phusion polymerase (New England Biolabs)

99
Name:
Phusion High Fidelity DNA Polymerase
Description:
Phusion High Fidelity DNA Polymerase 500 units
Catalog Number:
M0530L
Price:
437
Size:
500 units
Category:
Thermostable DNA Polymerases
Score:
85
|
Buy from Supplier |
Structured Review
New England Biolabs
phusion polymerase

Phusion High Fidelity DNA Polymerase 500 units
https://www.bioz.com/result/phusion polymerase/product/New England Biolabs
Average 99 stars, based on 714 article reviews
Price from $9.99 to $1999.99

Phusion High Fidelity DNA Polymerase 500 units
https://www.bioz.com/result/phusion polymerase/product/New England Biolabs
Average 99 stars, based on 714 article reviews
Price from $9.99 to $1999.99
phusion polymerase - by Bioz Stars,
2019-12
99/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Clone Assay:Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: E. coli TOP10 and E. coli XL-1 were used for cloning, following standard recombinant DNA techniques. .. PCR was performed using Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants Article Snippet: The discovery of ZUFSP as a K63-DUB, making DNA-mediated interactions with RPA and SSBP1, will be instrumental for addressing these important questions. .. ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: Paragraph title: Cloning of truncated Hp-TGM constructs ... Truncated Hp -TGM inserts were amplified using proofreading Amplification:Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria Article Snippet: See for details of the construct design. .. The template DNA was amplified by polymerase chain reaction using Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: This promoter construct was extended by 2 kb by amplification (5′-CGGGGTACCTTGAGAGATGAAGCTGAGCGGTGTG-3′ and 5′-TTCTAGTTCCGGTACCTCCTGTGCAGTCT-3′) of a more distal 5′ promoter region and cloned into the pGL3 KpnI site and Creb3l1 promoter KpnI cut site. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis Article Snippet: Briefly, PP were harvested and kept in RNAlater (Sigma‐Aldrich) until processing. .. PP were homogenized using a TissueLyser II (20 Hz, 2 min; Qiagen), and RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed with iScript Select cDNA Synthesis Kit (Bio‐Rad) using a mix of three primers to enrich in IgA transcripts (Lindner et al , ), and IgA heavy chain was amplified with Article Title: One-step generation of conditional and reversible gene knockouts Article Snippet: The FLIP cassette including selection marker gene was then transferred to the vector pUC118 (3318, Clontech) using the restriction enzymes SacI (R0156S, NEB) and PstI (R0140S, NEB) and Mighty cloning (6027, Takara). .. Homologous arms around an intron insertion site were amplified by Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides Article Snippet: An rps3 PCR standard was amplified using primers Hcat_rps3_F (CGAGGGCTACATGGTCAAGA) and Hcat_rps3_R CCTTTGGCTCGATGATGGTG). .. Each 25 µl reaction consisted of 0.5 U Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli Article Snippet: PAβN (25 mg/ml in H2 O) was stored at −20°C and used at final concentrations between 5 and 40 µg/ml, as indicated. .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: Primer pairs were used to systematically truncate one or more domains either from the N-terminus or C-terminus with the resultant nomenclature being TGMΔ1 = TGM with domain 1 truncated; TGM Δ1,2 = TGM with domains 1 and 2 truncated, etc. .. Truncated Hp -TGM inserts were amplified using proofreading Stable Transfection:Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Synthesized:Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria Article Snippet: Template DNA for Homo sapiens mitochondrial pre-tRNA substrates were synthesized (Integrated DNA Technologies). .. The template DNA was amplified by polymerase chain reaction using Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Construct:Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria Article Snippet: The template DNA was amplified by polymerase chain reaction using Phusion® High-Fidelity DNA Polymerase (New England BioLabs) or Phire II DNA Polymerase (Thermo Fisher Scientific). .. The template DNA was amplified by polymerase chain reaction using Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: A series of smaller rat Creb3l1 luciferase reporter constructs were made by restriction enzyme digestion (BamHI, BstEII, SacI, StuI) at sites present in the Creb3l1 promoter, blunted (with exception of StuI) with T4 DNA polymerase and excised from pGL3 with XhoI. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: PCR was performed using Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Custom CRISPR short guide RNAs (sgRNAs) targeting exon 1 oflamc3 were designed using CRISPR Design tool (crispr.mit.edu) to span an endonuclease target site and constructed using the oligonucleotides shown in generated by ZiFiT Targeter ( ). .. Template DNA was amplified from DR274 using Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Article Snippet: SSV1 mutants lacking VP1 genes or portions thereof were constructed via LIPCR using EAI283 as template ( ). .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants Article Snippet: Paragraph title: Constructs and cloning ... ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: Paragraph title: Cloning of truncated Hp-TGM constructs ... Truncated Hp -TGM inserts were amplified using proofreading Concentration Assay:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides Article Snippet: Each 25 µl reaction consisted of 0.5 U Real-time Polymerase Chain Reaction:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides Article Snippet: Paragraph title: Hyphochytrium catenoides genome qPCR size estimation ... Each 25 µl reaction consisted of 0.5 U Luciferase:Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: Paragraph title: Luciferase Assay ... Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Expressing:Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: PCR was performed using Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: Paragraph title: Heterologous expression in Pichia pastoris ... The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Transformation Assay:Article Title: One-step generation of conditional and reversible gene knockouts Article Snippet: Homologous arms around an intron insertion site were amplified by Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli Article Snippet: The lpxB coding sequence was amplified from E. coli BL21 cells with Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Over Expression:Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: PCR was performed using Transfection:Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: Truncated Hp -TGM inserts were amplified using proofreading DNA Ligation:Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Southern Blot:Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects Article Snippet: Segregants of the T1 generation negative in PCR were propagated to T2 and checked by Southern blot analysis. .. The 4319 bp amplicon was amplified using the Ligation:Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA Article Snippet: Paragraph title: PCR and ligation ... Unless otherwise stated, 50 μl PCR reactions were performed using Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Article Snippet: The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Cell Culture:Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation Article Snippet: To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, Hemagglutination Assay:Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Generated:Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Custom CRISPR short guide RNAs (sgRNAs) targeting exon 1 oflamc3 were designed using CRISPR Design tool (crispr.mit.edu) to span an endonuclease target site and constructed using the oligonucleotides shown in generated by ZiFiT Targeter ( ). .. Template DNA was amplified from DR274 using Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using DNA Sequencing:Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: PCR was performed using Sequencing:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis Article Snippet: Paragraph title: IgA sequencing and faecal Ig detection ... PP were homogenized using a TissueLyser II (20 Hz, 2 min; Qiagen), and RNA was extracted using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed with iScript Select cDNA Synthesis Kit (Bio‐Rad) using a mix of three primers to enrich in IgA transcripts (Lindner et al , ), and IgA heavy chain was amplified with Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation Article Snippet: The bait plasmid pSST91 contains the LexA protein coding sequence under the control of the yeast ADH1 promoter. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli Article Snippet: This structure should aid in the rational and computational development of new antibiotics targeting LpxB to combat the increasing problem of antibiotic resistance. .. The lpxB coding sequence was amplified from E. coli BL21 cells with Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading Injection:Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Template DNA was amplified from DR274 using Recombinant:Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: E. coli TOP10 and E. coli XL-1 were used for cloning, following standard recombinant DNA techniques. .. PCR was performed using Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, Cellular Antioxidant Activity Assay:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Imaging:Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using DNA Extraction:Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides Article Snippet: The supernatant was removed and genomic DNA was extracted from the remaining cells using a PowerSoil DNA isolation kit (MO BIO Laboratories). .. Each 25 µl reaction consisted of 0.5 U Molecular Cloning:Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses Article Snippet: Paragraph title: Molecular cloning of ggTLR21 cDNA ... A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a In Vivo:Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: PCR was performed using Methylation:Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Mutagenesis:Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Isolation:Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: Total RNA isolated from rice anther was converted into cDNA using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Purification:Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses Article Snippet: Total RNAs were purified from grouper splenocytes using TRIzol, and first-strand cDNA libraries were then prepared using the SuperScript® III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA), as previously described . .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: The DR274 plasmid (a gift from Keith Young – Addgene plasmid #42250) was linearised by BsaI (R0535, NEB) digestion according to manufacturer’s instructions and gel purified (28706, Qiagen). .. Template DNA was amplified from DR274 using Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Article Title: Crystal structure of lipid A disaccharide synthase LpxB from Escherichia coli Article Snippet: Paragraph title: Cloning and purification of LpxB ... The lpxB coding sequence was amplified from E. coli BL21 cells with Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference Article Snippet: The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides Article Snippet: Each 25 µl reaction consisted of 0.5 U Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli Article Snippet: Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Polymerase Chain Reaction:Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria Article Snippet: See for details of the construct design. .. The template DNA was amplified by polymerase chain reaction using Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: The excised fragments were cloned into the SmaI and Xho1 sites of pGL3. .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects Article Snippet: To check for full‐length cDNA expression, RNA was transcribed to cDNA using the M‐MLV reverse transcriptase according to the manufacturer's protocol (Invitrogen, Carlsbad (CA), USA) and a poly‐T (30) oligo. .. The 4319 bp amplicon was amplified using the Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA Article Snippet: The primer sequences used in this study were listed in Supplementary Table . .. Unless otherwise stated, 50 μl PCR reactions were performed using Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: DNA restriction enzymes were used as recommended by the manufacturer (New England Biolabs, NEB). .. PCR was performed using Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: Total RNA isolated from rice anther was converted into cDNA using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. .. The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference Article Snippet: Caveats and potential improvements to the system are discussed in the hope that the broader field of Chlamydia researchers might develop further applications of this approach. .. The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Article Title: Comparative genomic analysis of the ‘pseudofungus’ Hyphochytrium catenoides Article Snippet: An rps3 PCR standard was amplified using primers Hcat_rps3_F (CGAGGGCTACATGGTCAAGA) and Hcat_rps3_R CCTTTGGCTCGATGATGGTG). .. Each 25 µl reaction consisted of 0.5 U Article Title: The Biofilm Inhibitor Carolacton Enters Gram-Negative Cells: Studies Using a TolC-Deficient Strain of Escherichia coli Article Snippet: PAβN (25 mg/ml in H2 O) was stored at −20°C and used at final concentrations between 5 and 40 µg/ml, as indicated. .. Chemo-competent cells of E. coli were prepared according to the TSS method described by Chung et al. ( ). pIB166 was PCR amplified with Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading CRISPR:Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Paragraph title: CRISPR/Cas9 mutagenesis and imaging ... Template DNA was amplified from DR274 using cDNA Library Assay:Article Title: CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses Article Snippet: To clone ggTLR21 cDNA, a pair of forward and reverse primers (5′-gaacagattcctgtaccatgttcatc-3′ and 5′-gcttgtatgaattgtcacactgcac-3′) were designed based on the sequences of the 5′- and 3′-untranslated regions of osgTLR21 (GenBank: GU198366.2). .. A ggTLR21 cDNA containing both the 5′-and 3′-untranslated regions and the complete coding region was cloned from the prepared giant grouper spleen first-strand cDNA library using polymerase chain reaction (PCR) amplification with a Activated Clotting Time Assay:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: One microgram of RNA for each sample was reverse transcribed to cDNA using the Superscript II kit (Invitrogen, Life Technologies, Monza, Italy). cDNA was amplified with primers targeting the 16S rRNA gene V3-V4 region as described in . .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Plasmid Preparation:Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: For luciferase assays, Creb3l1 promoter fragments were cloned into luciferase reporter construct pGL3 basic vector (Promega, Madison, WI, USA). .. Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects Article Snippet: Southern blot was performed by digesting 10 μg of genomic DNA with EcoR I and using a 32 P‐labelled probe covering the HPT gene of the p6U vector as described previously (Risk et al ., ). .. The 4319 bp amplicon was amplified using the Article Title: One-step generation of conditional and reversible gene knockouts Article Snippet: Paragraph title: Addition of homologous arms to the FLIP cassette – FLIP targeting vector generation ... Homologous arms around an intron insertion site were amplified by Article Title: Knockdown of Laminin gamma-3 (Lamc3) impairs motoneuron guidance in the zebrafish embryo Article Snippet: Phosphorylated, annealed oligonucleotides (diluted 1:200) were ligated into the DR274 plasmid using the Quick ligation kit (M2200, NEB) and Plasmid Safe treatment (E3105K, Cambridge Bioscience). .. Template DNA was amplified from DR274 using Article Title: Neurodegeneration-associated mutant TREM2 proteins abortively cycle between the ER and ER–Golgi intermediate compartment Article Snippet: The human TREM2 cDNA was obtained from R & D Systems, amplified by PCR, and inserted into the pEGFP-N1 vector after first removing the EGFP coding sequence. .. To facilitate detection of TREM2, we inserted an HA epitope tag and linker sequence ( ) after the TREM2 signal sequence using the Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Article Title: Feasibility of a Conditional Knockout System for Chlamydia Based on CRISPR Interference Article Snippet: Caveats and potential improvements to the system are discussed in the hope that the broader field of Chlamydia researchers might develop further applications of this approach. .. The dCas9 gene from Staphylococcus aureus was PCR-amplified following the manufacturer's guidelines for Article Title: A family of unconventional deubiquitinases with modular chain specificity determinants Article Snippet: ZUFSP was cloned from HEK293 complementary DNA and Mug105 from S. pombe genomic DNA (kind gift from J. Dohmen, University of Cologne) using Article Title: TGF-β mimic proteins form an extended gene family in the murine parasite Heligmosomoides polygyrus Article Snippet: 2.3 Mammalian codon-optimised Hp -TGM was synthesized by GeneArt as previously published , inserted into a holding vector and subcloned into the mammalian expression vector pSECTag2a using restriction sites Asc I and Apa I. Amplification and cloning of the truncated versions of Hp -TGM was performed by PCR amplification using full-length codon-optimised Hp -TGM ( ) as template DNA and domain-specific primers with restriction sites (Asc I/Apa I) and cap sequence (gcgcgc) placed at either end (see ). .. Truncated Hp -TGM inserts were amplified using proofreading RNA Extraction:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: Paragraph title: RNA Extraction and 16S rRNA Library Preparation ... The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Agarose Gel Electrophoresis:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Article Title: Efficient strategy for introducing large and multiple changes in plasmid DNA Article Snippet: Unless otherwise stated, 50 μl PCR reactions were performed using Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and In Vitro:Article Title: Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1) Expression by Orphan Nuclear Receptor Nr4a1 Article Snippet: Deletion mutants (-NBRE2 and -NBRE3) of the rat Creb3l1 promoter were generated by overlap extension PCR using Transgenic Assay:Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects Article Snippet: Paragraph title: Detection of transgenic barley and determination of transgene copy number and full‐length cDNA amplification ... The 4319 bp amplicon was amplified using the Spectrophotometry:Article Title: Diversity within Italian Cheesemaking Brine-Associated Bacterial Communities Evidenced by Massive Parallel 16S rRNA Gene Tag Sequencing Article Snippet: RNA concentration and quality were measured using a UV-Vis spectrophotometer NanoDrop ND-1000 (Nanodrop Technologies, Wilmington, DE, United States) and by qPCR using 16S rRNA primers ( ). .. The primer includes sequences required for Illumina platform sequencing, a barcode and sequences corresponding to the bacterial 16S rRNA gene. cDNA was diluted to 0.2 ng/μL and amplified in three 20-μL reactions per sample, each composed of 5 μL of diluted cDNA, 0.4 μM of each primer (PCR1_16S_For CTA CAC GAC GCT CTT CCG ATC TTC CTA CGG GAG GCA GCA GT; PCR1_16S_Rev CAG ACG TGT GCT CTT CCG ATC TGG ACT ACC AGG GTA TCT AAT CCT GTT; the adapters are highlighted in bold), 0.25 mM dNTPs, 1× Phusion HF buffer and 1 U Produced:Article Title: The MRPP1/MRPP2 complex is a tRNA-maturation platform in human mitochondria Article Snippet: The tRNA constructs were either directly produced by run-off transcription or were joined 5′ of the GlmS ribozyme. .. The template DNA was amplified by polymerase chain reaction using Activation Assay:Article Title: Arabidopsis RETICULON-LIKE3 (RTNLB3) and RTNLB8 Participate in Agrobacterium-Mediated Plant Transformation Article Snippet: The prey plasmid pGAD424 generates a recombinant protein containing the GAL4 activation domain. .. To generate the bait plasmid expressing the LexA-RTNLB recombinant protein and the prey plasmid expressing the GAL4-RTNLB hybrid protein, Eco RI-Pst I fragments of the RTNLB3 , or RTNLB5-RTNLB8 coding sequences from Arabidopsis were obtained from PCR reactions by using Arabidopsis cDNA as a template, Alkaline Lysis:Article Title: Genetic Analysis of the Major Capsid Protein of the Archaeal Fusellovirus SSV1: Mutational Flexibility and Conformational Change Article Snippet: SSV2 and SSV9 DNA were isolated from the original Sulfolobus strains using alkaline lysis [ ]. .. The complete VP1 genes from SSV1, SSV2 and SSV9 and the N-terminal region of VP1 from SSV9 [ , , ] were amplified using Marker:Article Title: Pathogen‐inducible Ta‐Lr34res expression in heterologous barley confers disease resistance without negative pleiotropic effects Article Snippet: Total genomic DNA was extracted from leaves using the CTAB method (Stein et al ., ), and presence of Ta ‐Lr34res was assessed using the marker csffr1 (Lagudah et al ., ). .. The 4319 bp amplicon was amplified using the Gel Extraction:Article Title: Deficiency of a triterpene pathway results in humidity-sensitive genic male sterility in rice Article Snippet: The resulting cDNA was used as a template to isolate OsOSC12 by PCR, using the primer pair OSC8S/OSC8A (Supplementary Table ) and Homologous Recombination:Article Title: SAM-Dependent Enzyme-Catalysed Pericyclic Reactions in Natural Product Biosynthesis Article Snippet: PCR was performed using |