e0554  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 Site Directed Mutagenesis Kit
    Description:
    Q5 Site Directed Mutagenesis Kit 10 rxns
    Catalog Number:
    e0554s
    Price:
    197
    Size:
    10 rxns
    Category:
    PCR Mutagenesis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs e0554
    Q5 Site Directed Mutagenesis Kit
    Q5 Site Directed Mutagenesis Kit 10 rxns
    https://www.bioz.com/result/e0554/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e0554 - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Molecular Cloning:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Transfection:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Luciferase:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    In Vitro:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Clone Assay:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Mutagenesis:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Biochemical Analysis of the Complex between the Tetrameric Export Adapter Protein Rec of HERV-K/HML-2 and the Responsive RNA Element RcRE pck30
    Article Snippet: .. The mutations in RcRE pck30 were inserted into pSP64_pck30 by using a Phusion site-directed mutagenesis kit (New England BioLabs) according to the manufacturer instructions with primers ordered from Eurofins MWG (see Table S1 in the supplemental material). ..

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Construct:

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Modification:

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Generated:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Polymerase Chain Reaction:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Plasmid Preparation:

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Sequencing:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Binding Assay:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Derivative Assay:

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs pcmv flag abce1
    Mechanism of C-I30-u Formation and Aggregation in Human Cells (A) Immunoblots showing induction of C-I30-U and ATP5a-u (red asterisk) in HeLa, but not HeLa (GFP-Parkin), cells. Blue asterisk indicates a succinate dehydrogenase subunit A (SDHA) form not responding to CCCP or Parkin and is likely SDHA preprotein. (B) Immunostaining showing effect of anisomycin on CCCP-induced C-I30-FLAG aggregation. Arrowheads indicate aggregates outside (white) or inside (yellow) mitochondria. (C) Immunoblots showing the effect of anisomycin on the CTE (red asterisk) of C-I30-FLAG (upper panel) or endogenous ATP5a and C-I30 (lower panel). Blue asterisk indicates SDHA preprotein not responding to anisomycin. (D) Immunoblots showing effects of various modifiers or VCP inhibitor on C-I30-FLAG-u levels. (E) Immunostaining showing effects of various modifiers on CCCP-induced FLAG+ aggregates. Arrowheads indicate aggregates. (F) Immunostaining showing effects of ANKZF1 RNAi or OE on C-I30-FLAG aggregation. (G) CoIP assay showing effect of Parkin on the interaction of ANKZF1 or NEMF with <t>ABCE1.</t> .
    Pcmv Flag Abce1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv flag abce1/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pcmv flag abce1 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Mechanism of C-I30-u Formation and Aggregation in Human Cells (A) Immunoblots showing induction of C-I30-U and ATP5a-u (red asterisk) in HeLa, but not HeLa (GFP-Parkin), cells. Blue asterisk indicates a succinate dehydrogenase subunit A (SDHA) form not responding to CCCP or Parkin and is likely SDHA preprotein. (B) Immunostaining showing effect of anisomycin on CCCP-induced C-I30-FLAG aggregation. Arrowheads indicate aggregates outside (white) or inside (yellow) mitochondria. (C) Immunoblots showing the effect of anisomycin on the CTE (red asterisk) of C-I30-FLAG (upper panel) or endogenous ATP5a and C-I30 (lower panel). Blue asterisk indicates SDHA preprotein not responding to anisomycin. (D) Immunoblots showing effects of various modifiers or VCP inhibitor on C-I30-FLAG-u levels. (E) Immunostaining showing effects of various modifiers on CCCP-induced FLAG+ aggregates. Arrowheads indicate aggregates. (F) Immunostaining showing effects of ANKZF1 RNAi or OE on C-I30-FLAG aggregation. (G) CoIP assay showing effect of Parkin on the interaction of ANKZF1 or NEMF with ABCE1. .

    Journal: Molecular cell

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure

    doi: 10.1016/j.molcel.2019.06.031

    Figure Lengend Snippet: Mechanism of C-I30-u Formation and Aggregation in Human Cells (A) Immunoblots showing induction of C-I30-U and ATP5a-u (red asterisk) in HeLa, but not HeLa (GFP-Parkin), cells. Blue asterisk indicates a succinate dehydrogenase subunit A (SDHA) form not responding to CCCP or Parkin and is likely SDHA preprotein. (B) Immunostaining showing effect of anisomycin on CCCP-induced C-I30-FLAG aggregation. Arrowheads indicate aggregates outside (white) or inside (yellow) mitochondria. (C) Immunoblots showing the effect of anisomycin on the CTE (red asterisk) of C-I30-FLAG (upper panel) or endogenous ATP5a and C-I30 (lower panel). Blue asterisk indicates SDHA preprotein not responding to anisomycin. (D) Immunoblots showing effects of various modifiers or VCP inhibitor on C-I30-FLAG-u levels. (E) Immunostaining showing effects of various modifiers on CCCP-induced FLAG+ aggregates. Arrowheads indicate aggregates. (F) Immunostaining showing effects of ANKZF1 RNAi or OE on C-I30-FLAG aggregation. (G) CoIP assay showing effect of Parkin on the interaction of ANKZF1 or NEMF with ABCE1. .

    Article Snippet: Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare.

    Techniques: Western Blot, Immunostaining, Co-Immunoprecipitation Assay

    The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus MurE (Protein Data Bank ID 4c12) 32 and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus MurE (Protein Data Bank ID 4c12) 32 and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Article Snippet: Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Thin Layer Chromatography, Activity Assay, Mutagenesis

    Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b ) Schematic overview of GatD and MurT proteins. GatD consists of a single glutamine amidotransferase (GATase) domain with a cysteine at position 94 as the active residue and a histidine at position 189 as a component of the catalytic triad 19 . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . 24 . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c indicating the middle and C-terminal domains, respectively. The drawing was generated with TopDraw 54 .

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b ) Schematic overview of GatD and MurT proteins. GatD consists of a single glutamine amidotransferase (GATase) domain with a cysteine at position 94 as the active residue and a histidine at position 189 as a component of the catalytic triad 19 . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . 24 . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c indicating the middle and C-terminal domains, respectively. The drawing was generated with TopDraw 54 .

    Article Snippet: Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Isolation, Generated

    Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Isolation, Mutagenesis, Inhibition, Western Blot, Expressing, In Vitro, Activity Assay

    TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Functional Assay, Binding Assay, Plaque Assay, Staining, Mutagenesis, Western Blot, Stable Transfection, Immunoprecipitation

    49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: 49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Inhibition, Luciferase, Sequencing

    Unbiased genetic screen identifies pAdapters that produce less RNA-DNA adapter protein. (A) Schematic of mutagenesis strategy for pAdapter libraries. Six random bases (N 6 ) were inserted either at the −35 promoter sequence (−35) or the core of the Shine-Dalgarno (SD) sequence in the ribosomal binding site. Arrows show the positions of DNA oligonucleotides used to construct Q5 mutagenesis (see Methods). (B) Left: Colony-color phenotypes of β-gal B3H assays between sRNAs and Hfq under conditions used for forward genetic screen. KB483 reporter cells were transformed with pAdapter (pCW17), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -OxyS, 2xMS2 hp -MgrR, or 2xMS2 hp -ChiX). Right: Example plate from screen. KB473 reporter cells were transformed with pCW17-derived “-35 library”, pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). Transformed cells were spotted on X-gal containing indicator medium (see Methods). (C) Results of B3H β-gal assays from KB483 cells grown in presence of 5 μM IPTG, with pAdapter (CI-MS2 CP fusion expressed from pKB989, pCW17, or p35u4), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). (D) Results of CI-repression β-gal assays from FW123 cells containing the indicated pAdapter plasmid. (E) DNA sequencing results from p35u4 adapter plasmid. Matches to consensus are shown in bold. The region from −54 to −166 relative to the transcription start-site (TSS) in pCW17 was missing (Δ113bp). A σ 70 consensus match within this deleted region (from −107 to −77 relative to TSS (4/6 and 5/6 matches to consensus sequence). (F) Results of CI-repression β-gal assays from FW123 cells containing ΔCI, pCW17, pCW24 (pCW17-Δ), p35u4 or pRM24 (p35u4-Δ).

    Journal: bioRxiv

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein

    doi: 10.1101/2020.07.23.216291

    Figure Lengend Snippet: Unbiased genetic screen identifies pAdapters that produce less RNA-DNA adapter protein. (A) Schematic of mutagenesis strategy for pAdapter libraries. Six random bases (N 6 ) were inserted either at the −35 promoter sequence (−35) or the core of the Shine-Dalgarno (SD) sequence in the ribosomal binding site. Arrows show the positions of DNA oligonucleotides used to construct Q5 mutagenesis (see Methods). (B) Left: Colony-color phenotypes of β-gal B3H assays between sRNAs and Hfq under conditions used for forward genetic screen. KB483 reporter cells were transformed with pAdapter (pCW17), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -OxyS, 2xMS2 hp -MgrR, or 2xMS2 hp -ChiX). Right: Example plate from screen. KB473 reporter cells were transformed with pCW17-derived “-35 library”, pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). Transformed cells were spotted on X-gal containing indicator medium (see Methods). (C) Results of B3H β-gal assays from KB483 cells grown in presence of 5 μM IPTG, with pAdapter (CI-MS2 CP fusion expressed from pKB989, pCW17, or p35u4), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). (D) Results of CI-repression β-gal assays from FW123 cells containing the indicated pAdapter plasmid. (E) DNA sequencing results from p35u4 adapter plasmid. Matches to consensus are shown in bold. The region from −54 to −166 relative to the transcription start-site (TSS) in pCW17 was missing (Δ113bp). A σ 70 consensus match within this deleted region (from −107 to −77 relative to TSS (4/6 and 5/6 matches to consensus sequence). (F) Results of CI-repression β-gal assays from FW123 cells containing ΔCI, pCW17, pCW24 (pCW17-Δ), p35u4 or pRM24 (p35u4-Δ).

    Article Snippet: All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2).

    Techniques: Mutagenesis, Sequencing, Binding Assay, Construct, Transformation Assay, Derivative Assay, Plasmid Preparation, DNA Sequencing