sphtp3  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    Q5 Site Directed Mutagenesis Kit
    Description:
    Q5 Site Directed Mutagenesis Kit 10 rxns
    Catalog Number:
    e0554s
    Price:
    197
    Size:
    10 rxns
    Category:
    PCR Mutagenesis Kits
    Buy from Supplier


    Structured Review

    New England Biolabs sphtp3
    Q5 Site Directed Mutagenesis Kit
    Q5 Site Directed Mutagenesis Kit 10 rxns
    https://www.bioz.com/result/sphtp3/product/New England Biolabs
    Average 92 stars, based on 2177 article reviews
    Price from $9.99 to $1999.99
    sphtp3 - by Bioz Stars, 2020-07
    92/100 stars

    Images

    1) Product Images from "Cell entry of a host-targeting protein of oomycetes requires gp96"

    Article Title: Cell entry of a host-targeting protein of oomycetes requires gp96

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04796-3

    Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Translocation Assay, Nuclear Magnetic Resonance, Mutagenesis, Titration, Binding Assay

    SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)
    Figure Legend Snippet: SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)

    Techniques Used: Sequencing, Activity Assay, Negative Control, Functional Assay, Mutagenesis, Translocation Assay, Recombinant

    SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Inhibition, Incubation

    2) Product Images from "The R148.3 Gene Modulates Caenorhabditis elegans Lifespan and Fat Metabolism"

    Article Title: The R148.3 Gene Modulates Caenorhabditis elegans Lifespan and Fat Metabolism

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.117.041681

    Loss of R148.3 shortens lifespan. Representative population survival curve of (A and B) N2 worms, or (C) sbp-1 mutants fed either empty L4440 vector (control RNAi) or R148.3 RNAi. RNAi was initiated at either (A and C) stage L1 or at (B) stage L4/young adult. For all panels, P
    Figure Legend Snippet: Loss of R148.3 shortens lifespan. Representative population survival curve of (A and B) N2 worms, or (C) sbp-1 mutants fed either empty L4440 vector (control RNAi) or R148.3 RNAi. RNAi was initiated at either (A and C) stage L1 or at (B) stage L4/young adult. For all panels, P

    Techniques Used: Plasmid Preparation

    Loss of R148.3 increases susceptibility to oxidative stress. (A) Representative survival curve of adult N2 worms fed either empty vector or R148.3 RNAi, and treated with 100 mM paraquat. See Table S6 in File S2 for additional data on replicate experiments. (B) mRNA levels of genes involved in oxidative stress resistance in adult worms fed either empty vector or R148.3 RNAi. (C) mRNA levels of genes involved in autophagy in control ( RNAi ) and R148.3 ( RNAi ) worms described in (B). For all panels, * P
    Figure Legend Snippet: Loss of R148.3 increases susceptibility to oxidative stress. (A) Representative survival curve of adult N2 worms fed either empty vector or R148.3 RNAi, and treated with 100 mM paraquat. See Table S6 in File S2 for additional data on replicate experiments. (B) mRNA levels of genes involved in oxidative stress resistance in adult worms fed either empty vector or R148.3 RNAi. (C) mRNA levels of genes involved in autophagy in control ( RNAi ) and R148.3 ( RNAi ) worms described in (B). For all panels, * P

    Techniques Used: Plasmid Preparation

    Loss of R148.3 blunts the long-lived phenotype of eat-2 and daf-2 mutants. (A) Representative population survival curve of N2 worms and eat-2 mutants fed either empty vector or R148.3 RNAi ( P
    Figure Legend Snippet: Loss of R148.3 blunts the long-lived phenotype of eat-2 and daf-2 mutants. (A) Representative population survival curve of N2 worms and eat-2 mutants fed either empty vector or R148.3 RNAi ( P

    Techniques Used: Plasmid Preparation

    Expression of R148.3 in C. elegans . (A) Expression levels of R148.3 were measured by qPCR in N2 worms at different stages of their life; bars represent average ± SEM ( n = 3). (B) Expression of a R148 p ::GFP reporter in the pharynx, neurons, vulva, and body wall muscles. Top panels: head is oriented up; lower panels: head is oriented down. (C) Representative images of mCherry fluorescence in muscle and coelomocytes in myo-3p :: mCherry- vs. myo-3P :: ssR148.3 :: mCherry -expressing worms. Exposure: 20 msec. Bar, 200 µm. (D) Representative image of myo-3P :: ssR148.3 :: mCherry expression in coelomocytes. → indicates coelomocyte nuclei. Exposure: 1 msec. Bar, 10 µm. Similar findings were obtained with a second independent transgenic line.
    Figure Legend Snippet: Expression of R148.3 in C. elegans . (A) Expression levels of R148.3 were measured by qPCR in N2 worms at different stages of their life; bars represent average ± SEM ( n = 3). (B) Expression of a R148 p ::GFP reporter in the pharynx, neurons, vulva, and body wall muscles. Top panels: head is oriented up; lower panels: head is oriented down. (C) Representative images of mCherry fluorescence in muscle and coelomocytes in myo-3p :: mCherry- vs. myo-3P :: ssR148.3 :: mCherry -expressing worms. Exposure: 20 msec. Bar, 200 µm. (D) Representative image of myo-3P :: ssR148.3 :: mCherry expression in coelomocytes. → indicates coelomocyte nuclei. Exposure: 1 msec. Bar, 10 µm. Similar findings were obtained with a second independent transgenic line.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Fluorescence, Transgenic Assay

    Loss of R148.3 increases triglyceride accumulation. (A) Oil red O and Nile Red staining of N2 worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L1. Animals were assessed at all developmental stages and in adulthood. (B and C) Quantitative analysis of Oil Red O staining (B), and whole-body triglyceride content (C) of worms described in (A) and studied at L4 and adult stages. (D) Whole-body triglyceride content of worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L4/young adult and studied 8 d later. (E) Metabolomic analysis of lipid species of worms described in (C). (F–I) Pharyngeal pumping rates (F), twitching rates (G), oxygen consumption (H), and mRNA expression levels of lipid metabolism genes (I) of L4 worms described in (C). For all panels, * P
    Figure Legend Snippet: Loss of R148.3 increases triglyceride accumulation. (A) Oil red O and Nile Red staining of N2 worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L1. Animals were assessed at all developmental stages and in adulthood. (B and C) Quantitative analysis of Oil Red O staining (B), and whole-body triglyceride content (C) of worms described in (A) and studied at L4 and adult stages. (D) Whole-body triglyceride content of worms fed either empty L4440 vector (control) or R148.3 RNAi starting at stage L4/young adult and studied 8 d later. (E) Metabolomic analysis of lipid species of worms described in (C). (F–I) Pharyngeal pumping rates (F), twitching rates (G), oxygen consumption (H), and mRNA expression levels of lipid metabolism genes (I) of L4 worms described in (C). For all panels, * P

    Techniques Used: Staining, Plasmid Preparation, Expressing

    3) Product Images from "Alpha-ketoglutarate links p53 to cell fate during tumor suppression"

    Article Title: Alpha-ketoglutarate links p53 to cell fate during tumor suppression

    Journal: Nature

    doi: 10.1038/s41586-019-1577-5

    Characterization of reversibility of p53 dependent effects in KP sh cells. a, αKG/succinate ratio in Kras G12D ; TRE-shRenilla (KR sh ) PDAC cells cultured with or without dox for indicated number of days. b-d, Western blot for p53 ( b ), population doublings ( c ) and αKG/succinate ratio ( d ) in 2 KP sh lines cultured with (+Dox) or without dox (-Dox) for 6 days days or cultured without dox for 6 days, followed by 6 days of culture with dox (-Dox→+Dox, arrow indicates when dox was re-introduced). a, c were performed twice with similar results and b,d were performed once. For gel source data ( b . Data are presented as mean ± SD of n=3, independently treated wells of a representative experiment with individual data points shown ( a,c,d ) or or representative of 1 independently treated well ( b ).
    Figure Legend Snippet: Characterization of reversibility of p53 dependent effects in KP sh cells. a, αKG/succinate ratio in Kras G12D ; TRE-shRenilla (KR sh ) PDAC cells cultured with or without dox for indicated number of days. b-d, Western blot for p53 ( b ), population doublings ( c ) and αKG/succinate ratio ( d ) in 2 KP sh lines cultured with (+Dox) or without dox (-Dox) for 6 days days or cultured without dox for 6 days, followed by 6 days of culture with dox (-Dox→+Dox, arrow indicates when dox was re-introduced). a, c were performed twice with similar results and b,d were performed once. For gel source data ( b . Data are presented as mean ± SD of n=3, independently treated wells of a representative experiment with individual data points shown ( a,c,d ) or or representative of 1 independently treated well ( b ).

    Techniques Used: Cell Culture, Western Blot

    p53 restoration increases the cellular αKG/succinate ratio independently of changes in proliferation. a, Western blot (top) and qRT-PCR (bottom) of KP sh -1–3 lines cultured with or without doxycycline (dox) for six days. Gene expression is represented as the log 2 fold change relative to +dox controls for each line. b,c Steady-state levels of TCA cycle metabolites ( b ) or αKG/succinate ratio ( c ) in cells cultured with or without dox for eight days. d, αKG/succinate ratio in cells cultured on dox with 25 nM trametinib or 3 μM etoposide for 48 or 96 has shown. Cells cultured without dox for six days are included as a control. a-d were repeated twice with similar results. Data are presented as either a representative independently treated well ( a , top), as individual data points ( a bottom, b ), or as mean ± SD of n=3 independently treated wells with individual data points shown ( c,d ). For gel source data ( a . Significance assessed by two-tailed Student’s t- test ( c ) or 1-way ANOVA with Tukey’s post-test ( d) in comparison with vehicle treated cells grown with dox.
    Figure Legend Snippet: p53 restoration increases the cellular αKG/succinate ratio independently of changes in proliferation. a, Western blot (top) and qRT-PCR (bottom) of KP sh -1–3 lines cultured with or without doxycycline (dox) for six days. Gene expression is represented as the log 2 fold change relative to +dox controls for each line. b,c Steady-state levels of TCA cycle metabolites ( b ) or αKG/succinate ratio ( c ) in cells cultured with or without dox for eight days. d, αKG/succinate ratio in cells cultured on dox with 25 nM trametinib or 3 μM etoposide for 48 or 96 has shown. Cells cultured without dox for six days are included as a control. a-d were repeated twice with similar results. Data are presented as either a representative independently treated well ( a , top), as individual data points ( a bottom, b ), or as mean ± SD of n=3 independently treated wells with individual data points shown ( c,d ). For gel source data ( a . Significance assessed by two-tailed Student’s t- test ( c ) or 1-way ANOVA with Tukey’s post-test ( d) in comparison with vehicle treated cells grown with dox.

    Techniques Used: Western Blot, Quantitative RT-PCR, Cell Culture, Expressing, Two Tailed Test

    p53 restoration increases the αKG/succinate ratio independently of changes in proliferation or senescence. a, Glucose/glutamine consumption, lactate production in KP sh -1,2 cultured on/off dox for 4 or 8 days (D, days). b, TCA cycle schematic indicating entry points for glucose- and glutamine-derived carbons. Metabolites in red were assessed by isotope tracing experiments. c,d, Metabolite fraction containing 13 C derived from [U- 13 C]glucose ( 13 C-Glc) ( c ) or derived from [U- 13 C]glutamine ( 13 C-Gln) ( d ) after four h of labeling off/on dox for six days. e, f p53 immunoblot ( e ) or Senescence-associated β-galactosidase (SA-β GAL) staining ( f ) in on dox KP sh -2 treated with 3 μM etoposide (Etopo) or 25 nM trametinib (Tram) for 48 or 96 h. Cells grown in the absence of dox (-dox) for six days are included as a positive control. g,h, SA-βGAL ( g ) or BrdU positive ( h ) cells treated as described in ( e ). i, Western blot of cells expressing shRenilla, shp19, shp16/p19, or shCdkn1a/p21 on/off dox for six days. j, SA-βGAL staining of cells described in ( i ). k,l, SA-βGAL ( k ) or BrdU positive ( l ) cells treated as described in ( i ). m, αKG/succinate ratio in cells expressing shRenilla, shp19, p16/p19, or shCdkn1a/p21 on/off dox for six days. a,c,d,f-m were repeated twice with similar results and e was performed once. Data are presented as mean ± SEM of n=6, independently treated wells ( a ), mean ± SD of n=3, independently treated wells from a representative experiment with individual data points shown ( c,d,f,g,h,k,l,m ), or representative of 1 independently treated well ( e,f,i,j ). For gel source data ( e,i . Significance assessed in comparison to cells grown with dox by 1-way ANOVA with Tukey’s multiple comparison post-test ( a ) or in the indicated comparisons by 2-way ANOVA with Sidak’s post-test ( m ). Scale bar 50 μM.
    Figure Legend Snippet: p53 restoration increases the αKG/succinate ratio independently of changes in proliferation or senescence. a, Glucose/glutamine consumption, lactate production in KP sh -1,2 cultured on/off dox for 4 or 8 days (D, days). b, TCA cycle schematic indicating entry points for glucose- and glutamine-derived carbons. Metabolites in red were assessed by isotope tracing experiments. c,d, Metabolite fraction containing 13 C derived from [U- 13 C]glucose ( 13 C-Glc) ( c ) or derived from [U- 13 C]glutamine ( 13 C-Gln) ( d ) after four h of labeling off/on dox for six days. e, f p53 immunoblot ( e ) or Senescence-associated β-galactosidase (SA-β GAL) staining ( f ) in on dox KP sh -2 treated with 3 μM etoposide (Etopo) or 25 nM trametinib (Tram) for 48 or 96 h. Cells grown in the absence of dox (-dox) for six days are included as a positive control. g,h, SA-βGAL ( g ) or BrdU positive ( h ) cells treated as described in ( e ). i, Western blot of cells expressing shRenilla, shp19, shp16/p19, or shCdkn1a/p21 on/off dox for six days. j, SA-βGAL staining of cells described in ( i ). k,l, SA-βGAL ( k ) or BrdU positive ( l ) cells treated as described in ( i ). m, αKG/succinate ratio in cells expressing shRenilla, shp19, p16/p19, or shCdkn1a/p21 on/off dox for six days. a,c,d,f-m were repeated twice with similar results and e was performed once. Data are presented as mean ± SEM of n=6, independently treated wells ( a ), mean ± SD of n=3, independently treated wells from a representative experiment with individual data points shown ( c,d,f,g,h,k,l,m ), or representative of 1 independently treated well ( e,f,i,j ). For gel source data ( e,i . Significance assessed in comparison to cells grown with dox by 1-way ANOVA with Tukey’s multiple comparison post-test ( a ) or in the indicated comparisons by 2-way ANOVA with Sidak’s post-test ( m ). Scale bar 50 μM.

    Techniques Used: Cell Culture, Derivative Assay, Labeling, Staining, Positive Control, Western Blot, Expressing

    p53 status and cellular αKG/succinate ratio dictates 5hmC levels in mouse models of PDAC. a, Representative 5hmC and p53 staining in PDAC arising in KPC mice (n=3). High p53 staining denotes malignant cells. b, Representative 5hmC staining in human PanIN 1–3 and PDAC samples. b-catenin marks tumor epithelium. c , Fraction 5hmC-positive nuclei (binned into quartiles) in indicated numbers of human tumors. d, Representative 5hmC staining in orthotopic tumors derived from KP sh -2 cells in mice maintained on dox (n=3) or 10 days off dox (n=3). GFP denotes cells expressing shp53. e, Nuclear 5hmC intensity in lineage-traced (i.e., GFP high, +DOX; GFP low −DOX) tumor cells from three images each from n=3 independent tumors from d . n= 1074, 1571, 1359, 1569, 1253, 781 nuclei quanitified per mouse. f, Nuclear 5hmC intensity in lineage-traced (i.e., GFP+) tumor cells from three images each from n=3 independent tumors derived by orthotopic injection of KP flox cells expressing dox-inducible shRenilla, shOgdh, or shSdha two weeks after injection in mice maintained on dox. n =1609, 1796, 1947, 1581, 1751, 1619, 1636, 1786, 1907, 1801, 1892, 1758, 1829, 2001, 1898, 1982, 1839, 1926 nuclei quanitified per mouse. GFP denotes shRNA-expressing cells. g, Nuclear 5hmC intensity in lineage-traced (i.e., GFP high, +Dox; GFP low −Dox) tumor cells from three images each from n=3 independent tumors derived by orthotopic injection of KP sh -2 cells expressing shRenilla or shSdha maintained on dox or 10 days off dox. n=1810, 1720, 1980, 1837, 1739, 1670, 1695, 1592, 1583, 1690, 1428, 1734, 1351, 1434, 1708, 1543, 1308, 1413, 1641, 1893, 1476, 1586, 1597, 1547 nuclei quanitified per mouse. e-g, Population medians were taken for each mouse and points represent total 5hmC levels of individual nuclei normalized to DAPI. e-g, Significance assessed in indicated comparisons using two tailed Students t- test. Scale bar 50 μm.
    Figure Legend Snippet: p53 status and cellular αKG/succinate ratio dictates 5hmC levels in mouse models of PDAC. a, Representative 5hmC and p53 staining in PDAC arising in KPC mice (n=3). High p53 staining denotes malignant cells. b, Representative 5hmC staining in human PanIN 1–3 and PDAC samples. b-catenin marks tumor epithelium. c , Fraction 5hmC-positive nuclei (binned into quartiles) in indicated numbers of human tumors. d, Representative 5hmC staining in orthotopic tumors derived from KP sh -2 cells in mice maintained on dox (n=3) or 10 days off dox (n=3). GFP denotes cells expressing shp53. e, Nuclear 5hmC intensity in lineage-traced (i.e., GFP high, +DOX; GFP low −DOX) tumor cells from three images each from n=3 independent tumors from d . n= 1074, 1571, 1359, 1569, 1253, 781 nuclei quanitified per mouse. f, Nuclear 5hmC intensity in lineage-traced (i.e., GFP+) tumor cells from three images each from n=3 independent tumors derived by orthotopic injection of KP flox cells expressing dox-inducible shRenilla, shOgdh, or shSdha two weeks after injection in mice maintained on dox. n =1609, 1796, 1947, 1581, 1751, 1619, 1636, 1786, 1907, 1801, 1892, 1758, 1829, 2001, 1898, 1982, 1839, 1926 nuclei quanitified per mouse. GFP denotes shRNA-expressing cells. g, Nuclear 5hmC intensity in lineage-traced (i.e., GFP high, +Dox; GFP low −Dox) tumor cells from three images each from n=3 independent tumors derived by orthotopic injection of KP sh -2 cells expressing shRenilla or shSdha maintained on dox or 10 days off dox. n=1810, 1720, 1980, 1837, 1739, 1670, 1695, 1592, 1583, 1690, 1428, 1734, 1351, 1434, 1708, 1543, 1308, 1413, 1641, 1893, 1476, 1586, 1597, 1547 nuclei quanitified per mouse. e-g, Population medians were taken for each mouse and points represent total 5hmC levels of individual nuclei normalized to DAPI. e-g, Significance assessed in indicated comparisons using two tailed Students t- test. Scale bar 50 μm.

    Techniques Used: Staining, Mouse Assay, Derivative Assay, Expressing, Injection, shRNA, Two Tailed Test

    p53 reactivation and Ogdh inhibition induce 5hmC accumulation in PDAC cells. a, Median fluorescence intensity of 5hmC in KP sh -2 cells grown with or without dox for 8 days. b, qRT-PCR of Tet1, Tet2 , and Tet3 expression in KP sh -2 cells grown with or without dox for indicated number of days. c, Sequence analysis of CRISPR/Cas9 editing. Percentage of amplicons flanking sgRNA target sequence with indicated genotype amplified from KP sh -2 cells expressing sgRNAs targeting Tet1 , Tet2 , and Tet3 . d, 5hmC Median fluorescence intensity (MFI) in KP sh -2 cells expressing sgRNAs targeting Tet1 , Tet2 , and Tet3 grown with or without dox for 8 days. e , 5hmC MFI in KP sh -2 cells grown with 4 mM DM-αKG for 72 h. f, 5hmC MFI in 8988 and Panc1 cells grown with 4 mM DM-αKG for 72 h. g, 5hmC MFI in KPC flox RIK and KPC R172H RIK cells expressing dox-inducible shRNAs targeting Renilla or Ogdh grown 4 days with or without dox . h, Representative 5hmC staining in orthotopic tumors derived from KP flox cells expressing dox-inducible hairpins targeting Renilla (n=5 mice), Ogdh (n=4 mice), or Sdha (n=4 mice) two weeks after injection in mice maintained on dox. i, Representative 5hmC staining of orthotopic tumors derived from KP flox cells 9 days after activation of dox-inducible hairpins targeting Renilla (n=4 mice), Ogdh (Ogdh-1, n=4 mice, Ogdh-2, n=3 mice), or Sdha-1–3 (n=4) in established tumors. GFP marks cells expressing indicated shRNA. a,d-g were repeated twice with similar results, b was repeated in an additional line. Data are presented as mean ± SD of n=3, independently treated wells of a representative experiment with individual data points shown. Significance assessed by two-tailed Student’s t- test ( a,e,f ) or compared to shRenilla controls by 1-way ANOVA with Tukey’s multiple comparison post-test ( g ). Scale bar 50 μM
    Figure Legend Snippet: p53 reactivation and Ogdh inhibition induce 5hmC accumulation in PDAC cells. a, Median fluorescence intensity of 5hmC in KP sh -2 cells grown with or without dox for 8 days. b, qRT-PCR of Tet1, Tet2 , and Tet3 expression in KP sh -2 cells grown with or without dox for indicated number of days. c, Sequence analysis of CRISPR/Cas9 editing. Percentage of amplicons flanking sgRNA target sequence with indicated genotype amplified from KP sh -2 cells expressing sgRNAs targeting Tet1 , Tet2 , and Tet3 . d, 5hmC Median fluorescence intensity (MFI) in KP sh -2 cells expressing sgRNAs targeting Tet1 , Tet2 , and Tet3 grown with or without dox for 8 days. e , 5hmC MFI in KP sh -2 cells grown with 4 mM DM-αKG for 72 h. f, 5hmC MFI in 8988 and Panc1 cells grown with 4 mM DM-αKG for 72 h. g, 5hmC MFI in KPC flox RIK and KPC R172H RIK cells expressing dox-inducible shRNAs targeting Renilla or Ogdh grown 4 days with or without dox . h, Representative 5hmC staining in orthotopic tumors derived from KP flox cells expressing dox-inducible hairpins targeting Renilla (n=5 mice), Ogdh (n=4 mice), or Sdha (n=4 mice) two weeks after injection in mice maintained on dox. i, Representative 5hmC staining of orthotopic tumors derived from KP flox cells 9 days after activation of dox-inducible hairpins targeting Renilla (n=4 mice), Ogdh (Ogdh-1, n=4 mice, Ogdh-2, n=3 mice), or Sdha-1–3 (n=4) in established tumors. GFP marks cells expressing indicated shRNA. a,d-g were repeated twice with similar results, b was repeated in an additional line. Data are presented as mean ± SD of n=3, independently treated wells of a representative experiment with individual data points shown. Significance assessed by two-tailed Student’s t- test ( a,e,f ) or compared to shRenilla controls by 1-way ANOVA with Tukey’s multiple comparison post-test ( g ). Scale bar 50 μM

    Techniques Used: Inhibition, Fluorescence, Quantitative RT-PCR, Expressing, Sequencing, CRISPR, Amplification, Staining, Derivative Assay, Mouse Assay, Injection, Activation Assay, shRNA, Two Tailed Test

    KP sh ESC-GEMM PDAC model driven by mutant Kras and inducible and reversible p53 silencing. a, KP sh embryonic stem cell-based genetically engineered mouse model (ESC-GEMM) of pancreatic ductal adenocarcinoma (PDAC). Embryonic stem cells express Pdx1-Cre (transgenic expression of Cre in pancreatic progenitors); LSL-Kras G12D (knock-in, conditional heterozygous expression of mutant Kras); RIK (knock in, conditional heterozygous expression of rtTA and fluorescent mKate2 from the Rosa26 locus); Col1a1-TRE-GFP-shp53-shRenilla (Col1a1 homing cassette (CHC) targeted with doxycycline inducible tandem shRNA expressing shp53 and shRenilla linked to GFP). KP sh mice were generated by blastocyst injection and mothers enrolled on dox chow at day 5. Cell lines were derived and maintained in dox-containing media from tumors arising in dox fed mice. All KP sh cells constitutively express mKate2 (Kate) and rtTA. b, Population doublings of KP sh -1–3 lines grown on/off dox. c-f, Characterization of p53 levels ( c ), BrdU incorporation ( d ), Annexin-V staining ( e ) and senescence-associated β-galactosidase (SA-β GAL) staining ( f ) in three independent KP sh lines grown on/off dox (D, day). g, Representative gross pathology and epifluorescence images of pancreatic tumors resulting from orthotopic transplant of KP sh -2 cells into dox fed mice maintained on dox chow (top, n=3 mice) or withdrawn from dox chow for 10 days (bottom, n=3 mice). KP sh cells uniformly express Kate, while GFP expression indicates cell actively expressing the p53 shRNA. h, Representative Cdkn1a/p21 immunostainig in matched normal host pancreas, or in orthotopic KP sh -2 tumors maintained on dox (n=3) or 10 days following dox withdrawal (n=3). Kate indicates injected KP sh -2 cells. i , Representative Ki67 immunostaining in orthotopic KP sh -2 tumors maintained on dox (n= 3 mice) or 10 days following dox withdrawal (n=3 mice). Kate indicates injected KP sh -2 cells. j, Small animal ultrasound measurement of tumor volume. KP sh -2 cells were injected into dox-fed mice and mice were maintained on dox diet for 2 weeks. After two weeks (D0), tumor size was measured and mice were randomized into off (n=6 mice) and on dox chow groups (n=3 mice). Subsequent tumor size was measured at the indicated time points. n=3 mice on dox were collected for analysis upon sacrifice, n=3 mice were analyzed after 5 and 10 days of dox withdrawal, respectively. k, Survival of mice shown in i after randomization into groups maintained on dox food (n=3 mice) or following dox withdrawal (n= 6 mice). b-f were repeated twice with similar results. Data are presented as either representative independently treated wells ( c,f ) or mean ± SD of n=3, independently treated wells with individual data points shown ( b,d,e ). For gel source data ( c . Scale bar for immunostaining 50 μM. Scale bar for pathology 1 cm.
    Figure Legend Snippet: KP sh ESC-GEMM PDAC model driven by mutant Kras and inducible and reversible p53 silencing. a, KP sh embryonic stem cell-based genetically engineered mouse model (ESC-GEMM) of pancreatic ductal adenocarcinoma (PDAC). Embryonic stem cells express Pdx1-Cre (transgenic expression of Cre in pancreatic progenitors); LSL-Kras G12D (knock-in, conditional heterozygous expression of mutant Kras); RIK (knock in, conditional heterozygous expression of rtTA and fluorescent mKate2 from the Rosa26 locus); Col1a1-TRE-GFP-shp53-shRenilla (Col1a1 homing cassette (CHC) targeted with doxycycline inducible tandem shRNA expressing shp53 and shRenilla linked to GFP). KP sh mice were generated by blastocyst injection and mothers enrolled on dox chow at day 5. Cell lines were derived and maintained in dox-containing media from tumors arising in dox fed mice. All KP sh cells constitutively express mKate2 (Kate) and rtTA. b, Population doublings of KP sh -1–3 lines grown on/off dox. c-f, Characterization of p53 levels ( c ), BrdU incorporation ( d ), Annexin-V staining ( e ) and senescence-associated β-galactosidase (SA-β GAL) staining ( f ) in three independent KP sh lines grown on/off dox (D, day). g, Representative gross pathology and epifluorescence images of pancreatic tumors resulting from orthotopic transplant of KP sh -2 cells into dox fed mice maintained on dox chow (top, n=3 mice) or withdrawn from dox chow for 10 days (bottom, n=3 mice). KP sh cells uniformly express Kate, while GFP expression indicates cell actively expressing the p53 shRNA. h, Representative Cdkn1a/p21 immunostainig in matched normal host pancreas, or in orthotopic KP sh -2 tumors maintained on dox (n=3) or 10 days following dox withdrawal (n=3). Kate indicates injected KP sh -2 cells. i , Representative Ki67 immunostaining in orthotopic KP sh -2 tumors maintained on dox (n= 3 mice) or 10 days following dox withdrawal (n=3 mice). Kate indicates injected KP sh -2 cells. j, Small animal ultrasound measurement of tumor volume. KP sh -2 cells were injected into dox-fed mice and mice were maintained on dox diet for 2 weeks. After two weeks (D0), tumor size was measured and mice were randomized into off (n=6 mice) and on dox chow groups (n=3 mice). Subsequent tumor size was measured at the indicated time points. n=3 mice on dox were collected for analysis upon sacrifice, n=3 mice were analyzed after 5 and 10 days of dox withdrawal, respectively. k, Survival of mice shown in i after randomization into groups maintained on dox food (n=3 mice) or following dox withdrawal (n= 6 mice). b-f were repeated twice with similar results. Data are presented as either representative independently treated wells ( c,f ) or mean ± SD of n=3, independently treated wells with individual data points shown ( b,d,e ). For gel source data ( c . Scale bar for immunostaining 50 μM. Scale bar for pathology 1 cm.

    Techniques Used: Mutagenesis, Transgenic Assay, Expressing, Knock-In, shRNA, Mouse Assay, Generated, Injection, Derivative Assay, BrdU Incorporation Assay, Staining, Immunostaining

    Both p53 restoration and Ogdh inhibition promote tumor cell differentiation and tumor suppression. a, Representative hematoxylin and eosin (H E) staining of orthotopic tumors derived from KP sh -2 cells grown in mice on dox-diet (n=3) or ten days after dox withdrawal (n=3). b, Representative H E staining of orthotopic tumors derived from KP flox cells expressing dox-inducible shRenilla, shOgdh, or shSdha two weeks after injection in mice maintained on dox. n= 5 mice shRenilla, n=4 mice (shOgdh, shSdha). c, In vivo competition assay tracking frequency of KP flox RIK (top) or KP R172K RIK (bottom) cells expressing shRenilla, shOgdh, or shSdha (GFP+) after three weeks of tumor growth in dox-fed mice. Data are presented as mean ± SD of individual tumors. KP flox RIK: n= 5 mice shRenilla, n=4 mice (shOgdh, shSdha). KP R172K RIK : n= 5 mice shRenilla, (shOgdh, shSdha-1,2), n=3 mice shSdha-3. Scale bar 50 μm.
    Figure Legend Snippet: Both p53 restoration and Ogdh inhibition promote tumor cell differentiation and tumor suppression. a, Representative hematoxylin and eosin (H E) staining of orthotopic tumors derived from KP sh -2 cells grown in mice on dox-diet (n=3) or ten days after dox withdrawal (n=3). b, Representative H E staining of orthotopic tumors derived from KP flox cells expressing dox-inducible shRenilla, shOgdh, or shSdha two weeks after injection in mice maintained on dox. n= 5 mice shRenilla, n=4 mice (shOgdh, shSdha). c, In vivo competition assay tracking frequency of KP flox RIK (top) or KP R172K RIK (bottom) cells expressing shRenilla, shOgdh, or shSdha (GFP+) after three weeks of tumor growth in dox-fed mice. Data are presented as mean ± SD of individual tumors. KP flox RIK: n= 5 mice shRenilla, n=4 mice (shOgdh, shSdha). KP R172K RIK : n= 5 mice shRenilla, (shOgdh, shSdha-1,2), n=3 mice shSdha-3. Scale bar 50 μm.

    Techniques Used: Inhibition, Cell Differentiation, Staining, Derivative Assay, Mouse Assay, Expressing, Injection, In Vivo, Competitive Binding Assay

    p53 binding at Pcx and Idh1. a. Analysis of ChIP-Seq signal at the Pcx locus in primary p53 WT and p53 null (KO) mouse embryonic fibroblasts after treatment with doxorubicin. b. Analysis of ChIP-Seq signal at the Idh1 locus in primary p53 WT and p53 null .
    Figure Legend Snippet: p53 binding at Pcx and Idh1. a. Analysis of ChIP-Seq signal at the Pcx locus in primary p53 WT and p53 null (KO) mouse embryonic fibroblasts after treatment with doxorubicin. b. Analysis of ChIP-Seq signal at the Idh1 locus in primary p53 WT and p53 null .

    Techniques Used: Binding Assay, Chromatin Immunoprecipitation

    αKG recapitulates gene expression changes induced by p53 restoration. a, Mean log 2 fold change of all ATAC-Seq peaks following p53 reactivation or treatment with cell-permeable αKG in n=2, independently treated wells of KP sh -1 cells. All samples contained equivalent amounts of vehicle (DMSO). Pearson correlation r = 0.605, p
    Figure Legend Snippet: αKG recapitulates gene expression changes induced by p53 restoration. a, Mean log 2 fold change of all ATAC-Seq peaks following p53 reactivation or treatment with cell-permeable αKG in n=2, independently treated wells of KP sh -1 cells. All samples contained equivalent amounts of vehicle (DMSO). Pearson correlation r = 0.605, p

    Techniques Used: Expressing

    Elevating intracellular αKG levels phenocopies the effect of p53 reactivation on gene expression. a, Mean log 2 fold change of all genes following p53 reactivation or cell-permeable αKG in n=2, independently treated wells of KP sh -1 cells. All samples treated with equal amounts of DMSO (vehicle). Spearman correlation r = 0.556, p
    Figure Legend Snippet: Elevating intracellular αKG levels phenocopies the effect of p53 reactivation on gene expression. a, Mean log 2 fold change of all genes following p53 reactivation or cell-permeable αKG in n=2, independently treated wells of KP sh -1 cells. All samples treated with equal amounts of DMSO (vehicle). Spearman correlation r = 0.556, p

    Techniques Used: Expressing

    Functional p53 transactivation is required to increase the cellular αKG/succinate ratio. a-c, p53 immunoblot ( a ), Cdkn1a/p21 qRT-PCR ( b ), and αKG/succinate ratio ( c ) in KP flox RIK-TRE-Empty, KP flox RIK-TRE-p53 WT (dox inducible expression, wt p53), and KP flox RIK-TRE-p53 TAD1/2M (dox inducible expression, p53 with mutations in both transactivation domain 1 and 2) cells 2 days off/on dox. d Cdkn1a/p21, Mdm2, p53 (top), Idh1 and Pcx (bottom) qRT-PCR in KP sh -2 off/on dox. Day 0 and day 6 Cdkn1a/p21, Mdm2, and p53 values also shown in . e, αKG/succinate ratio in KP sh 1–3 grown on/off dox. f, Idh1 and Pcx qRT-PCR in KP flox RIK-TRE-Empty, KP flox RIK-TRE-p53 WT , and KP flox RIK-TRE-p53 TAD1/2M off/on dox for 2 days. g, PC activity associated glucose labeling patterns. IDH1 and PC dependent reactions labeled. h, Fractional m+3 (top) or m+5 (bottom) labeling of aspartate and citrate in KP sh 1–3 on/off dox for six days after four hours with [U- 13 C]glucose. i, Idh1 qRTPCR in KP sh -2 expressing shRenilla or shIdh1 on/off dox for 8 days. j, Idh1 and p53 levels in KP sh -2 expressing shRenilla or shIdh1 grown on/off dox for 8 days. Arrowhead: specific Idh1 band. k, αKG/succinate ratio in KP sh -2 expressing shRenilla or shIdh1 grown on/off dox. l,m. p53 and Idh1 immunoblot ( l ) and αKG/succinate ratio ( m ) in KP flox RIK-TRE-Empty, KP flox RIKTRE-p53 WT , and KP flox RIK-TRE-p53 TAD1/2M expressing shRenilla or shIdh1 grown with dox for 2 days. n, αKG/succinate ratio in parental KP sh -2 versus KP sh -2 expressing IDH1 or IDH2 cDNA grown on dox. a-e,h-n were repeated twice with similar results. Data are presented as representative of 1 independently treated well ( a,j,l ) or as mean ± SD of n=3 independently treated wells of a representative experiment with individual data points shown ( b-f , h,i,k,m,n ). For gel source data ( a,j,l . Significance assessed compared to cells grown on dox by 1-way ANOVA with Sidak’s multiple comparisons post-test ( e ) or indicated comparisons ( f ). Fig. 1a
    Figure Legend Snippet: Functional p53 transactivation is required to increase the cellular αKG/succinate ratio. a-c, p53 immunoblot ( a ), Cdkn1a/p21 qRT-PCR ( b ), and αKG/succinate ratio ( c ) in KP flox RIK-TRE-Empty, KP flox RIK-TRE-p53 WT (dox inducible expression, wt p53), and KP flox RIK-TRE-p53 TAD1/2M (dox inducible expression, p53 with mutations in both transactivation domain 1 and 2) cells 2 days off/on dox. d Cdkn1a/p21, Mdm2, p53 (top), Idh1 and Pcx (bottom) qRT-PCR in KP sh -2 off/on dox. Day 0 and day 6 Cdkn1a/p21, Mdm2, and p53 values also shown in . e, αKG/succinate ratio in KP sh 1–3 grown on/off dox. f, Idh1 and Pcx qRT-PCR in KP flox RIK-TRE-Empty, KP flox RIK-TRE-p53 WT , and KP flox RIK-TRE-p53 TAD1/2M off/on dox for 2 days. g, PC activity associated glucose labeling patterns. IDH1 and PC dependent reactions labeled. h, Fractional m+3 (top) or m+5 (bottom) labeling of aspartate and citrate in KP sh 1–3 on/off dox for six days after four hours with [U- 13 C]glucose. i, Idh1 qRTPCR in KP sh -2 expressing shRenilla or shIdh1 on/off dox for 8 days. j, Idh1 and p53 levels in KP sh -2 expressing shRenilla or shIdh1 grown on/off dox for 8 days. Arrowhead: specific Idh1 band. k, αKG/succinate ratio in KP sh -2 expressing shRenilla or shIdh1 grown on/off dox. l,m. p53 and Idh1 immunoblot ( l ) and αKG/succinate ratio ( m ) in KP flox RIK-TRE-Empty, KP flox RIKTRE-p53 WT , and KP flox RIK-TRE-p53 TAD1/2M expressing shRenilla or shIdh1 grown with dox for 2 days. n, αKG/succinate ratio in parental KP sh -2 versus KP sh -2 expressing IDH1 or IDH2 cDNA grown on dox. a-e,h-n were repeated twice with similar results. Data are presented as representative of 1 independently treated well ( a,j,l ) or as mean ± SD of n=3 independently treated wells of a representative experiment with individual data points shown ( b-f , h,i,k,m,n ). For gel source data ( a,j,l . Significance assessed compared to cells grown on dox by 1-way ANOVA with Sidak’s multiple comparisons post-test ( e ) or indicated comparisons ( f ). Fig. 1a

    Techniques Used: Functional Assay, Quantitative RT-PCR, Expressing, Activity Assay, Labeling

    Increase in the cellular αKG/succinate ratio enforces p53 driven tumor suppression. a-c, Sdha and p53 immunoblot ( a ), αKG/succinate ratio ( b ) and 5hmC MFI ( c ) in KP sh -2 cells expressing constitutive shRNAs targeting Sdha or Renilla grown with or without dox for 8 days. d, Representative 5hmC staining in orthotopic tumors derived from KP sh- 2 cells expressing constitutive shRNAs targeting Sdha or Renilla in mice maintained on dox (n=3 mice) or ten days following dox withdrawal (n=3 mice). GFP denotes cells expressing hairpin targeting p53. 5hmC staining per nucleus is quantified in . e,f, Small animal ultrasound measurement of tumors derived from KP sh -2 cells expressing constitutive shRNAs targeting Renilla (left) or Sdha (right) orthotopically injected into dox-fed mice maintained on dox diet for 2 weeks. After two weeks (D0), tumor size was measured and mice were randomized into off and on dox chow groups (shRenilla n=5 mice, shSdha n=4 mice). Subsequent tumor size and mouse survival was monitored up to 10 days after dox withdrawal. g, Fold change in tumor size from day 5 to day 10 following withdrawal of dox chow (D0) from mice bearing orthotopic tumors derived from KP sh -2 cells expressing constitutive shRNAs targeting Sdha or Renilla. h, Representative H E staining of orthotopic tumors derived from KP sh -2 cells expressing constitutive shRNAs targeting Sdha or Renilla maintained on dox or 10 days following dox withdrawal. a and b were performed once, c was repeated twice with similar results. For gel source data ( a . Data are presented as either a representative independently treated well ( a ), or as mean ± SD of n=3 independently treated wells with individual data points shown ( b,c ). Significance assessed by two-tailed, unpaired t- test ( g ). Scale bar 50 μM. Fig. 4g
    Figure Legend Snippet: Increase in the cellular αKG/succinate ratio enforces p53 driven tumor suppression. a-c, Sdha and p53 immunoblot ( a ), αKG/succinate ratio ( b ) and 5hmC MFI ( c ) in KP sh -2 cells expressing constitutive shRNAs targeting Sdha or Renilla grown with or without dox for 8 days. d, Representative 5hmC staining in orthotopic tumors derived from KP sh- 2 cells expressing constitutive shRNAs targeting Sdha or Renilla in mice maintained on dox (n=3 mice) or ten days following dox withdrawal (n=3 mice). GFP denotes cells expressing hairpin targeting p53. 5hmC staining per nucleus is quantified in . e,f, Small animal ultrasound measurement of tumors derived from KP sh -2 cells expressing constitutive shRNAs targeting Renilla (left) or Sdha (right) orthotopically injected into dox-fed mice maintained on dox diet for 2 weeks. After two weeks (D0), tumor size was measured and mice were randomized into off and on dox chow groups (shRenilla n=5 mice, shSdha n=4 mice). Subsequent tumor size and mouse survival was monitored up to 10 days after dox withdrawal. g, Fold change in tumor size from day 5 to day 10 following withdrawal of dox chow (D0) from mice bearing orthotopic tumors derived from KP sh -2 cells expressing constitutive shRNAs targeting Sdha or Renilla. h, Representative H E staining of orthotopic tumors derived from KP sh -2 cells expressing constitutive shRNAs targeting Sdha or Renilla maintained on dox or 10 days following dox withdrawal. a and b were performed once, c was repeated twice with similar results. For gel source data ( a . Data are presented as either a representative independently treated well ( a ), or as mean ± SD of n=3 independently treated wells with individual data points shown ( b,c ). Significance assessed by two-tailed, unpaired t- test ( g ). Scale bar 50 μM. Fig. 4g

    Techniques Used: Expressing, Staining, Derivative Assay, Mouse Assay, Injection, Two Tailed Test

    4) Product Images from "Biophysical forces rewire cell metabolism to guide microtubule-dependent cell mechanics"

    Article Title: Biophysical forces rewire cell metabolism to guide microtubule-dependent cell mechanics

    Journal: bioRxiv

    doi: 10.1101/2020.03.10.985036

    C-terminal tubulin tail mutants increase microtubule dynamics and modulate cell mechanic-dependent activities. (a-d) HeLa cells were transfected with TUBA1A constructs and plated on 50kPa hydrogel. (a) Representative alignment of microtubule in cells. (b) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin in cells. (c) Proliferation rate of cells. (d) Cell velocity (left) and speed (right) of cells. In all the panels n > 50 cells from 3 independent experiments were analyzed. *P
    Figure Legend Snippet: C-terminal tubulin tail mutants increase microtubule dynamics and modulate cell mechanic-dependent activities. (a-d) HeLa cells were transfected with TUBA1A constructs and plated on 50kPa hydrogel. (a) Representative alignment of microtubule in cells. (b) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin in cells. (c) Proliferation rate of cells. (d) Cell velocity (left) and speed (right) of cells. In all the panels n > 50 cells from 3 independent experiments were analyzed. *P

    Techniques Used: Transfection, Construct, Diffusion-based Assay

    TTLL4 force microtubule glutamylation to adjust cell mechanics and sustain cell mechanic-dependent activities. (a-f , h) HeLa cells plated on 50 kPa hydrogel were transfected with the indicated siRNA. (a) Immunoblot and quantification of Glu-Tubulin in cells. (b) Representative confocal images (left) and quantification (right) of Glu-Tubulin and Tubulin. Scale bar=10 µm. (c) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP. n > 500 comets. Scale bar=1 µm. (d) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin. (e) Apparent Young’s moduli obtained by AFM analysis. Bars represent the median. (f) Representative heat map (left) and quantification (right) showing contractile forces generate by cells. (g) Representative confocal images (left) and quantification (right) of circularity index. Scale bar=10 µm. In all the panels n > 20 cells from 3 independent experiments were analyzed. *P
    Figure Legend Snippet: TTLL4 force microtubule glutamylation to adjust cell mechanics and sustain cell mechanic-dependent activities. (a-f , h) HeLa cells plated on 50 kPa hydrogel were transfected with the indicated siRNA. (a) Immunoblot and quantification of Glu-Tubulin in cells. (b) Representative confocal images (left) and quantification (right) of Glu-Tubulin and Tubulin. Scale bar=10 µm. (c) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP. n > 500 comets. Scale bar=1 µm. (d) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin. (e) Apparent Young’s moduli obtained by AFM analysis. Bars represent the median. (f) Representative heat map (left) and quantification (right) showing contractile forces generate by cells. (g) Representative confocal images (left) and quantification (right) of circularity index. Scale bar=10 µm. In all the panels n > 20 cells from 3 independent experiments were analyzed. *P

    Techniques Used: Transfection, Diffusion-based Assay

    TTLL5 orTTLL9 cell depletion decreased MT glutamylation, reorganize the microtubule lattice and affect cell mechanic-dependent cell functions (a-l) HeLa cells were transfected with the indicated siRNA (control, siCtrl; TTLL and CCP, siRNA single, _s1, s2, s3) for 48h and plated on 50kPa hydrogel. (a , b) Immunoblot of Glu-Tubulin in cells. (c , e) Representative confocal images (left) and quantification (right; n > 50 cells from 3 independent experiments) of Glu-Tubulin and Tubulin in cells. Scale bar=10 µm. At least 10 cells per condition from n=3 independent experiments. (d, f) Representative alignment of microtubule in cells. (g , h) Quantification of circularity index of cells. (i-j) Proliferation rate of cells. (k-l) Cell velocity (left) and speed (right) of cells. In all the panels n > 50 cells from 3 independent experiments were analyzed. *P
    Figure Legend Snippet: TTLL5 orTTLL9 cell depletion decreased MT glutamylation, reorganize the microtubule lattice and affect cell mechanic-dependent cell functions (a-l) HeLa cells were transfected with the indicated siRNA (control, siCtrl; TTLL and CCP, siRNA single, _s1, s2, s3) for 48h and plated on 50kPa hydrogel. (a , b) Immunoblot of Glu-Tubulin in cells. (c , e) Representative confocal images (left) and quantification (right; n > 50 cells from 3 independent experiments) of Glu-Tubulin and Tubulin in cells. Scale bar=10 µm. At least 10 cells per condition from n=3 independent experiments. (d, f) Representative alignment of microtubule in cells. (g , h) Quantification of circularity index of cells. (i-j) Proliferation rate of cells. (k-l) Cell velocity (left) and speed (right) of cells. In all the panels n > 50 cells from 3 independent experiments were analyzed. *P

    Techniques Used: Transfection

    Microtubules glutamylation is orchestrated by TTLL4 and CCP5 to adjust cell mechanics and sustain cell mechanic-dependent activities. (a-j) HeLa cells were transfected with the indicated siRNA (control, siCtrl; TTLL and CCP, siRNA single, _s1, s2, s3) for 48h. (a) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP in cells plated on 1kPa hydrogel. n > 500 comets. Scale bar=1 µm. (b) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin in cells plated on 1kPa hydrogel (n > 45 cells). (c) Representative heat map (left) and quantification (right) showing contractile forces generate by cells plated on 12kPa hydrogel. (d) Representative confocal images (left) and quantification (right) of circularity index of cells plated on 1kPa hydrogel. Scale bar=10 µm. (e-f) Proliferation rate of cells plated on 50kPa (e) or 1kPa (f) hydrogel. (g-h) Measurement of cell adhesion on cells plated on 50kPa (g) or 1kPa (h) hydrogel. (i-j) Cell velocity (left) and speed (right) of cells plated on 50kPa (i) or 1kPa (j) hydrogel. In all the panels n > 50 cells from 3 independent experiments were analyzed. *P
    Figure Legend Snippet: Microtubules glutamylation is orchestrated by TTLL4 and CCP5 to adjust cell mechanics and sustain cell mechanic-dependent activities. (a-j) HeLa cells were transfected with the indicated siRNA (control, siCtrl; TTLL and CCP, siRNA single, _s1, s2, s3) for 48h. (a) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP in cells plated on 1kPa hydrogel. n > 500 comets. Scale bar=1 µm. (b) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin in cells plated on 1kPa hydrogel (n > 45 cells). (c) Representative heat map (left) and quantification (right) showing contractile forces generate by cells plated on 12kPa hydrogel. (d) Representative confocal images (left) and quantification (right) of circularity index of cells plated on 1kPa hydrogel. Scale bar=10 µm. (e-f) Proliferation rate of cells plated on 50kPa (e) or 1kPa (f) hydrogel. (g-h) Measurement of cell adhesion on cells plated on 50kPa (g) or 1kPa (h) hydrogel. (i-j) Cell velocity (left) and speed (right) of cells plated on 50kPa (i) or 1kPa (j) hydrogel. In all the panels n > 50 cells from 3 independent experiments were analyzed. *P

    Techniques Used: Transfection, Diffusion-based Assay

    Mechanical cues increase microtubules glutamylation and alter microtubules dynamics to force cell mechanics. (a) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of endogenous Tubulin labeled with Oregon Green™ 488 Taxol, Bis-Acetate in HeLa cells plated on different stiffness hydrogel (1, 12, 50 kPa) or plastic (n > 45 cells). (b) Representative heat map (left) and quantification (right; n > 15 cells from n=3 independent experiments) showing contractile forces generate by cells plated on 12kPa hydrogel and treated with Nocodazole or Taxol. (c) Immunoblot and quantification (n=3 independent experiments) of Glu-Tubulin in HeLa cells plated on 1 kPa hydrogel and after shear stress for the indicated times. Hsp90 was used as a loading control. (d , e) Immunoblot of Glu-Tubulin in MDA-MB-468 cells (d) and primary pulmonary arterial smooth muscle cells (PASMCs; e) plated on the indicated substrate. (f , h) Representative confocal images of Tubulin and Glu-Tubulin localization in HeLa cells plated on different stiffness hydrogel (1, 12, 50 kPa) or plated on 1kPa hydrogel and after osmotic stress for the indicated times. Nuclei were stained with DAPI (Blue) on the MERGE image. Quantification (right) of Glu-Tubulin intensity in the different condition. At least 50 cells per condition. Scale bar=10 µm. (g) Representative alignment of microtubule in HeLa cells plated on different stiffness hydrogel (1, 12, 50 kPa). At least 10 cells per condition. n=3 independent experiments; **P
    Figure Legend Snippet: Mechanical cues increase microtubules glutamylation and alter microtubules dynamics to force cell mechanics. (a) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of endogenous Tubulin labeled with Oregon Green™ 488 Taxol, Bis-Acetate in HeLa cells plated on different stiffness hydrogel (1, 12, 50 kPa) or plastic (n > 45 cells). (b) Representative heat map (left) and quantification (right; n > 15 cells from n=3 independent experiments) showing contractile forces generate by cells plated on 12kPa hydrogel and treated with Nocodazole or Taxol. (c) Immunoblot and quantification (n=3 independent experiments) of Glu-Tubulin in HeLa cells plated on 1 kPa hydrogel and after shear stress for the indicated times. Hsp90 was used as a loading control. (d , e) Immunoblot of Glu-Tubulin in MDA-MB-468 cells (d) and primary pulmonary arterial smooth muscle cells (PASMCs; e) plated on the indicated substrate. (f , h) Representative confocal images of Tubulin and Glu-Tubulin localization in HeLa cells plated on different stiffness hydrogel (1, 12, 50 kPa) or plated on 1kPa hydrogel and after osmotic stress for the indicated times. Nuclei were stained with DAPI (Blue) on the MERGE image. Quantification (right) of Glu-Tubulin intensity in the different condition. At least 50 cells per condition. Scale bar=10 µm. (g) Representative alignment of microtubule in HeLa cells plated on different stiffness hydrogel (1, 12, 50 kPa). At least 10 cells per condition. n=3 independent experiments; **P

    Techniques Used: Diffusion-based Assay, Labeling, Multiple Displacement Amplification, Staining

    Mechanical cues force microtubules glutamylation to stabilize the microtubule lattice. (a) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin (n > 45 cells) (b) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP in cells plated on the indicated substrate. n > 500 comets. Scale bar=1 µm. (c-d) Immunoblot and quantification of Glu-Tubulin in cells plated on the indicated substrate (c) or after hypo-osmotic shock ( d). (e-f) Representative STED images of Tubulin and Glu-Tubulin localization (e) and representative alignment of microtubule (f) in cells plated on 1 or 50 kPa hydrogel (n > 10). Scale bar=10 µm; for the inset, scale bar=1 µm.; *P
    Figure Legend Snippet: Mechanical cues force microtubules glutamylation to stabilize the microtubule lattice. (a) Representative FRAP curves (left) and quantification of diffusion rate (t ½) and mobile fraction (right) of GFP-Tubulin (n > 45 cells) (b) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP in cells plated on the indicated substrate. n > 500 comets. Scale bar=1 µm. (c-d) Immunoblot and quantification of Glu-Tubulin in cells plated on the indicated substrate (c) or after hypo-osmotic shock ( d). (e-f) Representative STED images of Tubulin and Glu-Tubulin localization (e) and representative alignment of microtubule (f) in cells plated on 1 or 50 kPa hydrogel (n > 10). Scale bar=10 µm; for the inset, scale bar=1 µm.; *P

    Techniques Used: Diffusion-based Assay

    Microtubule glutamylation is sufficient to adjust cell mechanics and sustain cell mechanic-dependent activities. (a) Schematic representation of TUBA1A structure in wild type and mutant. (b-g) HeLa cells were transfected with TUBA1A constructs. (b) Immunoblot and quantification of Glu-Tubulin in cells. (c) Representative confocal images (left) and quantification (right) of Glu-Tubulin and Tubulin. Scale bar=10 µm. *: Transfected cell (d) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP. n > 500 comets. Scale bar=1 µm. (e) Apparent Young’s moduli obtained by AFM analysis. Bars represent the median. (f) Representative heat map (left) and quantification (right) showing contractile forces generate by cells. (g) Representative confocal images (left) and quantification (right) of circularity index. Scale bar=10 µm. In all the panels n > 50 cells from 3 independent experiments were analyzed. **P
    Figure Legend Snippet: Microtubule glutamylation is sufficient to adjust cell mechanics and sustain cell mechanic-dependent activities. (a) Schematic representation of TUBA1A structure in wild type and mutant. (b-g) HeLa cells were transfected with TUBA1A constructs. (b) Immunoblot and quantification of Glu-Tubulin in cells. (c) Representative confocal images (left) and quantification (right) of Glu-Tubulin and Tubulin. Scale bar=10 µm. *: Transfected cell (d) Representative kymographs (left) and growth rates quantification (right) of EB1-GFP. n > 500 comets. Scale bar=1 µm. (e) Apparent Young’s moduli obtained by AFM analysis. Bars represent the median. (f) Representative heat map (left) and quantification (right) showing contractile forces generate by cells. (g) Representative confocal images (left) and quantification (right) of circularity index. Scale bar=10 µm. In all the panels n > 50 cells from 3 independent experiments were analyzed. **P

    Techniques Used: Mutagenesis, Transfection, Construct

    Balanced microtubules glutamylation by TTL4 and CCP5 organize the microtubule lattice. (a-i) HeLa cells were transfected with the indicated siRNA (control, siCtrl; TTLL and CCP, siRNA smarpool or siRNA single, _s1, s2, s3) for 48h. (a , c-d) As demonstrated by RT-qPCR, effective siRNA knockdown was achieved in Hela cells. For each gene transcript, mean expression in control groups (siCtrl) were assigned a fold change of 1, to which relevant samples (transfected with a siRNA specific to that gene) were compared . (b , e-f) Immunoblot (b , e-f) and quantification (b) of Glu-Tubulin in cells. (g, i) Representative alignment of microtubule in cells in plated on 50 kPa (g) or 1kPa (i) hydrogels. (h) Representative confocal images (left) and quantification (right; n > 50 cells from 3 independent experiments) of Glu-Tubulin and Tubulin in cells plated on 1kPa hydrogel. Scale bar=10 µm. At least 10 cells per condition from n=3 independent experiments; *P
    Figure Legend Snippet: Balanced microtubules glutamylation by TTL4 and CCP5 organize the microtubule lattice. (a-i) HeLa cells were transfected with the indicated siRNA (control, siCtrl; TTLL and CCP, siRNA smarpool or siRNA single, _s1, s2, s3) for 48h. (a , c-d) As demonstrated by RT-qPCR, effective siRNA knockdown was achieved in Hela cells. For each gene transcript, mean expression in control groups (siCtrl) were assigned a fold change of 1, to which relevant samples (transfected with a siRNA specific to that gene) were compared . (b , e-f) Immunoblot (b , e-f) and quantification (b) of Glu-Tubulin in cells. (g, i) Representative alignment of microtubule in cells in plated on 50 kPa (g) or 1kPa (i) hydrogels. (h) Representative confocal images (left) and quantification (right; n > 50 cells from 3 independent experiments) of Glu-Tubulin and Tubulin in cells plated on 1kPa hydrogel. Scale bar=10 µm. At least 10 cells per condition from n=3 independent experiments; *P

    Techniques Used: Transfection, Quantitative RT-PCR, Expressing

    Mechanoactivation of GLS-dependent glutamine catabolism sustain microtubules glutamylation under mechanical stresses. (a-b, d-e) HeLa cells plated on the indicated substrate and treated with CB839 or BPTES. (a) Immunoblot and quantification (n=3 independent experiments) of Glu-Tubulin in cells. (b) Immunoblot and quantification (n=3) of Glu-Tubulin in HeLa cells after osmotic stress for the indicated times. Hsp90 was used as a loading control. (c) Immunoblot and quantification (n=3) of Glu-Tubulin in HeLa cells transfected with the siRNA GLS in presence of glutamate for 24h. (d) Representative confocal images (left) and quantification (right; n > 50 cells from n=3 independent experiments) of Glu-Tubulin and Tubulin in presence of glutamate for 24h. Nuclei were stained with DAPI (Blue) on the MERGE image.Scale bar=10 µm. At least 50 cells per condition from 3 independent experiments. Scale bar=10 µm. (e) Representative alignment of microtubule in cells in presence of glutamate for 24h. At least 10 cells per condition from n=3 independent experiments; *P
    Figure Legend Snippet: Mechanoactivation of GLS-dependent glutamine catabolism sustain microtubules glutamylation under mechanical stresses. (a-b, d-e) HeLa cells plated on the indicated substrate and treated with CB839 or BPTES. (a) Immunoblot and quantification (n=3 independent experiments) of Glu-Tubulin in cells. (b) Immunoblot and quantification (n=3) of Glu-Tubulin in HeLa cells after osmotic stress for the indicated times. Hsp90 was used as a loading control. (c) Immunoblot and quantification (n=3) of Glu-Tubulin in HeLa cells transfected with the siRNA GLS in presence of glutamate for 24h. (d) Representative confocal images (left) and quantification (right; n > 50 cells from n=3 independent experiments) of Glu-Tubulin and Tubulin in presence of glutamate for 24h. Nuclei were stained with DAPI (Blue) on the MERGE image.Scale bar=10 µm. At least 50 cells per condition from 3 independent experiments. Scale bar=10 µm. (e) Representative alignment of microtubule in cells in presence of glutamate for 24h. At least 10 cells per condition from n=3 independent experiments; *P

    Techniques Used: Transfection, Staining

    5) Product Images from "HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission"

    Article Title: HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission

    Journal: Cell host & microbe

    doi: 10.1016/j.chom.2018.12.008

    Actin cytoskeletal disruption restrains initial viral dissemination (A) ORF diagrams of HIV Nef WT and HIV Nef F191A . (B) 10 4 IUs each of each clone were intravaginally co-inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured at week two, followed the next day by tissue harvest or, in non-viremic animals, repeat intravaginal inoculation and tissue harvest at week three. (C) Plasma viremia. Dashed line and grey-shaded area indicate mean and range of background signals in three uninfected control animals. (D) Ratio of nef WT (red) or nef F191A (green) NGS reads (~2 × 10 4 total reads/sample) from plasma vRNA obtained at the time of initial viremia. Numbers indicate individual animals. HIV nef WT vRNA was undetectable at any time in plasma or any tissue analyzed in the four animals grouped on the left. (E) ORF diagrams of HIV Nef WT and HIV ΔNef. (F) 10 4 IUs each of HIV Nef WT and HIV ΔNef were intravaginally inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured weekly starting at week 2. Non-viremic animals received repeat intravaginal inoculations the next day. (G) Plasma viremia. Dotted line and grey-shaded area indicate mean and range of background signals. (H, I) Ratio of NGS reads (~2 × 10 4 total reads/sample) for nef WT (red) or Δ nef (green) from plasma vRNA obtained at the time of initial viremia (H) or at the time of sacrifice (I). Numbers indicate individual animals. Either nef WT or Δ nef vRNA were undetectable in any samples in the animals grouped on the left (n=1) or on the right (n=2), respectively.
    Figure Legend Snippet: Actin cytoskeletal disruption restrains initial viral dissemination (A) ORF diagrams of HIV Nef WT and HIV Nef F191A . (B) 10 4 IUs each of each clone were intravaginally co-inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured at week two, followed the next day by tissue harvest or, in non-viremic animals, repeat intravaginal inoculation and tissue harvest at week three. (C) Plasma viremia. Dashed line and grey-shaded area indicate mean and range of background signals in three uninfected control animals. (D) Ratio of nef WT (red) or nef F191A (green) NGS reads (~2 × 10 4 total reads/sample) from plasma vRNA obtained at the time of initial viremia. Numbers indicate individual animals. HIV nef WT vRNA was undetectable at any time in plasma or any tissue analyzed in the four animals grouped on the left. (E) ORF diagrams of HIV Nef WT and HIV ΔNef. (F) 10 4 IUs each of HIV Nef WT and HIV ΔNef were intravaginally inoculated into BLT NSG mice at 50:50 ratio (based on I.U.). Plasma viremia was measured weekly starting at week 2. Non-viremic animals received repeat intravaginal inoculations the next day. (G) Plasma viremia. Dotted line and grey-shaded area indicate mean and range of background signals. (H, I) Ratio of NGS reads (~2 × 10 4 total reads/sample) for nef WT (red) or Δ nef (green) from plasma vRNA obtained at the time of initial viremia (H) or at the time of sacrifice (I). Numbers indicate individual animals. Either nef WT or Δ nef vRNA were undetectable in any samples in the animals grouped on the left (n=1) or on the right (n=2), respectively.

    Techniques Used: Mouse Assay, Next-Generation Sequencing

    Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.
    Figure Legend Snippet: Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.

    Techniques Used: Migration, Expressing, Infection, Injection, Mutagenesis, Mouse Assay

    The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .
    Figure Legend Snippet: The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .

    Techniques Used: Infection, Expressing, Fluorescence

    6) Product Images from "Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas"

    Article Title: Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04128-5

    Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Mutagenesis, Expressing, Transformation Assay, Growth Assay, Stable Transfection, Plasmid Preparation, MTT Assay, Proliferation Assay, Wound Healing Assay

    Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation

    Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P
    Figure Legend Snippet: Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P

    Techniques Used: Inhibition, Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation, Proliferation Assay

    7) Product Images from "Cell entry of a host-targeting protein of oomycetes requires gp96"

    Article Title: Cell entry of a host-targeting protein of oomycetes requires gp96

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04796-3

    Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: Molecular tweezers inhibit the translocation of SpHtp3. a Superimposition of the 10 lowest-energy NMR-based structures of the C-terminal peptide of SpHtp3 with the central helix (P204-K211) highlighted. b Electrostatic surface presentation of the C-terminal peptide of SpHtp3. Positive, neutral and negative charges are displayed in blue, grey and red, respectively. c Superimposition of the NMR-based structures of the C-terminal peptide wt (blue) and the double mutant (K208A/R210A, red) of SpHtp3 with the central helix (P204-K211). d 1 H-1D NMR titration experiments of the SpHtp3 peptide with a stepwise increasing amount of tweezers as indicated. Decreasing signal intensities indicate an interaction of both. e Effect of molecular tweezers on the translocation of SpHtp3-mRFP into RTG-2 cells. With increasing tweezers’ concentrations, the uptake and cell surface binding of SpHtp3 are interrupted. Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Translocation Assay, Nuclear Magnetic Resonance, Mutagenesis, Titration, Binding Assay

    Model for the self-translocation of SpHtp3 into host cells and its vesicle release. The fish-pathogenic oomycete S. parasitica secretes several effector proteins during different stages of infection. The nuclease SpHtp3 is secreted in the later stages of infection. S. parasitica acidifies the pH of its environment, which likely leads to the exposure of a gp96-like protein to the host cell surface. The gp96-like protein is working as a receptor and mediates the translocation of SpHtp3 via lipid rafts into the cell. Finally, SpHtp3 is released from vesicles with the help of other effector proteins, as SpHtp1, into the cytosol where it is functionally active as a nuclease
    Figure Legend Snippet: Model for the self-translocation of SpHtp3 into host cells and its vesicle release. The fish-pathogenic oomycete S. parasitica secretes several effector proteins during different stages of infection. The nuclease SpHtp3 is secreted in the later stages of infection. S. parasitica acidifies the pH of its environment, which likely leads to the exposure of a gp96-like protein to the host cell surface. The gp96-like protein is working as a receptor and mediates the translocation of SpHtp3 via lipid rafts into the cell. Finally, SpHtp3 is released from vesicles with the help of other effector proteins, as SpHtp1, into the cytosol where it is functionally active as a nuclease

    Techniques Used: Translocation Assay, Fluorescence In Situ Hybridization, Infection

    SpHtp3 is released from vesicles with the help of SpHtp1 from S. parasitica . a RTG-2 cells in direct contact with S. parasitica are shrunk with a condensed nucleus. In these cells, no cytosolic RNA (SytoRNA) can be detected and infected cells contain a high amount of vesicles (membrane stain FM4-64FX, see also Fig. 1b ). In contrast, cells in close proximity but no direct contact do not show any morphological abnormalities (*). Scale bar: 20 µm ( n = 3). b RTG-2 cells (c) were challenged with S. parasitica (h) after 1 h incubation with SpHtp3-mRFP. A hyphal tip (arrowhead, DIC) is attacking an RTG-2 cell. Magnification of the infected cell (red square) at different time points (bottom) show vesicles disappearing within a minute (arrowheads). See also Supplementary Movie 1 . In contrast, cells in close proximity but no direct contact to S. parasitica contain less disappearing vesicles (*). Scale bar: 20 µm ( n = 3). c Quantification of SpHtp3-mRFP containing vesicles of RTG-2 cells from b over time. d Vesicle release of SpHtp3-mRFP into the cytosol of RTG-2 cells after pre-incubation with SpHtp1 21–198 -His 6 at pH 7.5. SpHtp3 accumulates in vesicles of RTG-2 cells after self-translocation (see also Fig. 2d ). However, after co-incubation of SpHtp1 with SpHtp3, the number of vesicles in the periphery of the cells is reduced and the cytosolic fluorescence of RFP increased. Pictures were taken with a Zeiss Imager M2. Scale bar: 20 µm ( n = 2). e Fluorescence intensity of SpHtp3-mRFP across the cell as indicated by dashed lines in d . f In vitro complex formation of recombinant SpHtp1-His 6 and SpHtp3-His 6 after cross-link verified by LC-MS/MS (Supplementary Table 2 ). An additional band, which only appears in the sample with both proteins is highlighted (Complex)
    Figure Legend Snippet: SpHtp3 is released from vesicles with the help of SpHtp1 from S. parasitica . a RTG-2 cells in direct contact with S. parasitica are shrunk with a condensed nucleus. In these cells, no cytosolic RNA (SytoRNA) can be detected and infected cells contain a high amount of vesicles (membrane stain FM4-64FX, see also Fig. 1b ). In contrast, cells in close proximity but no direct contact do not show any morphological abnormalities (*). Scale bar: 20 µm ( n = 3). b RTG-2 cells (c) were challenged with S. parasitica (h) after 1 h incubation with SpHtp3-mRFP. A hyphal tip (arrowhead, DIC) is attacking an RTG-2 cell. Magnification of the infected cell (red square) at different time points (bottom) show vesicles disappearing within a minute (arrowheads). See also Supplementary Movie 1 . In contrast, cells in close proximity but no direct contact to S. parasitica contain less disappearing vesicles (*). Scale bar: 20 µm ( n = 3). c Quantification of SpHtp3-mRFP containing vesicles of RTG-2 cells from b over time. d Vesicle release of SpHtp3-mRFP into the cytosol of RTG-2 cells after pre-incubation with SpHtp1 21–198 -His 6 at pH 7.5. SpHtp3 accumulates in vesicles of RTG-2 cells after self-translocation (see also Fig. 2d ). However, after co-incubation of SpHtp1 with SpHtp3, the number of vesicles in the periphery of the cells is reduced and the cytosolic fluorescence of RFP increased. Pictures were taken with a Zeiss Imager M2. Scale bar: 20 µm ( n = 2). e Fluorescence intensity of SpHtp3-mRFP across the cell as indicated by dashed lines in d . f In vitro complex formation of recombinant SpHtp1-His 6 and SpHtp3-His 6 after cross-link verified by LC-MS/MS (Supplementary Table 2 ). An additional band, which only appears in the sample with both proteins is highlighted (Complex)

    Techniques Used: Infection, Staining, Incubation, Translocation Assay, Fluorescence, In Vitro, Recombinant, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)
    Figure Legend Snippet: SpHtp3 is a self-translocating nuclease. a Amino acid sequence of SpHtp3 (top), including the secretion signal (M1-G21, underlined), the RxLR sequence (R48-R51, red) and the predicted nuclease domain (L89-S197, bold). Protein domain structure of SpHtp3 (bottom). b Visualisation of RNA (left, RTG-2 cell RNA) and DNA (right, linearised pET21b) degrading activities of SpHtp3-His 6 and SpHtp3-mRFP ( n = 3). c Real-time ribonuclease activity assessment of SpHtp3 wt (black) compared to a negative control (SpHtp1-mRFP, red) and a non-functional mutant of SpHtp3 (GTLG, blue) with RNaseAlert® ( n = 2). d Autonomous translocation activity of recombinant SpHtp3-mRFP into living RTG-2 cells at pH 7.5 and 5.5. The control (mRFP only) does not show any translocation. Scale bar: 20 µm ( n = 3)

    Techniques Used: Sequencing, Activity Assay, Negative Control, Functional Assay, Mutagenesis, Translocation Assay, Recombinant

    SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p
    Figure Legend Snippet: SpHtp3 is taken up via a gp96-like receptor. a Uptake inhibition of SpHtp3-mRFP into RTG-2 cells pre-incubated for 1 h with the inhibitors dynasore, brefeldin A or nystatin (top) and respective quantification (bottom). Nuclei are indicated by dashed lines. Error bars denote s.e.m. (cells: 50). *** p

    Techniques Used: Inhibition, Incubation

    SpHtp3 self-translocates into host cells via its C-terminus. a Self-translocation of SpHtp3-mRFP wt, SpHtp3-mRFP 21–55 (containing the RTLR sequence), a mutant of SpHtp3-mRFP RTLR/GTLG and mRFP only into living RTG-2 cells at pH 5.5. Scale bar: 20 µm ( n = 3). b Quantitative FACS analysis of RTG-2 cells from Figs. 2d and 3a. Error bars denote s.e.m. ( n = 3). *** p
    Figure Legend Snippet: SpHtp3 self-translocates into host cells via its C-terminus. a Self-translocation of SpHtp3-mRFP wt, SpHtp3-mRFP 21–55 (containing the RTLR sequence), a mutant of SpHtp3-mRFP RTLR/GTLG and mRFP only into living RTG-2 cells at pH 5.5. Scale bar: 20 µm ( n = 3). b Quantitative FACS analysis of RTG-2 cells from Figs. 2d and 3a. Error bars denote s.e.m. ( n = 3). *** p

    Techniques Used: Translocation Assay, Sequencing, Mutagenesis, FACS

    8) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.
    Figure Legend Snippet: Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.

    Techniques Used: Western Blot, Quantitative RT-PCR, Staining, Recombinant

    9) Product Images from "Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus"

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-31098-x

    The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus MurE (Protein Data Bank ID 4c12) 32 and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.
    Figure Legend Snippet: The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus MurE (Protein Data Bank ID 4c12) 32 and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Techniques Used: Binding Assay, Thin Layer Chromatography, Activity Assay, Mutagenesis

    Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b ) Schematic overview of GatD and MurT proteins. GatD consists of a single glutamine amidotransferase (GATase) domain with a cysteine at position 94 as the active residue and a histidine at position 189 as a component of the catalytic triad 19 . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . 24 . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c indicating the middle and C-terminal domains, respectively. The drawing was generated with TopDraw 54 .
    Figure Legend Snippet: Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b ) Schematic overview of GatD and MurT proteins. GatD consists of a single glutamine amidotransferase (GATase) domain with a cysteine at position 94 as the active residue and a histidine at position 189 as a component of the catalytic triad 19 . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . 24 . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c indicating the middle and C-terminal domains, respectively. The drawing was generated with TopDraw 54 .

    Techniques Used: Binding Assay, Isolation, Generated

    10) Product Images from "miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma"

    Article Title: miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma

    Journal: Cell Death and Differentiation

    doi: 10.1038/s41418-017-0053-8

    miR-137 directly targets SLC1A5 in melanoma cells. a Sequence alignment of miR-137 and the 3′-UTR of SLC1A5 or SLC38A1. The seed sequence of miR-137 and the binding sites in 3′-UTR are indicated in red. The 3′-UTR mutants containing mismatched nucleotides are shown at the bottom. The binding site of SLC1A5 is highly conserved in several species (left), but the binding site of SLC38A1 is not conserved between different species (right). b miR-137 overexpression inhibited the expression of 3′-UTR-luciferase reporter of SLC1A5 in A375 and G-361 cells, but the mutant construct was immune to miR-137. Data are mean ± SD from three independent experiments. *** p
    Figure Legend Snippet: miR-137 directly targets SLC1A5 in melanoma cells. a Sequence alignment of miR-137 and the 3′-UTR of SLC1A5 or SLC38A1. The seed sequence of miR-137 and the binding sites in 3′-UTR are indicated in red. The 3′-UTR mutants containing mismatched nucleotides are shown at the bottom. The binding site of SLC1A5 is highly conserved in several species (left), but the binding site of SLC38A1 is not conserved between different species (right). b miR-137 overexpression inhibited the expression of 3′-UTR-luciferase reporter of SLC1A5 in A375 and G-361 cells, but the mutant construct was immune to miR-137. Data are mean ± SD from three independent experiments. *** p

    Techniques Used: Sequencing, Binding Assay, Over Expression, Expressing, Luciferase, Mutagenesis, Construct

    11) Product Images from "Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas"

    Article Title: Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04128-5

    Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Mutant HRAS Q61R expression induces transformation and growth in non-malignant breast epithelial cells. a Representative images of soft agar anchorage-independent growth assay of parental MCF-10A PIK3CA -wild-type (MCF-10A P ), MCF-10A PIK3CA H1047R-mutant (MCF-10A H1047R ), and MCF-12A cells stably expressing empty vector (EV), HRAS-wild-type (HRAS WT ), or HRAS Q61R-mutant (HRAS Q61R ) protein (scale bars, 2 mm). Boxplots showing the quantification of the size of colonies (see Methods). The mean value of the size of colonies, and the 75th and 25th percentiles are displayed at the top and bottom of the boxes, respectively. b MTT cell proliferation assay of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV (black), HRAS WT (yellow), or mutant HRAS Q61R (red) protein. c The migratory effects of MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing EV, HRAS WT , or mutant HRAS Q61R were analyzed using the wound-healing assay at 0 and 24 h. Scale bars, 500 µm. In a − c , data are representative of three independent experiments. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Mutagenesis, Expressing, Transformation Assay, Growth Assay, Stable Transfection, Plasmid Preparation, MTT Assay, Proliferation Assay, Wound Healing Assay

    Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P
    Figure Legend Snippet: Expression of mutant HRAS Q61R results in the acquisition of a partial myoepithelial phenotype in non-malignant breast epithelial cells. a Representative western blot (left) analysis of total protein expression of alpha-smooth muscle actin (αSMA), TIMP1, cytokeratin 5 (CK5), E-cadherin, vimentin, and nuclear protein expression of ∆N-p63 and TA-p63 in MCF-10A P , MCF-10A H1047R , and MCF-12A cells stably expressing empty vector (EV), HRAS WT , or mutant HRAS Q61R . α-Tubulin and Histone H3 were used as protein loading controls for total and nuclear protein expression, respectively. Quantification (right) using LI-COR is shown based on experiments done in triplicate. Comparisons of protein levels were performed between HRAS WT and mutant HRAS Q61R , both relative to EV. Error bars, s.d. of mean ( n = 3). n.s. = not significant, * P

    Techniques Used: Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation

    Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P
    Figure Legend Snippet: Impact of AKT and MEK inhibition on PI3K-AKT and MAPK signaling pathways and proliferation in non-malignant breast epithelial cells expressing mutant HRAS Q61R . a Representative western blot analysis of p-ERK1/2 (T202/Y204), p-p90 RSK (S380), p-AKT (S473), p-AKT (T308), p-PRAS40 (T246), p-FOXO1/3a/4, p-GSK3β (S9), p-mTOR (S2448), p-p70 S6K (T389), and p-S6 (S240/244) protein in MCF-10A P and MCF-10A H1047R cells stably expressing empty vector (EV) or mutant HRAS Q61R treated with 2 µM AKT inhibitor (AKTi, MK2206) at different time points. β-actin was used as a protein loading control. Experiments were repeated at least twice with similar results . b Cell proliferation assay of MCF-10A P and MCF-10A H1047R cells stably expressing EV or mutant HRAS Q61R . **** P

    Techniques Used: Inhibition, Expressing, Mutagenesis, Western Blot, Stable Transfection, Plasmid Preparation, Proliferation Assay

    12) Product Images from "Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases"

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    Journal: The EMBO Journal

    doi: 10.15252/embj.201798047

    Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.
    Figure Legend Snippet: Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.

    Techniques Used: Isolation, Mutagenesis, Inhibition, Western Blot, Expressing, In Vitro, Activity Assay

    TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.
    Figure Legend Snippet: TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.

    Techniques Used: Functional Assay, Binding Assay, Plaque Assay, Staining, Mutagenesis, Western Blot, Stable Transfection, Immunoprecipitation

    49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.
    Figure Legend Snippet: 49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.

    Techniques Used: Inhibition, Luciferase, Sequencing

    13) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P

    Techniques Used: Binding Assay, Luciferase, Western Blot, Quantitative RT-PCR, Construct, Expressing, Staining, Recombinant, Agarose Gel Electrophoresis, In Vitro, Activity Assay

    N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.
    Figure Legend Snippet: N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.

    Techniques Used: Labeling, Staining, Recombinant, Purification, Western Blot, Quantitative RT-PCR

    Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.
    Figure Legend Snippet: Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.

    Techniques Used: Western Blot, Quantitative RT-PCR, Staining, Recombinant

    N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P

    Techniques Used: Mutagenesis, Western Blot, Quantitative RT-PCR

    14) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.
    Figure Legend Snippet: METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.

    Techniques Used: Western Blot, Histone Association Assay, Binding Assay, Transfection, Mass Spectrometry, SDS Page, Staining

    15) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.
    Figure Legend Snippet: METTL3 associates with translation initiation factors. a, Deletion mutants of METTL3 were expressed in HeLa cell. The total-cell extracts (Input) and the cap-associated protein samples were analyzed by Western blotting using the indicated antibodies. Two independently performed experiments show similar results. b, Cap-association assay with METTL3 depletion. The total-cell extracts (Input) and the cap-bound protein samples were analyzed by Western blotting using the indicated antibodies. m 7 GpppG cap analogue was used for antagonizing cap-associating proteins binding to m 7 GTP-Agarose. Two independently performed experiments show similar results. c, Same as ( b ) except HeLa cells were transfected with CTIF, eIF3b or eIF4GI siRNA. Two independently performed experiments show similar results. d-f, Mass spectrometry of FLAG-METTL3 interacting proteins. d, Proteins that were co-immunopurified with FLAG-METTL3 subjected to 4-12% Tris-Glycine SDS-PAGE. Colloidal Coomassie blue staining was performed. n=1 independent experiment. e, Gene ontology analysis of the identified proteins from Mass spectrometry. n=1 independent experiment. Hypergeometric distribution (one-tail) with Bonferroni adjustment was used to determine enrichment statistical significance. f, Table showing the translation involving factors identified from Mass spectrometry.

    Techniques Used: Western Blot, Histone Association Assay, Binding Assay, Transfection, Mass Spectrometry, SDS Page, Staining

    16) Product Images from "Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus"

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-31098-x

    Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c .
    Figure Legend Snippet: Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c .

    Techniques Used: Binding Assay, Isolation

    The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.
    Figure Legend Snippet: The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Techniques Used: Binding Assay, Thin Layer Chromatography, Activity Assay, Mutagenesis

    17) Product Images from "mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis"

    Article Title: mRNA circularization by METTL3-eIF3h enhances translation and promotes oncogenesis

    Journal: Nature

    doi: 10.1038/s41586-018-0538-8

    METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: METTL3 binding close to the stop codon enhances translation. a, Schematic diagram of reporter plasmids containing Firefly luciferase cDNA and different positions of MS2 binding sites. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. Each tested reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio for each construct with FLAG-MS2 expression was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency as described in ( Fig. 1h ). Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. e, Colloidal Coomassie blue staining of recombinant protein His-FLAG-MS2, His-FLAG-MS2-METTL3, or His-FLAG-MS2-METTL3 (1-200). Two independently performed experiments show similar results. f, Ethidium bromide-stained agarose gel electrophoresis of the indicated in vitro transcribed reporter mRNAs; FLuc-MS2bs without poly (A) tail (Poly (A) -) or FLuc-MS2bs with 30nt poly (A) tail (Poly (A) +). Two independently performed experiments show similar results. g, In vitro translation of reporter mRNAs using either H1299 cell extracts or Rabbit reticulocyte lysate (RRL). The levels of in vitro -translated FLuc protein were analyzed using luciferase assays. Value of FLuc activity in the presence of His-FLAG-MS2 recombinant protein was set to 1.0. Error bars represent mean ± SD; n = 6 independent experiments. Two-sided t-test, *** denotes multiple comparison for the p-values showing P

    Techniques Used: Binding Assay, Luciferase, Western Blot, Quantitative RT-PCR, Construct, Expressing, Staining, Recombinant, Agarose Gel Electrophoresis, In Vitro, Activity Assay

    N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.
    Figure Legend Snippet: N-terminal region of METTL3 directly interacts with MPN domain of eIF3h. a, EM images of polyribosome with METTL3-gold particle labeling. Red arrows indicate METTL3 with immuno-gold particle (6 nm). Three independently performed experiments show similar results. b, Counting of METTL3 with gold particle labeling in each polyribosome. c, EM images of polyribosome with METTL3 and eIF4E. Red arrows indicate METTL3 with immuno-gold particle (6 nm) and yellow arrows indicate eIF4E with immuno-gold particle (10 nm). Four independently performed experiments show similar results. d, Average distance between immuno-gold particles was measured. n = 6 biologically independent samples from at least three independent experiments. Error bars represent mean ± SD. e, Colloidal Coomassie blue staining of recombinant protein His-METTL3 or His-METTL3 1-200 amino acid fragments (1-200). Two independently performed experiments show similar results. f, Colloidal Coomassie blue staining of recombinant GST-tagged protein eIF3g, eIF3h, eIF3i, eIF3j or eIF3m. Two independently performed experiments show similar results. g, GST-eIF3h was co-purified with His-METTL3 in the presence of either rabbit IgG (rIgG) or α-METTL3 antibody. Levels of co-purified His-METTL3 were analyzed by Western blotting. Two independently performed experiments show similar results. h, Schematic diagram of human eIF3h deletion mutants. i, Colloidal Coomassie blue staining of recombinant GST-eIF3h, -eIF3h (1-222) or -eIF3h (29-222). n = 1 independent experiments. j, GST pull-down of indicated eIF3h deletion mutants. Co-purified His-METTL3 was analyzed by Western blotting. n = 1 independent experiments. k, Western blotting demonstrates efficient knockdown of eIF3h protein. Three independently performed experiments show similar results. l, qRT-PCR analysis demonstrates efficient down regulation of eIF3h mRNA. Error bars represent mean ± SD; n = 3 biologically independent samples; two-sided t-test. m, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs reporter mRNAs were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples.

    Techniques Used: Labeling, Staining, Recombinant, Purification, Western Blot, Quantitative RT-PCR

    Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.
    Figure Legend Snippet: Identification of a conserved Alanine residue in the N-terminal region of METTL3 required for its interaction with eIF3h. a, Secondary structure prediction of the N-terminal (1-200) region of METTL3 protein showing putative alpha helices (blue lines). b, Evolutionary conservation of the N-terminal (1-200) region METTL3 protein. c, Computational modeling of the 3D structure of the N-terminal (77-163) region METTL3 protein, based on the coordinates of PDB: 3HHH. d, Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. e, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 6 independent experiments. f, IP of FLAG-METTL3 WT or A155P and Western blotting analysis using indicated antibodies. Two independently performed experiments show similar results. g, Staining of recombinant protein His-FLAG-MS2-METTL3 WT or His-FLAG-MS2-METTL3 A155P. Two independently performed experiments show similar results.

    Techniques Used: Western Blot, Quantitative RT-PCR, Staining, Recombinant

    N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P
    Figure Legend Snippet: N-terminal region of METTL3 promotes translation. a, Schematic diagram of METTL3 deletion mutants or mutation in METTL3 catalytic domain. b, Western blotting with indicated antibodies. Two independently performed experiments show similar results. c, qRT-PCR analysis of reporter mRNAs. FLuc-MS2bs mRNA levels were normalized to RLuc mRNAs. The FLuc:RLuc ratio obtained in FLAG-MS2 (control) was set to 1. Error bars represent mean ± SD; n = 3 biologically independent samples. d, Tethering assay to measure translation efficiency of reporter mRNAs as described in ( Fig. 1 h ). Error bars represent mean ± SD; n = 3 biologically independent samples. Two-sided t-test, ** denotes multiple comparison for the p-values showing P

    Techniques Used: Mutagenesis, Western Blot, Quantitative RT-PCR

    18) Product Images from "The dual role of chloride in synaptic vesicle glutamate transport"

    Article Title: The dual role of chloride in synaptic vesicle glutamate transport

    Journal: eLife

    doi: 10.7554/eLife.34896

    Chloride and glutamate currents in endosomes expressing mutant VGLUTs. Compiled data ( A–C ) and sample traces ( D–I ) for alanine substitutions at conserved arginine residues in TM7, 1 and 4 of VGLUT1 ( A ), VGLUT2 ( B,D–F ) and VGLUT3 ( C,G–I ). All endosomes were recorded with 140 mM NMDG Cl at pH 5.0 in the pipette (n = 3–5) except for those expressing the arginine mutant in TM4, which were recorded with 140 mM NMDG gluconate (0 mM Cl - ) in the pipette (n = 4–7). The baselines for outward Cl - and glutamate currents were defined as in Figure 1—figure supplement 1 and Figure 2—figure supplement 2 . Bar graphs indicate mean ± SEM. +p
    Figure Legend Snippet: Chloride and glutamate currents in endosomes expressing mutant VGLUTs. Compiled data ( A–C ) and sample traces ( D–I ) for alanine substitutions at conserved arginine residues in TM7, 1 and 4 of VGLUT1 ( A ), VGLUT2 ( B,D–F ) and VGLUT3 ( C,G–I ). All endosomes were recorded with 140 mM NMDG Cl at pH 5.0 in the pipette (n = 3–5) except for those expressing the arginine mutant in TM4, which were recorded with 140 mM NMDG gluconate (0 mM Cl - ) in the pipette (n = 4–7). The baselines for outward Cl - and glutamate currents were defined as in Figure 1—figure supplement 1 and Figure 2—figure supplement 2 . Bar graphs indicate mean ± SEM. +p

    Techniques Used: Expressing, Mutagenesis, Transferring

    19) Product Images from "HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission"

    Article Title: HIV-1 Balances the Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton Early after Mucosal Transmission

    Journal: Cell host & microbe

    doi: 10.1016/j.chom.2018.12.008

    Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.
    Figure Legend Snippet: Nef interferes with cell migration by activating PAK2. (A) Cell surface expression of CD4 and MHC I on uninfected T CM (black histograms) or T CM infected with HIV-GFP encoding either wildtype Nef, ΔNef, Nef F191A or Nef LLAA (green histograms). (B) Frequency of infected T cells. (C) Frequency of viable (Annexin V − ) infected cells on day two. (D) Exp. protocol and CD4 expression by infected cells in draining popLNs 2 days following footpad co-injection of WT and F191A mutant reporter strains. Grey histogram shows uninfected LN CD4 + T cells. (E) Mean track velocities and (F) Arrest coefficients of HIV infected T cells. Uninfected T CM recorded in LNs of separate BLT NS mice are shown for reference. Data are pooled from 17 individual recordings from 5 animals. Blue lines and numbers above graphs indicate medians. n.s. = not significant.

    Techniques Used: Migration, Expressing, Infection, Injection, Mutagenesis, Mouse Assay

    The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .
    Figure Legend Snippet: The NL4-3 Nef hydrophobic patch perturbs actin cytoskeletal function in migrating HIV-infected T cells (A) ORF diagram of HIV-Lifeact-GFP. (B) Experimental protocol. (C) Time-lapse series (2 pairs of consecutive frames/cell) of T CM infected with HIV-Lifeact-GFP expressing Nef WT (top two rows) or Nef F191A (bottom row). Fluorescence intensity is represented using a heat map look-up table. Elapsed time in minutes:seconds. Arrowheads indicate small peripheral F-actin clusters. Arrows indicate large F-actin clusters predominantly observed in the uropod of polarized cells. (D) Fractions of cells forming lamellipodia (‘polarized’) or not (‘non-polarized’), and of cells ‘transitioning’ between these states, of a total of 43 (Nef WT ) and 21 (Nef F191A ) cell traces from 3 independent experiments. Mean ± SEM. (E) Rectangular ROIs were used to longitudinally measure MFIs at randomly chosen sites in non-polarized cells (repositioned for each time-point to capture the same aspect of the cell) and at the leading edge of polarized cells (repositioned for each time-point perpendicular to the direction of movement). MFIs were normalized to a value of ‘1’ for individual cells and plotted over time for 5 representative cells from each group to compare the fluctuations of F-actin polymerization in infected T cells expressing Nef WT or Nef F191A .

    Techniques Used: Infection, Expressing, Fluorescence

    20) Product Images from "Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis"

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1900101116

    Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P
    Figure Legend Snippet: Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Techniques Used: Mutagenesis, Activation Assay, Transfection, Luciferase, Plasmid Preparation, Expressing, Quantitative RT-PCR

    Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P
    Figure Legend Snippet: Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Techniques Used: Quantitative RT-PCR, Infection, Migration, Transfection

    P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P
    Figure Legend Snippet: P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Techniques Used: Infection, Quantitative RT-PCR, Confocal Microscopy, Staining, Software

    ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P
    Figure Legend Snippet: ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Techniques Used: Transfection, Infection, Quantitative RT-PCR, Plasmid Preparation, Expressing, Mutagenesis, Protease Inhibitor, Migration, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Binding Assay

    Related Articles

    Transfection:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Luciferase:

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    In Vitro:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Mutagenesis:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Article Title: Phytochrome Signaling Is Mediated by PHYTOCHROME INTERACTING FACTOR in the Liverwort Marchantia polymorpha
    Article Snippet: .. To obtain the overexpression lines of Mp- PHYY241H , the plasmid carrying Mp- PHY cDNA was mutagenized using a Phusion site-directed mutagenesis kit (New England Biolabs) with the primer pair 5′-CACACAAATTCCATGAGGAT-3′ and 5′-CCATAACCCGGTCGTAACCT-3′. .. The cloned sequence was then transferred to the pMpGWB103 vector to generate pMH03.

    Article Title: Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae
    Article Snippet: .. Site-specific mutagenesis of CBP60g was performed using the Phusion™ Site-Directed Mutagenesis Kit (New England Biolabs Inc., MA USA). .. For determination of CaM binding and production of transgenic plants carrying mutated versions of CBP60g , site-specific mutagenesis was carried out beginning with a full-length cDNA clone or a genomic clone, respectively, in pCR8.

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Biochemical Analysis of the Complex between the Tetrameric Export Adapter Protein Rec of HERV-K/HML-2 and the Responsive RNA Element RcRE pck30
    Article Snippet: .. The mutations in RcRE pck30 were inserted into pSP64_pck30 by using a Phusion site-directed mutagenesis kit (New England BioLabs) according to the manufacturer instructions with primers ordered from Eurofins MWG (see Table S1 in the supplemental material). ..

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Polymerase Chain Reaction:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Generated:

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis
    Article Snippet: .. A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB). .. The FOXO Reporter and Negative Control Reporter were from BPS Bioscience.

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases
    Article Snippet: .. This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively. .. Similarly, ASP3ty‐F344C strain was generated by transfecting with a Cas9‐YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3‐F344C synthetic oligonucleotides in KI‐ASP3ty parasites (Dogga et al , ).

    Modification:

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Binding Assay:

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Over Expression:

    Article Title: Phytochrome Signaling Is Mediated by PHYTOCHROME INTERACTING FACTOR in the Liverwort Marchantia polymorpha
    Article Snippet: .. To obtain the overexpression lines of Mp- PHYY241H , the plasmid carrying Mp- PHY cDNA was mutagenized using a Phusion site-directed mutagenesis kit (New England Biolabs) with the primer pair 5′-CACACAAATTCCATGAGGAT-3′ and 5′-CCATAACCCGGTCGTAACCT-3′. .. The cloned sequence was then transferred to the pMpGWB103 vector to generate pMH03.

    Plasmid Preparation:

    Article Title: Off-Pathway Assembly of Fimbria Subunits Is Prevented by Chaperone CfaA of CFA/I Fimbriae from Enterotoxigenic E. coli
    Article Snippet: .. The vector pCDFDue-1- (his)6 cfaB was modified by removing the N-terminal donor strand (residue 24–36) using the Phusion® site-directed mutagenesis kit (New England Biolab, MA) to generate the plasmid pCDFDue-1- (his)6 ntdcfaB (residue 37–170). .. The expressing vector pETDue1- cfaA was also modified by inserting a Strep -tag (WSHPQFEK) directly following the CfaA coding region to generate pETDue1- cfaA(Strep) .

    Article Title: Phytochrome Signaling Is Mediated by PHYTOCHROME INTERACTING FACTOR in the Liverwort Marchantia polymorpha
    Article Snippet: .. To obtain the overexpression lines of Mp- PHYY241H , the plasmid carrying Mp- PHY cDNA was mutagenized using a Phusion site-directed mutagenesis kit (New England Biolabs) with the primer pair 5′-CACACAAATTCCATGAGGAT-3′ and 5′-CCATAACCCGGTCGTAACCT-3′. .. The cloned sequence was then transferred to the pMpGWB103 vector to generate pMH03.

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus
    Article Snippet: .. Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs atp binding site
    The AMPPNP binding site in <t>GatD/MurT.</t> ( a ) Catalytic center of MurT bound to the <t>ATP</t> analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus MurE (Protein Data Bank ID 4c12) 32 and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.
    Atp Binding Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atp binding site/product/New England Biolabs
    Average 99 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    atp binding site - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus MurE (Protein Data Bank ID 4c12) 32 and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus MurE (Protein Data Bank ID 4c12) 32 and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Article Snippet: Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Thin Layer Chromatography, Activity Assay, Mutagenesis

    Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b ) Schematic overview of GatD and MurT proteins. GatD consists of a single glutamine amidotransferase (GATase) domain with a cysteine at position 94 as the active residue and a histidine at position 189 as a component of the catalytic triad 19 . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . 24 . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c indicating the middle and C-terminal domains, respectively. The drawing was generated with TopDraw 54 .

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b ) Schematic overview of GatD and MurT proteins. GatD consists of a single glutamine amidotransferase (GATase) domain with a cysteine at position 94 as the active residue and a histidine at position 189 as a component of the catalytic triad 19 . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . 24 . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c indicating the middle and C-terminal domains, respectively. The drawing was generated with TopDraw 54 .

    Article Snippet: Mutagenesis and in vitro amidation assay Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21-murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Isolation, Generated

    Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: Isolation and characterization of ASP3‐F344C mutant allele in parasites resistant to 49c Schematic representation of the strategy used to obtain Toxoplasma gondii resistant lines to 49c. The mutation in TgASP3 found in three independent experiments is shown. Dose–response curve representing growth inhibition of 49c‐resistant Toxoplasma gondii (B5) in presence of 49f, 49b, and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Western blot showing equivalent ectopic expression of wild‐type (ASP3ty) or mutant ASP3 (ASP3ty‐F344C). Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant ASP3ty‐F344C parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty antibodies coupled to beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunopurified ASP3ty and ASP3ty‐F344C cleaves TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Western blot showing severely reduced accumulation of unprocessed TgMIC6 (pMIC6) in case of ASP3ty‐F344C as compared to ASP3ty parasite in presence of 100 nM 49c. DMSO treatment is used as a control for 49c, and catalase is used as loading control. Dose–response curve comparing in vitro inhibition of ASP3ty (IC 50 : 7 ± 1.5 nM) or mutant ASP3ty‐F344C activity by 49c (IC 50 : 40 ± 8 nM). Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Overlap of the two mutant models ASP3‐F344C and ASP3‐F344Y. The picture shows the additional interaction that tyrosine and cysteine can make via the hydroxyl and thiol group, respectively, with the W306 and its amino moiety affecting the flexibility of the flap. The C344 and the Y344 residues are represented with the van der Waals surface to appreciate their real space occupancy. Overlap of the docking results of 49c obtained with the wt TgASP3 model (yellow) and the ASP3‐F344C mutant model (magenta). The main interacting residues are reported in licorice green, and the black dotted lines show the hydroxyl group interacting with the aspartic catalytic dyad. Source data are available online for this figure.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Isolation, Mutagenesis, Inhibition, Western Blot, Expressing, In Vitro, Activity Assay

    TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: TgASP3 mutants are functional and not detrimental to parasite fitness Lipophilic potential surface of the binding site of TgASP3 with compound 49c. The colored legend on the right shows the increasing of the lipophilicity from the blue color (bottom) to the brown (upper), highlighting the presence of a hydrophobic cavity between the two F344 and F386. Molecular docking predictions of the possible effects in the binding mode of 49c in the presence of the two mutants ASP3‐F344Y (upper panel) and ASP3‐F386Y (lower panel) Plaque assay was performed in parental stain ASP3myc‐iKD or parental strain complemented with wild‐type ASP3 (ASP3ty) or with mutant forms of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) in the UPRT locus. Knockdown of ASP3 in presence of ATc resulted in complete impairment of the lytic cycle, as assessed by plaque formation after 7 days, in parental ASP3myc‐iKD strain. Complementation with ASP3ty or with ASP3 mutants (ASP3ty‐F344Y, ASP3ty‐F386Y, and ASP3ty‐F344Y/F386Y) fully restored plaque formation. Scale bar represents 1 μm. Western blots analysis comparing lysate of parental ASP3myc‐iKD strain and complemented strain (ASP3myc‐iKD/ASP3ty, ASP3myc‐iKD/ASP3ty‐F344Y, ASP3myc‐iKD/ASP3ty‐F386Y, ASP3myc‐iKD/ASP3ty‐F344Y/F386Y) ± ATc for 48 h. Significant accumulation of TgMIC6 precursor form with reduction of mature form was observed in iKDASP3myc parasites by ASP3 depletion. Parasites complemented with either wild type or with the mutant form of ASP3 as well as untreated parasite showed proper processing of TgMIC6. Regulation of myc‐tagged inducible copy of ASP3 was shown by probing with α‐myc antibody. Catalase is used as loading control. Lysate of wild‐type ASP3ty and mutant form of ASP3 (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) stably expressed in the UPRT locus of ASP3myc‐iKD parasites was used to immunoprecipitate (IP) wild‐type or mutant forms of ASP3 using anti‐ty couple beads. Input and bound fractions were analyzed by Western blot and revealed the presence of precursor (pASP3ty) and mature form (mASP3ty) of ASP3ty. Immunoprecipitated wild‐type ASP3ty and its mutant forms (ASP3ty‐F344Y, ASP3ty‐F386Y, ASP3ty‐F344Y/F386Y) cleave TgMIC6 fluorogenic peptide (DABCYL‐G‐ FVQLS|ETPAA ‐G‐EDANS) with equal efficiency. Result represents mean ± SD, n = 3, of three independent experiments. Source data are available online for this figure.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Functional Assay, Binding Assay, Plaque Assay, Staining, Mutagenesis, Western Blot, Stable Transfection, Immunoprecipitation

    49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.

    Journal: The EMBO Journal

    Article Title: Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

    doi: 10.15252/embj.201798047

    Figure Lengend Snippet: 49c and 49f specifically target TgASP3 Dose–response curve showing significant decrease in growth inhibition of RHCBG99 luciferase parasite in presence of 49b compared to 49f and pyrimethamine. Data represent mean ± SEM, n = 2, from a representative experiment out of three independent assays. Multiple amino acid sequence alignment of aspartyl proteases from T. gondii (TgASP5, TgASP7, TgASP3, TgASP1, TgASP6, TgASP4, TgASP2) and P. falciparum (PfPMV, PfHAP, PfPMIV, PfPMII, PfPMI, PfPMIX, and PfPMX) using Espript3 server. The highlighted region reflected amino acids in position 344 and 386 in the Flap and Flap‐like hydrophobic pocket. Highlight of the main difference in the Flap region between and TgAsp5 (purple) and TgASP3 (green) with the docking solution of compound 49c (yellow). The ligand is represented with a wireframe surface; meanwhile, the relevant residues and the compound structure are depicted in licorice considering the numeration of the TgASP5 sequence.

    Article Snippet: This Ku80 luciferase strain was transfected with a Cas9‐YFP/CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 site‐directed mutagenesis kit (NEB) along with 40 μg of TgASP3 wild‐type or TgASP3‐F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.

    Techniques: Inhibition, Luciferase, Sequencing

    Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c .

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: Overall structure and organization of the GatD/MurT complex. ( a ) Reaction catalyzed by GatD/MurT. The free α-carboxyl of D-iso-glutamate in the peptide stem is amidated in a glutamine- and ATP-dependent reaction. ( b . MurT is composed of two domains: a Mur ligase middle domain (MurT middle) containing the canonical ATP binding site and, surprisingly, a ribbon-type Zinc finger, and a C-terminal Mur ligase domain (MurT C-term). MurT residue glutamate 108 participates in ATP hydrolysis, and aspartate 349 forms the third residue in the putative catalytic triad. ( c ) Overview of the GatD/MurT structure. GatD and MurT form a boomerang-shaped complex, with GatD contacting the MurT C-term domain through contacts that are in part mediated by helix α7 of GatD. Catalytic triad residues GatD-C94, GatD-H189, MurT-D349 and the bound nucleotide AMPPNP are shown in stick representation. The zinc ion in the Cys 4 zinc ribbon of MurT is shown as a green sphere, and the four cysteine residues ligating it are shown as sticks. ( d ) Tilted view of the MurT middle domain to show the central β-sheet and the bound AMPPNP and its surrounding secondary structure elements, as well as the zinc ribbon. ( e ) Topological representation of the GatD/MurT architecture. Secondary structure nomenclature of GatD was done according to Leisico et al . As the short helices α1 and α5 in the isolated GatD structure do not conform to helical geometry in our complex, they were not assigned. The MurT domains were assigned separately with the prefixes m and c .

    Article Snippet: Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Isolation

    The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Journal: Scientific Reports

    Article Title: Structural basis of cell wall peptidoglycan amidation by the GatD/MurT complex of Staphylococcus aureus

    doi: 10.1038/s41598-018-31098-x

    Figure Lengend Snippet: The AMPPNP binding site in GatD/MurT. ( a ) Catalytic center of MurT bound to the ATP analogue AMPPNP. The adenine base is inserted into a pocket composed of several aromatic residues and two asparagines, including N267, while the conserved K59, T60 and E108 residues coordinate the β and γ phosphates as well as a magnesium ion (green sphere) found in the active center of ATPases. A bound water is shown with a red sphere. ( b ) Superimposition of ATP analogues from S. aureus and P. aeruginosa MurF (Protein Data Bank ID 4cvk) onto the MurT ATP-binding pocket in surface representation based on structural superimpositions of the entire domains. The MurT-bound AMPPNP is shown as a colored stick model, the superimposed nucleotides from the two related structures are shown as white sticks. ( c ) Thin-layer chromatography analysis of an activity assay of ATP-binding site mutants. Mutation of the magnesium-coordinating residues T60 and E108 to alanines completely abolishes catalysis. Replacement of the conserved N267 with a bulky tyrosine residue also impedes catalysis, probably by interfering with AMPPNP binding.

    Article Snippet: Site-directed mutagenesis was performed according to the manufacturer´s instructions using plasmid pET21- murT/gatD as the template to generate active site mutants GatD-C94S and MurT-D349N (QuikChange Lightning Site-Directed Mutagenesis Kit, Agilent) and to generate mutations in the ATP binding site (MurT mutants T60A, E108A, N267Y and double mutant T60A E108A; Q5 site-directed mutagenesis kit, New England Biolabs).

    Techniques: Binding Assay, Thin Layer Chromatography, Activity Assay, Mutagenesis

    Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Mutagenesis, Activation Assay, Transfection, Luciferase, Plasmid Preparation, Expressing, Quantitative RT-PCR

    Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Quantitative RT-PCR, Infection, Migration, Transfection

    P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Infection, Quantitative RT-PCR, Confocal Microscopy, Staining, Software

    ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Transfection, Infection, Quantitative RT-PCR, Plasmid Preparation, Expressing, Mutagenesis, Protease Inhibitor, Migration, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Binding Assay