e0554  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 Site Directed Mutagenesis Kit
    Description:
    Q5 Site Directed Mutagenesis Kit 10 rxns
    Catalog Number:
    E0554S
    Price:
    197
    Category:
    PCR Mutagenesis Kits
    Size:
    10 rxns
    Buy from Supplier


    Structured Review

    New England Biolabs e0554
    Q5 Site Directed Mutagenesis Kit
    Q5 Site Directed Mutagenesis Kit 10 rxns
    https://www.bioz.com/result/e0554/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e0554 - by Bioz Stars, 2021-05
    99/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: CRISPR/Cas9 editing of ARF8 and TAA1 Two target sites of FveARF8 in wild strawberry were determined by CRISPRdirect ( https://crispr.dbcls.jp/ ) (Naito et al ., ), and the potency score was measured by SSC ( http://crispr.dfci.harvard.edu/SSC/ ) (Xu et al ., ). .. Two guide RNA sequences were inserted into entry vector JH4 by BsaI digestion/ligation and Q5 site‐directed mutagenesis kit (NEB), respectively, through two primer pairs (Fv ARF8‐F/Fv ARF8‐R and Fv ARF8‐F3/Fv ARF8‐R3) (Table ). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: The source code (requiring Python environment) to generate the in-house peptide sequencing pools will be available upon request. .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Mutagenesis:

    Article Title: Efficient genome editing of wild strawberry genes, vector development and validation
    Article Snippet: CRISPR/Cas9 editing of ARF8 and TAA1 Two target sites of FveARF8 in wild strawberry were determined by CRISPRdirect ( https://crispr.dbcls.jp/ ) (Naito et al ., ), and the potency score was measured by SSC ( http://crispr.dfci.harvard.edu/SSC/ ) (Xu et al ., ). .. Two guide RNA sequences were inserted into entry vector JH4 by BsaI digestion/ligation and Q5 site‐directed mutagenesis kit (NEB), respectively, through two primer pairs (Fv ARF8‐F/Fv ARF8‐R and Fv ARF8‐F3/Fv ARF8‐R3) (Table ). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: The source code (requiring Python environment) to generate the in-house peptide sequencing pools will be available upon request. .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Article Title: Cocaine-regulated microRNA miR-124 controls poly (ADP-ribose) polymerase-1 expression in neuronal cells
    Article Snippet: The control plasmid (pPARP-Null) without the Parp-1 3′UTR sequence was generated by restriction digestion of the full-length plasmid as described previously (46). .. Considering the results obtained from the initial in silico studies, we carried out site-directed mutagenesis using the Site-Directed Mutagenesis Kit (NEB, USA) following manufacturer’s protocol. .. For base substitutions mutations performed and generated were pPARP-1 mutant 1 (CC > GG), pPARP-1 mutant 2 (TG > CA), pPARP-1 mutant 3 (GC > AA).

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: DNA fragments were cloned into the pGL3-Basic plasmid. .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: Ku80 luciferase strain was generated by transfecting with circular 60 μg pT8CBG99‐luciferase‐HX plasmid (Dogga et al , ). .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: Plasmids pCW13-19 (pAC-pconstit -λCI-MS2CP ) were constructed by mutagenic PCR from pCW17. ( ) PCR mutagenesis to create site-directed mutants of the promoter region of pCW17 or the hfq sequence in pKB817 was conducted either with Quikchange-style mutagenesis or with Q5 Site-Directed Mutagenesis (New England Biolabs) using end-to-end primers designed with NEBaseChanger. (Table S2 and S3). .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    In Vitro:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Binding Assay:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Molecular Cloning:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: The source code (requiring Python environment) to generate the in-house peptide sequencing pools will be available upon request. .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Sequencing:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: The source code (requiring Python environment) to generate the in-house peptide sequencing pools will be available upon request. .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Generated:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: The source code (requiring Python environment) to generate the in-house peptide sequencing pools will be available upon request. .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: DNA fragments were cloned into the pGL3-Basic plasmid. .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: Ku80 luciferase strain was generated by transfecting with circular 60 μg pT8CBG99‐luciferase‐HX plasmid (Dogga et al , ). .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Clone Assay:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: The source code (requiring Python environment) to generate the in-house peptide sequencing pools will be available upon request. .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    Modification:

    Article Title: MISTERMINATE Mechanistically Links Mitochondrial Dysfunction with Proteostasis Failure
    Article Snippet: The source code (requiring Python environment) to generate the in-house peptide sequencing pools will be available upon request. .. Plasmids and molecular cloning The original human C-I30 CDS sequence was from the pPM-N-D-C-His (PV394217, abm) plasmid. pcDNA3.1(+)-C-I30-FLG and pcDNA3.1(+)-C-I30-FLG-TEV plasmids were generated by cloning the human C-I30 CDS with different tags into pcDNA3.1(+) vector via KpnI and Xba I sites. pcDNA3.1(+)-C-I30-TEV-FLG; pcDNA3.1(+)-C-I30-FLG-AT5; pcDNA3.1(+)-C-I30-FLG-AT23; pcDNA3.1(+)-C-I30-FLG-non-AT25; pcDNA3.1(+)-C-I30(mMTS)-FLG (36R/A); pcDNA3.1(+)-C-I30-FLG-Astop; pcDNA3.1(+)-C-I30-FLG-AKstop; pcDNA3.1(+)-C-I30-FLG-AKKstop and pcDNA3.1(+)-HA-C-I30-FLG; were modified based on the pcDNA3.1(+)-C-I30-FLG-TEV plasmid via the Q5 Site-Directed Mutagenesis Kit (cat#: E0554S, NEB). pCMV-FLAG-ABCE1 was a gift from Dr. Ramanujan Hegde. pCMV6-FLAG-NOT4 and pCMV6-ANKZF1 was obtained from OriGene Inc (cat#: RC217418 and RC201054 TrueORF). pCMV-SPORT6.1-eRF1 (cat#: MHS6278–202804766, DharmaconTM) and pCMV-SPORT6.1-VCP (cat#: MHS6278–202760239, DharmaconTM) were from GE healthcare. .. CLIP assay and tRNA RT-PCR CLIP assays were performed as we described before ( ).

    In Silico:

    Article Title: Cocaine-regulated microRNA miR-124 controls poly (ADP-ribose) polymerase-1 expression in neuronal cells
    Article Snippet: The control plasmid (pPARP-Null) without the Parp-1 3′UTR sequence was generated by restriction digestion of the full-length plasmid as described previously (46). .. Considering the results obtained from the initial in silico studies, we carried out site-directed mutagenesis using the Site-Directed Mutagenesis Kit (NEB, USA) following manufacturer’s protocol. .. For base substitutions mutations performed and generated were pPARP-1 mutant 1 (CC > GG), pPARP-1 mutant 2 (TG > CA), pPARP-1 mutant 3 (GC > AA).

    Polymerase Chain Reaction:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: DNA fragments were cloned into the pGL3-Basic plasmid. .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Luciferase:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: Ku80 luciferase strain was generated by transfecting with circular 60 μg pT8CBG99‐luciferase‐HX plasmid (Dogga et al , ). .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Transfection:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: Ku80 luciferase strain was generated by transfecting with circular 60 μg pT8CBG99‐luciferase‐HX plasmid (Dogga et al , ). .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Construct:

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: Plasmids pCW13-19 (pAC-pconstit -λCI-MS2CP ) were constructed by mutagenic PCR from pCW17. ( ) PCR mutagenesis to create site-directed mutants of the promoter region of pCW17 or the hfq sequence in pKB817 was conducted either with Quikchange-style mutagenesis or with Q5 Site-Directed Mutagenesis (New England Biolabs) using end-to-end primers designed with NEBaseChanger. (Table S2 and S3). .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Derivative Assay:

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein
    Article Snippet: Plasmids pCW13-19 (pAC-pconstit -λCI-MS2CP ) were constructed by mutagenic PCR from pCW17. ( ) PCR mutagenesis to create site-directed mutants of the promoter region of pCW17 or the hfq sequence in pKB817 was conducted either with Quikchange-style mutagenesis or with Q5 Site-Directed Mutagenesis (New England Biolabs) using end-to-end primers designed with NEBaseChanger. (Table S2 and S3). .. All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2). .. No terminator sequence outside of the intrinsic terminators in each sRNA was provided, except for a trpA terminator present in pHL26 (pCDF-pBAD-1xMS2hp -A27 -TtrpA ); this construct was derived through insertion of a poly(adenosine) stretch into pHL6 (pCDF-pBAD-1xMS2hp -TtrpA ), using Q5 Site-Directed Mutagenesis (Table S2).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs atp binding site
    Overall structure and organization of the <t>GatD/MurT</t> complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and <t>ATP-dependent</t> reaction. ( b . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c .
    Atp Binding Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atp binding site/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    atp binding site - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c .

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c .

    Article Snippet: Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Isolation

    The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Article Snippet: Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Thin Layer Chromatography, Activity Assay, Mutagenesis

    Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Mutagenesis, Activation Assay, Transfection, Luciferase, Plasmid Preparation, Expressing, Quantitative RT-PCR

    Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Quantitative RT-PCR, Infection, Migration, Transfection

    P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Infection, Quantitative RT-PCR, Confocal Microscopy, Staining, Software

    ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Transfection, Infection, Quantitative RT-PCR, Plasmid Preparation, Expressing, Mutagenesis, Protease Inhibitor, Migration, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Binding Assay

    Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Isolation, Mutagenesis, Inhibition, Western Blot, Expressing, In Vitro, Activity Assay

    TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Functional Assay, Binding Assay, Plaque Assay, Staining, Mutagenesis, Western Blot, Stable Transfection, Immunoprecipitation

    49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: 49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Inhibition, Luciferase, Sequencing

    Unbiased genetic screen identifies pAdapters that produce less RNA-DNA adapter protein. (A) Schematic of mutagenesis strategy for pAdapter libraries. Six random bases (N 6 ) were inserted either at the −35 promoter sequence (−35) or the core of the Shine-Dalgarno (SD) sequence in the ribosomal binding site. Arrows show the positions of DNA oligonucleotides used to construct Q5 mutagenesis (see Methods). (B) Left: Colony-color phenotypes of β-gal B3H assays between sRNAs and Hfq under conditions used for forward genetic screen. KB483 reporter cells were transformed with pAdapter (pCW17), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -OxyS, 2xMS2 hp -MgrR, or 2xMS2 hp -ChiX). Right: Example plate from screen. KB473 reporter cells were transformed with pCW17-derived “-35 library”, pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). Transformed cells were spotted on X-gal containing indicator medium (see Methods). (C) Results of B3H β-gal assays from KB483 cells grown in presence of 5 μM IPTG, with pAdapter (CI-MS2 CP fusion expressed from pKB989, pCW17, or p35u4), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). (D) Results of CI-repression β-gal assays from FW123 cells containing the indicated pAdapter plasmid. (E) DNA sequencing results from p35u4 adapter plasmid. Matches to consensus are shown in bold. The region from −54 to −166 relative to the transcription start-site (TSS) in pCW17 was missing (Δ113bp). A σ 70 consensus match within this deleted region (from −107 to −77 relative to TSS (4/6 and 5/6 matches to consensus sequence). (F) Results of CI-repression β-gal assays from FW123 cells containing ΔCI, pCW17, pCW24 (pCW17-Δ), p35u4 or pRM24 (p35u4-Δ).

    Journal: bioRxiv

    Article Title: Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter-protein

    doi: 10.1101/2020.07.23.216291

    Figure Lengend Snippet: Unbiased genetic screen identifies pAdapters that produce less RNA-DNA adapter protein. (A) Schematic of mutagenesis strategy for pAdapter libraries. Six random bases (N 6 ) were inserted either at the −35 promoter sequence (−35) or the core of the Shine-Dalgarno (SD) sequence in the ribosomal binding site. Arrows show the positions of DNA oligonucleotides used to construct Q5 mutagenesis (see Methods). (B) Left: Colony-color phenotypes of β-gal B3H assays between sRNAs and Hfq under conditions used for forward genetic screen. KB483 reporter cells were transformed with pAdapter (pCW17), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -OxyS, 2xMS2 hp -MgrR, or 2xMS2 hp -ChiX). Right: Example plate from screen. KB473 reporter cells were transformed with pCW17-derived “-35 library”, pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). Transformed cells were spotted on X-gal containing indicator medium (see Methods). (C) Results of B3H β-gal assays from KB483 cells grown in presence of 5 μM IPTG, with pAdapter (CI-MS2 CP fusion expressed from pKB989, pCW17, or p35u4), pPrey (α-Hfq) and pBaitRNA (2xMS2 hp -MgrR). (D) Results of CI-repression β-gal assays from FW123 cells containing the indicated pAdapter plasmid. (E) DNA sequencing results from p35u4 adapter plasmid. Matches to consensus are shown in bold. The region from −54 to −166 relative to the transcription start-site (TSS) in pCW17 was missing (Δ113bp). A σ 70 consensus match within this deleted region (from −107 to −77 relative to TSS (4/6 and 5/6 matches to consensus sequence). (F) Results of CI-repression β-gal assays from FW123 cells containing ΔCI, pCW17, pCW24 (pCW17-Δ), p35u4 or pRM24 (p35u4-Δ).

    Article Snippet: All 2xMS2hp –sRNA hybrids were constructed by inserting the sRNA of interest into the XmaI/HindIII sites of pKB845 (pCDF–pBAD–2xMS2hp –XmaI–HindIII). ( ) pHL34 (pCDF-pBAD-2xMS2hp -ΔXmaI-DsrA) was further derived from pKB941 (pCDF-pBAD-2xMS2hp -DsrA) using Q5 mutagenesis to remove the XmaI restriction site (6bp; Table S2).

    Techniques: Mutagenesis, Sequencing, Binding Assay, Construct, Transformation Assay, Derivative Assay, Plasmid Preparation, DNA Sequencing