functional Assay, Mutagenesis, Translocation Assay, Recombinant

    SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Inhibition, Incubation

    SpHtp3 self-translocates into host cells via its C-terminus. a Self-translocation of SpHtp3-mRFP wt, SpHtp3-mRFP 21–55 (containing the RTLR sequence), a mutant of SpHtp3-mRFP RTLR/GTLG and mRFP only into living RTG-2 cells at pH 5.5. Scale bar: 20 µm ( n = 3). b Quantitative FACS analysis of RTG-2 cells from Figs. 2d and 3a. Error bars denote s.e.m. ( n = 3). *** p
    Figure Legend Snippet: SpHtp3 self-translocates into host cells via its C-terminus. a Self-translocation of SpHtp3-mRFP wt, SpHtp3-mRFP 21–55 (containing the RTLR sequence), a mutant of SpHtp3-mRFP RTLR/GTLG and mRFP only into living RTG-2 cells at pH 5.5. Scale bar: 20 µm ( n = 3). b Quantitative FACS analysis of RTG-2 cells from Figs. 2d and 3a. Error bars denote s.e.m. ( n = 3). *** p

    Techniques Used: Translocation Assay, Sequencing, Mutagenesis, FACS

    6) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.
    Figure Legend Snippet: Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.

    Techniques Used: Western Blot, Quantitative RT-PCR, Staining, Recombinant

    7) Product Images from "miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma"

    Article Title: miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma

    Journal: Cell Death and Differentiation

    doi: 10.1038/s41418-017-0053-8

    miR-137 directly targets SLC1A5 in melanoma cells. a Sequence alignment of miR-137 and the 3′-UTR of SLC1A5 or SLC38A1. The seed sequence of miR-137 and the binding sites in 3′-UTR are indicated in red. The 3′-UTR mutants containing mismatched nucleotides are shown at the bottom. The binding site of SLC1A5 is highly conserved in several species (left), but the binding site of SLC38A1 is not conserved between different species (right). b miR-137 overexpression inhibited the expression of 3′-UTR-luciferase reporter of SLC1A5 in A375 and G-361 cells, but the mutant construct was immune to miR-137. Data are mean ± SD from three independent experiments. *** p
    Figure Legend Snippet: miR-137 directly targets SLC1A5 in melanoma cells. a Sequence alignment of miR-137 and the 3′-UTR of SLC1A5 or SLC38A1. The seed sequence of miR-137 and the binding sites in 3′-UTR are indicated in red. The 3′-UTR mutants containing mismatched nucleotides are shown at the bottom. The binding site of SLC1A5 is highly conserved in several species (left), but the binding site of SLC38A1 is not conserved between different species (right). b miR-137 overexpression inhibited the expression of 3′-UTR-luciferase reporter of SLC1A5 in A375 and G-361 cells, but the mutant construct was immune to miR-137. Data are mean ± SD from three independent experiments. *** p

    Techniques Used: Sequencing, Binding Assay, Over Expression, Expressing, Luciferase, Mutagenesis, Construct

    8) Product Images from "Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas"

    Article Title: Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04128-5

    Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Mutagenesis, Expressing, Transformation Assay, Growth Assay, Stable Transfection, Plasmid Preparation, MTT Assay, Proliferation Assay, Wound Healing Assay

    Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation

    Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P
    Figure Legend Snippet: Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P

    Techniques Used: Inhibition, Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation, Proliferation Assay

    9) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P

    Techniques Used: Binding Assay, Luciferase, Western Blot, Quantitative RT-PCR, Construct, Expressing, Staining, Recombinant, Agarose Gel Electrophoresis, In Vitro, Activity Assay

    N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.
    Figure Legend Snippet: N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.

    Techniques Used: Labeling, Staining, Recombinant, Purification, Western Blot, Quantitative RT-PCR

    Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.
    Figure Legend Snippet: Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.

    Techniques Used: Western Blot, Quantitative RT-PCR, Staining, Recombinant

    N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P

    Techniques Used: Mutagenesis, Western Blot, Quantitative RT-PCR

    10) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.
    Figure Legend Snippet: METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.

    Techniques Used: Western Blot, Histone Association Assay, Binding Assay, Transfection, Mass Spectrometry, SDS Page, Staining

    11) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.
    Figure Legend Snippet: METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.

    Techniques Used: Western Blot, Histone Association Assay, Binding Assay, Transfection, Mass Spectrometry, SDS Page, Staining

    12) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P

    Techniques Used: Binding Assay, Luciferase, Western Blot, Quantitative RT-PCR, Construct, Expressing, Staining, Recombinant, Agarose Gel Electrophoresis, In Vitro, Activity Assay

    N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.
    Figure Legend Snippet: N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.

    Techniques Used: Labeling, Staining, Recombinant, Purification, Western Blot, Quantitative RT-PCR

    Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.
    Figure Legend Snippet: Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.

    Techniques Used: Western Blot, Quantitative RT-PCR, Staining, Recombinant

    N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P

    Techniques Used: Mutagenesis, Western Blot, Quantitative RT-PCR

    13) Product Images from "The dual role of chloride in synaptic vesicle glutamate transport"

    Article Title: The dual role of chloride in synaptic vesicle glutamate transport

    Journal: eLife

    doi: 10.7554/eLife.34896

    Chloride and glutamate currents in endosomes expressing mutant VGLUTs. Compiled data ( A–C ) and sample traces ( D–I ) for alanine substitutions at conserved arginine residues in TM7, 1 and 4 of VGLUT1 ( A ), VGLUT2 ( B,D–F ) and VGLUT3 ( C,G–I ). All endosomes were recorded with 140 mM NMDG Cl at pH 5.0 in the pipette (n = 3–5) except for those expressing the arginine mutant in TM4, which were recorded with 140 mM NMDG gluconate (0 mM Cl - ) in the pipette (n = 4–7). The baselines for outward Cl - and glutamate currents were defined as in Figure 1—figure supplement 1 and Figure 2—figure supplement 2 . Bar graphs indicate mean ± SEM. +p
    Figure Legend Snippet: Chloride and glutamate currents in endosomes expressing mutant VGLUTs. Compiled data ( A–C ) and sample traces ( D–I ) for alanine substitutions at conserved arginine residues in TM7, 1 and 4 of VGLUT1 ( A ), VGLUT2 ( B,D–F ) and VGLUT3 ( C,G–I ). All endosomes were recorded with 140 mM NMDG Cl at pH 5.0 in the pipette (n = 3–5) except for those expressing the arginine mutant in TM4, which were recorded with 140 mM NMDG gluconate (0 mM Cl - ) in the pipette (n = 4–7). The baselines for outward Cl - and glutamate currents were defined as in Figure 1—figure supplement 1 and Figure 2—figure supplement 2 . Bar graphs indicate mean ± SEM. +p

    Techniques Used: Expressing, Mutagenesis, Transferring

    14) Product Images from "HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission"

    Article Title: HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission

    Journal: Cell host & microbe

    doi: 10.1016/j.chom.2018.12.008

    Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.
    Figure Legend Snippet: Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.

    Techniques Used: Migration, Expressing, Infection, Injection, Mutagenesis, Mouse Assay

    The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .
    Figure Legend Snippet: The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .

    Techniques Used: Infection, Expressing, Fluorescence

    Related Articles

    Clone Assay:

    Article Title: Phosphorylation of SDT repeats in the MDC1 N terminus triggers retention of NBS1 at the DNA damage–modified chromatin
    Article Snippet: To the shorter N-terminal MDC1 fragments, a triple nuclear localization signal was added by cloning the fragments into pCMV-myc/nuc (Invitrogen) vector and thereafter subcloning back into pcDNA4/TO by PCR. .. The QuikChange Site-Directed Mutagenesis kit (Stratagene) was used to generate point mutations; deletions were made using the Phusion Site-Directed Mutagenesis kit (New England Biolabs, Inc.) and performed according to the manufacturer's instructions.

    Article Title: OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas
    Article Snippet: Paragraph title: Cloning and mutagenesis of the rat 1.1 kb Ovol1 promoter ... A point mutation in the E-box 1 was created using a mismatch in the mutagenic primer and a kit (Phusion Site-Directed Mutagenesis Kit; New England Biolabs, Ipswich, MA, USA).

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: DNA fragments were cloned into the pGL3-Basic plasmid. .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: Plasmid pET20b-6pgdh based on the two DNA fragments was obtained using a Simple Cloning method . .. The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit.

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Paragraph title: Cloning and site-specific mutagenesis of CBP60g ... Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Article Title: MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF
    Article Snippet: In addition, Renilla luciferase (hRLuc) reporter driven by a CMV promoter was cloned into the same vector, serving as the tracking gene and internal control. .. The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs.

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: However, the BtgZ1 enzyme site was found inefficient in cloning and was removed by SpeI and EcoR1 enzyme digestion and then replaced with an Arabidopsis U6 promoter‐driven sgRNA cassette (AtU6‐26 promoter/Linker/sgRNA scaffold/AtU6‐26 terminator) derived from pCAMBIA Cas9 + sgRNA (Jiang et al ., ). .. For this dual sgRNA entry vector, one seed RNA is inserted at the BsaI site driven by the FveU6‐2 promoter, and a second seed RNA is inserted into the JH4 vector via Q5 site‐directed mutagenesis kit (NEB, Ipswich, MA) and driven by the AtU6‐26 promoter.

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: Paragraph title: Cloning and mutagenesis ... All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation.

    Luciferase:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: Paragraph title: Plasmid Construction, RNA Interference, Transfections, and Luciferase Assay. ... A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Article Title: MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF
    Article Snippet: Firefly and Renilla luciferase activities were measured using a Dual Luciferase Reporter Assay System kit (Promega Corp. WI, USA) and each transfected well was assayed in triplicate as described . .. The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs.

    Reporter Assay:

    Article Title: MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF
    Article Snippet: Paragraph title: Dual-Luciferase Reporter Assay ... The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs.

    Synthesized:

    Article Title: MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF
    Article Snippet: .. The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs. ..

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: This synthesized fragment was inserted into the pENTR2b vector (Invitrogen, Carlsbad, CA) at SalI and EcoRI sites to yield JH2 vector. .. For this dual sgRNA entry vector, one seed RNA is inserted at the BsaI site driven by the FveU6‐2 promoter, and a second seed RNA is inserted into the JH4 vector via Q5 site‐directed mutagenesis kit (NEB, Ipswich, MA) and driven by the AtU6‐26 promoter.

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: The Arthrobacter species FB24 (Arsp-FB24) Arth_1007 intein precursor (locus tag Arth_1007, accession number YP_830503) with an N-terminal His tag was synthesized by DNA2.0, Inc (Menlo Park, CA). .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation.

    Blocking Assay:

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: Mutations were made in the homing nuclease domain active site to block endonuclease activity (Asp123 Ala and Asp219 Ala). .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation.

    Amplification:

    Article Title: OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas
    Article Snippet: The 1.1 kb sequence encompassing the 5′ region from −841 to +230 of the rat Ovol1 gene containing the E-box 1 was amplified by PCR using rat genomic DNA as template and cloned into the pGL2-Basic vector. .. A point mutation in the E-box 1 was created using a mismatch in the mutagenic primer and a kit (Phusion Site-Directed Mutagenesis Kit; New England Biolabs, Ipswich, MA, USA).

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: Site directed mutagenesis The Tm 6PGDH gene was amplified from plasmid by a primer pair of 6PGDH_IF and 6PGDH_IR. pET20b vector backbone was amplified with a primer pair of 6PGDH_VF and 6PGDH_VR. .. The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit.

    Article Title: Crystal Structure of Cardiac-specific Histone Methyltransferase SmyD1 Reveals Unusual Active Site Architecture *
    Article Snippet: SmyD1 mutants were prepared using the Phusion Site-directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's instructions. .. The amplified linear PCR product was then circularized in a ligation reaction with Quick T4 DNA Ligase (New England Biolabs).

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Cloning and site-specific mutagenesis of CBP60g To make the complementation and transgenic site-specific mutagenesis constructs, the genomic coding sequence (with introns) of At5g26920 and an additional 1093 base pairs of DNA sequence upstream of its start codon was first amplified by polymerase chain reaction (PCR) using KOD Hot Start DNA Polymerase (Novagen, CA) and TA-cloned into the pCR8 vector following the manufacturer's protocol (Invitrogen, CA). .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Article Title: High-Throughput Screening of Coenzyme Preference Change of Thermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+
    Article Snippet: Construction of mutant libraries by saturation mutagenesis The two-round DNA mutant libraries were constructed by the NEB Phusion site-directed mutagenesis kit. .. In the first round, the single-site saturation mutagenesis library R31 was amplified based on pET28a-Ptac -6pgdh by using a pair of degenerate primers 31_NNK_F/31_NNK_R.

    Activity Assay:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. Luciferase activity was measured with the Dual-Glo Luciferase Assay system (Promega) and normalized to the Renilla internal control.

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: Mutations were made in the homing nuclease domain active site to block endonuclease activity (Asp123 Ala and Asp219 Ala). .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation.

    Transformation Assay:

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit. .. The PCR product was digested by DpnI followed by the purification of gel electrophoresis using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA) and then transformed into E. coli BL21 (DE3).

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA). .. Arabidopsis transformation was carried out using Agrobacterium tumefaciens stain C58C1 as described by .

    Derivative Assay:

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: However, the BtgZ1 enzyme site was found inefficient in cloning and was removed by SpeI and EcoR1 enzyme digestion and then replaced with an Arabidopsis U6 promoter‐driven sgRNA cassette (AtU6‐26 promoter/Linker/sgRNA scaffold/AtU6‐26 terminator) derived from pCAMBIA Cas9 + sgRNA (Jiang et al ., ). .. For this dual sgRNA entry vector, one seed RNA is inserted at the BsaI site driven by the FveU6‐2 promoter, and a second seed RNA is inserted into the JH4 vector via Q5 site‐directed mutagenesis kit (NEB, Ipswich, MA) and driven by the AtU6‐26 promoter.

    Transfection:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: Paragraph title: Plasmid Construction, RNA Interference, Transfections, and Luciferase Assay. ... A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Article Title: MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF
    Article Snippet: Firefly and Renilla luciferase activities were measured using a Dual Luciferase Reporter Assay System kit (Promega Corp. WI, USA) and each transfected well was assayed in triplicate as described . .. The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs.

    Ligation:

    Article Title: Crystal Structure of Cardiac-specific Histone Methyltransferase SmyD1 Reveals Unusual Active Site Architecture *
    Article Snippet: SmyD1 mutants were prepared using the Phusion Site-directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's instructions. .. The amplified linear PCR product was then circularized in a ligation reaction with Quick T4 DNA Ligase (New England Biolabs).

    Introduce:

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: .. The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit. .. The mutant N32D, N32D/R33I/T34I, N32D/R33L/T34S, and N32E/R33I/T34I were prepared by their respective primer pairs ( ).

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation. .. Expression, purification, and protein characterization Precursors were expressed in either the E. coli NEB Turbo strain or NEB Express strain (New England Biolabs) by induction with 0.4 mM isopropyl-β-D-thiogalactoside (IPTG) at OD600 of 0.4–0.6 in 10 ml LB medium containing 100 µg/ml ampicillin for 2 hours at 37°C or 15°C overnight.

    Generated:

    Article Title: Phosphorylation of SDT repeats in the MDC1 N terminus triggers retention of NBS1 at the DNA damage–modified chromatin
    Article Snippet: HA-MDC1 fragments were generated by PCR and subcloned into a pcDNA4/TO (Invitrogen) plasmid. .. The QuikChange Site-Directed Mutagenesis kit (Stratagene) was used to generate point mutations; deletions were made using the Phusion Site-Directed Mutagenesis kit (New England Biolabs, Inc.) and performed according to the manufacturer's instructions.

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    DNA Sequencing:

    Article Title: Crystal Structure of Cardiac-specific Histone Methyltransferase SmyD1 Reveals Unusual Active Site Architecture *
    Article Snippet: SmyD1 mutants were prepared using the Phusion Site-directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's instructions. .. After transforming into competent E. coli DH5α cells, the plasmid sequences were verified by DNA sequencing.

    Polymerase Chain Reaction:

    Article Title: Phosphorylation of SDT repeats in the MDC1 N terminus triggers retention of NBS1 at the DNA damage–modified chromatin
    Article Snippet: To the shorter N-terminal MDC1 fragments, a triple nuclear localization signal was added by cloning the fragments into pCMV-myc/nuc (Invitrogen) vector and thereafter subcloning back into pcDNA4/TO by PCR. .. The QuikChange Site-Directed Mutagenesis kit (Stratagene) was used to generate point mutations; deletions were made using the Phusion Site-Directed Mutagenesis kit (New England Biolabs, Inc.) and performed according to the manufacturer's instructions.

    Article Title: OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas
    Article Snippet: The 1.1 kb sequence encompassing the 5′ region from −841 to +230 of the rat Ovol1 gene containing the E-box 1 was amplified by PCR using rat genomic DNA as template and cloned into the pGL2-Basic vector. .. A point mutation in the E-box 1 was created using a mismatch in the mutagenic primer and a kit (Phusion Site-Directed Mutagenesis Kit; New England Biolabs, Ipswich, MA, USA).

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit. .. PCR reaction solution (50 μL) containing 1 ng of plasmid template (pET20b-6pgdh ) was conducted as follows: 98 °C denaturation for 1 min; 20 cycles of 98 °C denaturation for 30 s, 60 °C annealing for 30 s and 72 °C extension for 2.5 min; and 72 °C extension for 5 min.

    Article Title: Crystal Structure of Cardiac-specific Histone Methyltransferase SmyD1 Reveals Unusual Active Site Architecture *
    Article Snippet: SmyD1 mutants were prepared using the Phusion Site-directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's instructions. .. Briefly, point mutations were introduced with the phosphorylated primers using PCR, in which pSUMO-SmyD1 (see above) containing the wild-type SmyD1 gene was used as PCR template.

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Cloning and site-specific mutagenesis of CBP60g To make the complementation and transgenic site-specific mutagenesis constructs, the genomic coding sequence (with introns) of At5g26920 and an additional 1093 base pairs of DNA sequence upstream of its start codon was first amplified by polymerase chain reaction (PCR) using KOD Hot Start DNA Polymerase (Novagen, CA) and TA-cloned into the pCR8 vector following the manufacturer's protocol (Invitrogen, CA). .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Article Title: High-Throughput Screening of Coenzyme Preference Change of Thermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+
    Article Snippet: Construction of mutant libraries by saturation mutagenesis The two-round DNA mutant libraries were constructed by the NEB Phusion site-directed mutagenesis kit. .. PCR reaction solution (50 μL) containing 1 ng of plasmid template was conducted as follows: 98 °C denaturation for 1 min; 20 cycles of 98 °C denaturation for 30 s, 60 °C annealing for 30 s and 72 °C extension for 3 min; and 72 °C extension for 5 min.

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: The Arsp-FB24 Arth_1007 intein with 5 native extein residues on both sides was cloned by PCR into a model precursor termed MIP, with the intein flanked by the E. coli Maltose Binding Protein (M) and the ΔSal fragment of D. immitis paramyosin (P) as previously described , , , . .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation.

    Binding Assay:

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: For testing CaM binding, mapping the CBP60g CBD, and identifying crucial amino acids of the CBP60g CBD, full length and various partial cDNA sequences of CBP60g (without the promoter or introns) was cloned into the pDEST15 vector (Invitrogen, CA) and expressed in E. coli . .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: The Arsp-FB24 Arth_1007 intein with 5 native extein residues on both sides was cloned by PCR into a model precursor termed MIP, with the intein flanked by the E. coli Maltose Binding Protein (M) and the ΔSal fragment of D. immitis paramyosin (P) as previously described , , , . .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation.

    Nucleic Acid Electrophoresis:

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit. .. The PCR product was digested by DpnI followed by the purification of gel electrophoresis using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA) and then transformed into E. coli BL21 (DE3).

    Mutagenesis:

    Article Title: Phosphorylation of SDT repeats in the MDC1 N terminus triggers retention of NBS1 at the DNA damage–modified chromatin
    Article Snippet: .. The QuikChange Site-Directed Mutagenesis kit (Stratagene) was used to generate point mutations; deletions were made using the Phusion Site-Directed Mutagenesis kit (New England Biolabs, Inc.) and performed according to the manufacturer's instructions. ..

    Article Title: OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas
    Article Snippet: .. A point mutation in the E-box 1 was created using a mismatch in the mutagenic primer and a kit (Phusion Site-Directed Mutagenesis Kit; New England Biolabs, Ipswich, MA, USA). .. Primers for quantitative PCR and RT-PCR experiments to detect pulled-down DNA fragments from ChIP experiments are in .

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: .. Two guide RNA sequences were inserted into entry vector JH4 by BsaI digestion/ligation and Q5 site‐directed mutagenesis kit (NEB), respectively, through two primer pairs (Fv ARF8‐F/Fv ARF8‐R and Fv ARF8‐F3/Fv ARF8‐R3) (Table ). ..

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: .. The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit. .. The mutant N32D, N32D/R33I/T34I, N32D/R33L/T34S, and N32E/R33I/T34I were prepared by their respective primer pairs ( ).

    Article Title: Crystal Structure of Cardiac-specific Histone Methyltransferase SmyD1 Reveals Unusual Active Site Architecture *
    Article Snippet: .. SmyD1 mutants were prepared using the Phusion Site-directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's instructions. .. Briefly, point mutations were introduced with the phosphorylated primers using PCR, in which pSUMO-SmyD1 (see above) containing the wild-type SmyD1 gene was used as PCR template.

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA). .. For determination of CaM binding and production of transgenic plants carrying mutated versions of CBP60g , site-specific mutagenesis was carried out beginning with a full-length cDNA clone or a genomic clone, respectively, in pCR8.

    Article Title: MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF
    Article Snippet: .. The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs. ..

    Article Title: Bacterial encapsulins as orthogonal compartments for mammalian cell engineering
    Article Snippet: .. In order to generate encapsulin derivatives featuring C-terminal acidic peptides of magnetotactic bacteria Mms proteins that are implicated in mediation of magnetite formation either the C-terminal peptide of Mms6 (YAYMKSRDIESAQSDEEVELRDALA) or Mms7 (YVWARRRHGTPDLSDDALLAAAGEE) of Magnetospirillum magneticum were fused either to the inward-facing N-terminus of MxEncAFLAG or to the C-terminus of either the MxEncB or C using Q5® Site-Directed Mutagenesis. .. Low passage number HEK293T (ECACC: 12022001, obtained via Sigma-Aldrich) and CHO (ECACC: 85050302, obtained via Sigma-Aldrich) cells were cultured in advanced DMEM with 10 % FBS and penicillin–streptomycin at 100 µg/ml at 37 °C and 5% CO2 .

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: .. For this dual sgRNA entry vector, one seed RNA is inserted at the BsaI site driven by the FveU6‐2 promoter, and a second seed RNA is inserted into the JH4 vector via Q5 site‐directed mutagenesis kit (NEB, Ipswich, MA) and driven by the AtU6‐26 promoter. ..

    Article Title: High-Throughput Screening of Coenzyme Preference Change of Thermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+
    Article Snippet: .. Construction of mutant libraries by saturation mutagenesis The two-round DNA mutant libraries were constructed by the NEB Phusion site-directed mutagenesis kit. .. In the first round, the single-site saturation mutagenesis library R31 was amplified based on pET28a-Ptac -6pgdh by using a pair of degenerate primers 31_NNK_F/31_NNK_R.

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation. .. Expression, purification, and protein characterization Precursors were expressed in either the E. coli NEB Turbo strain or NEB Express strain (New England Biolabs) by induction with 0.4 mM isopropyl-β-D-thiogalactoside (IPTG) at OD600 of 0.4–0.6 in 10 ml LB medium containing 100 µg/ml ampicillin for 2 hours at 37°C or 15°C overnight.

    Subcloning:

    Article Title: Phosphorylation of SDT repeats in the MDC1 N terminus triggers retention of NBS1 at the DNA damage–modified chromatin
    Article Snippet: To the shorter N-terminal MDC1 fragments, a triple nuclear localization signal was added by cloning the fragments into pCMV-myc/nuc (Invitrogen) vector and thereafter subcloning back into pcDNA4/TO by PCR. .. The QuikChange Site-Directed Mutagenesis kit (Stratagene) was used to generate point mutations; deletions were made using the Phusion Site-Directed Mutagenesis kit (New England Biolabs, Inc.) and performed according to the manufacturer's instructions.

    Purification:

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit. .. The PCR product was digested by DpnI followed by the purification of gel electrophoresis using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA) and then transformed into E. coli BL21 (DE3).

    Sequencing:

    Article Title: OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas
    Article Snippet: The 1.1 kb sequence encompassing the 5′ region from −841 to +230 of the rat Ovol1 gene containing the E-box 1 was amplified by PCR using rat genomic DNA as template and cloned into the pGL2-Basic vector. .. A point mutation in the E-box 1 was created using a mismatch in the mutagenic primer and a kit (Phusion Site-Directed Mutagenesis Kit; New England Biolabs, Ipswich, MA, USA).

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: .. The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit. .. The mutant N32D, N32D/R33I/T34I, N32D/R33L/T34S, and N32E/R33I/T34I were prepared by their respective primer pairs ( ).

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Cloning and site-specific mutagenesis of CBP60g To make the complementation and transgenic site-specific mutagenesis constructs, the genomic coding sequence (with introns) of At5g26920 and an additional 1093 base pairs of DNA sequence upstream of its start codon was first amplified by polymerase chain reaction (PCR) using KOD Hot Start DNA Polymerase (Novagen, CA) and TA-cloned into the pCR8 vector following the manufacturer's protocol (Invitrogen, CA). .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: For this dual sgRNA entry vector, one seed RNA is inserted at the BsaI site driven by the FveU6‐2 promoter, and a second seed RNA is inserted into the JH4 vector via Q5 site‐directed mutagenesis kit (NEB, Ipswich, MA) and driven by the AtU6‐26 promoter. .. To insert the target seed sequence, 5′‐gctc G[19 bp target sequence]‐3′ is annealed to a reverse‐strand oligo (5′‐aaac G[19 bp in reverse complement]‐3′) to create the double‐stranded target sequence, which is inserted into JH1 at the Bsa1 sites (Figure a).

    Construct:

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: Two guide RNA sequences were inserted into entry vector JH4 by BsaI digestion/ligation and Q5 site‐directed mutagenesis kit (NEB), respectively, through two primer pairs (Fv ARF8‐F/Fv ARF8‐R and Fv ARF8‐F3/Fv ARF8‐R3) (Table ). .. JH19‐FveTAA1 was constructed similarly using two different primer pairs (Fv TAA1‐F/Fv TAA1‐R and Fv TAA1‐F3/Fv TAA1‐R3) (Table ).

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Cloning and site-specific mutagenesis of CBP60g To make the complementation and transgenic site-specific mutagenesis constructs, the genomic coding sequence (with introns) of At5g26920 and an additional 1093 base pairs of DNA sequence upstream of its start codon was first amplified by polymerase chain reaction (PCR) using KOD Hot Start DNA Polymerase (Novagen, CA) and TA-cloned into the pCR8 vector following the manufacturer's protocol (Invitrogen, CA). .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Article Title: High-Throughput Screening of Coenzyme Preference Change of Thermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+
    Article Snippet: .. Construction of mutant libraries by saturation mutagenesis The two-round DNA mutant libraries were constructed by the NEB Phusion site-directed mutagenesis kit. .. In the first round, the single-site saturation mutagenesis library R31 was amplified based on pET28a-Ptac -6pgdh by using a pair of degenerate primers 31_NNK_F/31_NNK_R.

    Article Title: The Arthrobacter Species FB24 Arth_1007 (DnaB) Intein Is a Pseudogene
    Article Snippet: .. All mutations were constructed using the Phusion™ site-directed mutagenesis kit (New England Biolabs) with appropriate primers to introduce the desired mutation. .. Expression, purification, and protein characterization Precursors were expressed in either the E. coli NEB Turbo strain or NEB Express strain (New England Biolabs) by induction with 0.4 mM isopropyl-β-D-thiogalactoside (IPTG) at OD600 of 0.4–0.6 in 10 ml LB medium containing 100 µg/ml ampicillin for 2 hours at 37°C or 15°C overnight.

    CRISPR:

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: Paragraph title: CRISPR/Cas9 editing of ARF8 and TAA1 ... Two guide RNA sequences were inserted into entry vector JH4 by BsaI digestion/ligation and Q5 site‐directed mutagenesis kit (NEB), respectively, through two primer pairs (Fv ARF8‐F/Fv ARF8‐R and Fv ARF8‐F3/Fv ARF8‐R3) (Table ).

    Plasmid Preparation:

    Article Title: Phosphorylation of SDT repeats in the MDC1 N terminus triggers retention of NBS1 at the DNA damage–modified chromatin
    Article Snippet: To the shorter N-terminal MDC1 fragments, a triple nuclear localization signal was added by cloning the fragments into pCMV-myc/nuc (Invitrogen) vector and thereafter subcloning back into pcDNA4/TO by PCR. .. The QuikChange Site-Directed Mutagenesis kit (Stratagene) was used to generate point mutations; deletions were made using the Phusion Site-Directed Mutagenesis kit (New England Biolabs, Inc.) and performed according to the manufacturer's instructions.

    Article Title: OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas
    Article Snippet: The 1.1 kb sequence encompassing the 5′ region from −841 to +230 of the rat Ovol1 gene containing the E-box 1 was amplified by PCR using rat genomic DNA as template and cloned into the pGL2-Basic vector. .. A point mutation in the E-box 1 was created using a mismatch in the mutagenic primer and a kit (Phusion Site-Directed Mutagenesis Kit; New England Biolabs, Ipswich, MA, USA).

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: Paragraph title: Plasmid Construction, RNA Interference, Transfections, and Luciferase Assay. ... A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: .. Two guide RNA sequences were inserted into entry vector JH4 by BsaI digestion/ligation and Q5 site‐directed mutagenesis kit (NEB), respectively, through two primer pairs (Fv ARF8‐F/Fv ARF8‐R and Fv ARF8‐F3/Fv ARF8‐R3) (Table ). ..

    Article Title: Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries
    Article Snippet: Plasmid pET20b-6pgdh based on the two DNA fragments was obtained using a Simple Cloning method . .. The QuickChangeTM site-directed mutagenesis method (Stratagene, La Jolla, CA) was used to introduce point mutations into the Tm 6PGDH sequence according to the protocol of the NEB Phusion site-directed mutagenesis kit.

    Article Title: Crystal Structure of Cardiac-specific Histone Methyltransferase SmyD1 Reveals Unusual Active Site Architecture *
    Article Snippet: SmyD1 mutants were prepared using the Phusion Site-directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's instructions. .. After transforming into competent E. coli DH5α cells, the plasmid sequences were verified by DNA sequencing.

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: For testing CaM binding, mapping the CBP60g CBD, and identifying crucial amino acids of the CBP60g CBD, full length and various partial cDNA sequences of CBP60g (without the promoter or introns) was cloned into the pDEST15 vector (Invitrogen, CA) and expressed in E. coli . .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Article Title: MicroRNA-377 Regulates Mesenchymal Stem Cell-Induced Angiogenesis in Ischemic Hearts by Targeting VEGF
    Article Snippet: .. The mutated pEZX-MT01 plasmid containing the mutated VEGF-3′UTR with mutation in the seed region was synthesized using Phusion™ site-directed mutagenesis kit (New England Biolabs. ..

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: .. For this dual sgRNA entry vector, one seed RNA is inserted at the BsaI site driven by the FveU6‐2 promoter, and a second seed RNA is inserted into the JH4 vector via Q5 site‐directed mutagenesis kit (NEB, Ipswich, MA) and driven by the AtU6‐26 promoter. ..

    Article Title: High-Throughput Screening of Coenzyme Preference Change of Thermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+
    Article Snippet: Construction of mutant libraries by saturation mutagenesis The two-round DNA mutant libraries were constructed by the NEB Phusion site-directed mutagenesis kit. .. The two-site saturation mutagenesis library A30/T32 was amplified from plasmid of pET28a-Ptac -6pgdh (R31I) by using a pair of degenerate primers 30_32_NNK_F/30_32_NNK_R.

    Negative Control:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Transgenic Assay:

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Cloning and site-specific mutagenesis of CBP60g To make the complementation and transgenic site-specific mutagenesis constructs, the genomic coding sequence (with introns) of At5g26920 and an additional 1093 base pairs of DNA sequence upstream of its start codon was first amplified by polymerase chain reaction (PCR) using KOD Hot Start DNA Polymerase (Novagen, CA) and TA-cloned into the pCR8 vector following the manufacturer's protocol (Invitrogen, CA). .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Staining:

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA). .. Arabidopsis transformation was carried out using Agrobacterium tumefaciens stain C58C1 as described by .

    Chick Chorioallantoic Membrane Assay:

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: For testing CaM binding, mapping the CBP60g CBD, and identifying crucial amino acids of the CBP60g CBD, full length and various partial cDNA sequences of CBP60g (without the promoter or introns) was cloned into the pDEST15 vector (Invitrogen, CA) and expressed in E. coli . .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 site directed mutagenesis kit
    Diagrams illustrating gateway‐based CRISPR vectors. (a) Illustration of the single sg RNA gateway entry vector JH 1. A sg RNA cloning cassette (enlarged on top) is inserted between the attL1 and attL2 recombination sites of pENTR 2b. Two inverted BsaI restriction enzyme recognition sites enable easy cloning of the double‐stranded target sequence. pENTR 2b‐R and pENTR 2b‐F in the vector map are two sequencing primers. (b) Illustration of the dual sg RNA gateway entry vector JH 4. The dual sg RNA cloning cassette (enlarged on top) is inserted between the attL1 and attL2 recombination sites of pENTR 2b. One sg RNA is driven by the FveU6‐2 promoter similarly to JH 1. The second sg RNA is driven by the Arabidopsis U6‐26 promoter. A linker sequence GCGCTTCAAGGTGCACATGG between the AtU6‐26 promoter and the sg RNA scaffold can be replaced with a 20 bp target sequence using the <t>Q5</t> site‐directed mutagenesis kit. (c) The gateway destination vector JH 12 is a hygromycin‐resistant binary vector harbouring a At UBQ 10 promoter‐driven Cas9. (d) The gateway destination vector JH 19, a binary vector similar to JH 12 except that JH 19, harbours a 35S:: NSL ‐3 XGFP cassette. The GFP fluorescence allows easy visualization and identification of transgenic plants.
    Q5 Site Directed Mutagenesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 800 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 site directed mutagenesis kit/product/New England Biolabs
    Average 99 stars, based on 800 article reviews
    Price from $9.99 to $1999.99
    q5 site directed mutagenesis kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Diagrams illustrating gateway‐based CRISPR vectors. (a) Illustration of the single sg RNA gateway entry vector JH 1. A sg RNA cloning cassette (enlarged on top) is inserted between the attL1 and attL2 recombination sites of pENTR 2b. Two inverted BsaI restriction enzyme recognition sites enable easy cloning of the double‐stranded target sequence. pENTR 2b‐R and pENTR 2b‐F in the vector map are two sequencing primers. (b) Illustration of the dual sg RNA gateway entry vector JH 4. The dual sg RNA cloning cassette (enlarged on top) is inserted between the attL1 and attL2 recombination sites of pENTR 2b. One sg RNA is driven by the FveU6‐2 promoter similarly to JH 1. The second sg RNA is driven by the Arabidopsis U6‐26 promoter. A linker sequence GCGCTTCAAGGTGCACATGG between the AtU6‐26 promoter and the sg RNA scaffold can be replaced with a 20 bp target sequence using the Q5 site‐directed mutagenesis kit. (c) The gateway destination vector JH 12 is a hygromycin‐resistant binary vector harbouring a At UBQ 10 promoter‐driven Cas9. (d) The gateway destination vector JH 19, a binary vector similar to JH 12 except that JH 19, harbours a 35S:: NSL ‐3 XGFP cassette. The GFP fluorescence allows easy visualization and identification of transgenic plants.

    Journal: Plant Biotechnology Journal

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation

    doi: 10.1111/pbi.12922

    Figure Lengend Snippet: Diagrams illustrating gateway‐based CRISPR vectors. (a) Illustration of the single sg RNA gateway entry vector JH 1. A sg RNA cloning cassette (enlarged on top) is inserted between the attL1 and attL2 recombination sites of pENTR 2b. Two inverted BsaI restriction enzyme recognition sites enable easy cloning of the double‐stranded target sequence. pENTR 2b‐R and pENTR 2b‐F in the vector map are two sequencing primers. (b) Illustration of the dual sg RNA gateway entry vector JH 4. The dual sg RNA cloning cassette (enlarged on top) is inserted between the attL1 and attL2 recombination sites of pENTR 2b. One sg RNA is driven by the FveU6‐2 promoter similarly to JH 1. The second sg RNA is driven by the Arabidopsis U6‐26 promoter. A linker sequence GCGCTTCAAGGTGCACATGG between the AtU6‐26 promoter and the sg RNA scaffold can be replaced with a 20 bp target sequence using the Q5 site‐directed mutagenesis kit. (c) The gateway destination vector JH 12 is a hygromycin‐resistant binary vector harbouring a At UBQ 10 promoter‐driven Cas9. (d) The gateway destination vector JH 19, a binary vector similar to JH 12 except that JH 19, harbours a 35S:: NSL ‐3 XGFP cassette. The GFP fluorescence allows easy visualization and identification of transgenic plants.

    Article Snippet: Two guide RNA sequences were inserted into entry vector JH4 by BsaI digestion/ligation and Q5 site‐directed mutagenesis kit (NEB), respectively, through two primer pairs (Fv ARF8‐F/Fv ARF8‐R and Fv ARF8‐F3/Fv ARF8‐R3) (Table ).

    Techniques: CRISPR, Plasmid Preparation, Clone Assay, Sequencing, Mutagenesis, Fluorescence, Transgenic Assay

    Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Mutagenesis, Activation Assay, Transfection, Luciferase, Plasmid Preparation, Expressing, Quantitative RT-PCR

    Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Quantitative RT-PCR, Infection, Migration, Transfection

    P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Infection, Quantitative RT-PCR, Confocal Microscopy, Staining, Software

    ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Transfection, Infection, Quantitative RT-PCR, Plasmid Preparation, Expressing, Mutagenesis, Protease Inhibitor, Migration, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Binding Assay