human starr seq backbone  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    Gibson Assembly Master Mix
    Description:
    Gibson Assembly Master Mix 50 rxns
    Catalog Number:
    e2611l
    Price:
    649
    Size:
    50 rxns
    Category:
    Cloning and Expression Systems
    Buy from Supplier


    Structured Review

    New England Biolabs human starr seq backbone
    Gibson Assembly Master Mix
    Gibson Assembly Master Mix 50 rxns
    https://www.bioz.com/result/human starr seq backbone/product/New England Biolabs
    Average 94 stars, based on 13180 article reviews
    Price from $9.99 to $1999.99
    human starr seq backbone - by Bioz Stars, 2020-04
    94/100 stars

    Images

    1) Product Images from "Functional testing of thousands of osteoarthritis-associated variants for regulatory activity"

    Article Title: Functional testing of thousands of osteoarthritis-associated variants for regulatory activity

    Journal: Nature Communications

    doi: 10.1038/s41467-019-10439-y

    Schematic of massively parallel reporter assay. a For each GWAS-lead SNP, we identified all SNPs in LD with r 2 > 0.8. Colored lines indicate SNPs in the same LD block. b For all SNPs, we extracted 196 nt of genomic sequence centered at the SNP, and separately synthesized the minor (hollow circle) and major alleles, flanked by common adaptor sequences (cyan and purple). c , d We amplified our library from the array via PCR with primers directed at the common adaptors, in the process appending five nt degenerate barcodes (black lines) and additional sequences homologous to the vector (cyan). We cloned our barcoded library of all major and minor alleles into the STARR-seq vector. Each putative regulatory region is cloned into the 3′-UTR of a reporter gene (cyan) with a minimal promoter (dark blue). e We transfected our library into Saos-2 cells via electroporation. Forty-eight hours post transfection, we extracted RNA and DNA. f We determined the abundance of each allele–barcode combination in the mRNA and DNA population through sequencing. For each allele, we calculated one activity score as the average log 2 (RNA/DNA) across all independent measurements
    Figure Legend Snippet: Schematic of massively parallel reporter assay. a For each GWAS-lead SNP, we identified all SNPs in LD with r 2 > 0.8. Colored lines indicate SNPs in the same LD block. b For all SNPs, we extracted 196 nt of genomic sequence centered at the SNP, and separately synthesized the minor (hollow circle) and major alleles, flanked by common adaptor sequences (cyan and purple). c , d We amplified our library from the array via PCR with primers directed at the common adaptors, in the process appending five nt degenerate barcodes (black lines) and additional sequences homologous to the vector (cyan). We cloned our barcoded library of all major and minor alleles into the STARR-seq vector. Each putative regulatory region is cloned into the 3′-UTR of a reporter gene (cyan) with a minimal promoter (dark blue). e We transfected our library into Saos-2 cells via electroporation. Forty-eight hours post transfection, we extracted RNA and DNA. f We determined the abundance of each allele–barcode combination in the mRNA and DNA population through sequencing. For each allele, we calculated one activity score as the average log 2 (RNA/DNA) across all independent measurements

    Techniques Used: Reporter Assay, GWAS, Blocking Assay, Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Transfection, Electroporation, Activity Assay

    2) Product Images from "Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?"

    Article Title: Targeting Somatostatin Receptors By Functionalized Mesoporous Silica Nanoparticles - Are We Striking Home?

    Journal: Nanotheranostics

    doi: 10.7150/ntno.23826

    SSTR2, 3 and 5 expression in cell lines employed in the study: indirect immunolabelling in a flow cytometry analysis. SSTR2, 3 and 5 immunolabelling results in paraformaldehyde (PFA)-fixed and saponin-permeabilized HEK293 and BON1 cells, along with matched control stains in viable non-permeabilized HEK293 cells are presented on panels A and B, respectively. As all the anti-SSTR antibodies (Abs) employed in the series on panel A target native epitopes within C -tails of the receptors (confined to cytoplasmic compartment), the cells were fixed with PFA and permeabilized with saponin before immunolabelling. Conversely, the immunolabelling of the cells on panel B involved primary Ab against distinct tags within extracellular N -termini of SSTRs, hence no permeabilization was required and the staining was done on viable non-permeabilized cells. Noteworthy, the pattern of signal from matched samples stained for the same target with Abs against its different epitopes (Abs to intracellular C -tails of receptors on panel A vs Abs to tags within extracellular domains of the same receptors on panel B) is almost identical, which signifies specificity of the data. Bimodal appearance of the populations on histograms, especially obvious in case of SSTR3- and 5-overexpressing cells, is explained by the oligoclonal nature of the cultures, with the resulting distribution being formed by progeny of two (or more) dominant clones. Staining for β-tubulin, a component of a cytoskeleton, on panels A and B was implemented as a positive or negative control of permeabilization, respectively. The cells were analyzed on LSRII cytometer; at least 15 000 of the gated events were captured. Every image represents an overlay histogram of two samples: black transparent charts stand for either non-stained controls or fully stained samples; shaded green charts reflect the corresponding secondary antibody - only stained controls. x-axis denotes sample emission [(505 nm longpass)/(530/30 nm bandpass)] upon stimulation with 488 nm laser; y-axis indicates the number of events registered. The data from a single representative experiment (performed in duplicate) is shown; the complete series has been independently performed at least three times.
    Figure Legend Snippet: SSTR2, 3 and 5 expression in cell lines employed in the study: indirect immunolabelling in a flow cytometry analysis. SSTR2, 3 and 5 immunolabelling results in paraformaldehyde (PFA)-fixed and saponin-permeabilized HEK293 and BON1 cells, along with matched control stains in viable non-permeabilized HEK293 cells are presented on panels A and B, respectively. As all the anti-SSTR antibodies (Abs) employed in the series on panel A target native epitopes within C -tails of the receptors (confined to cytoplasmic compartment), the cells were fixed with PFA and permeabilized with saponin before immunolabelling. Conversely, the immunolabelling of the cells on panel B involved primary Ab against distinct tags within extracellular N -termini of SSTRs, hence no permeabilization was required and the staining was done on viable non-permeabilized cells. Noteworthy, the pattern of signal from matched samples stained for the same target with Abs against its different epitopes (Abs to intracellular C -tails of receptors on panel A vs Abs to tags within extracellular domains of the same receptors on panel B) is almost identical, which signifies specificity of the data. Bimodal appearance of the populations on histograms, especially obvious in case of SSTR3- and 5-overexpressing cells, is explained by the oligoclonal nature of the cultures, with the resulting distribution being formed by progeny of two (or more) dominant clones. Staining for β-tubulin, a component of a cytoskeleton, on panels A and B was implemented as a positive or negative control of permeabilization, respectively. The cells were analyzed on LSRII cytometer; at least 15 000 of the gated events were captured. Every image represents an overlay histogram of two samples: black transparent charts stand for either non-stained controls or fully stained samples; shaded green charts reflect the corresponding secondary antibody - only stained controls. x-axis denotes sample emission [(505 nm longpass)/(530/30 nm bandpass)] upon stimulation with 488 nm laser; y-axis indicates the number of events registered. The data from a single representative experiment (performed in duplicate) is shown; the complete series has been independently performed at least three times.

    Techniques Used: Expressing, Flow Cytometry, Cytometry, Staining, Clone Assay, Negative Control

    3) Product Images from "Functional characterization of enhancer evolution in the primate lineage"

    Article Title: Functional characterization of enhancer evolution in the primate lineage

    Journal: Genome Biology

    doi: 10.1186/s13059-018-1473-6

    Schematic of Experimental Design. a We identified potential hominoid-specific enhancers by intersecting hominoid-specific ChIP-seq predicted enhancers from primary human liver with ChromHMM-predicted strong enhancers in HepG2 cells (screenshot from http://genome.ucsc.edu ) [ 54 ]. We then tiled across each candidate enhancer using 194 nt sequences and identified 697 tiles that were active in the STARR-seq reporter assay in HepG2 cells. b We located orthologous sequences in 11 primates and computationally reconstructed 9 ancestral sequences for 348 of the active tiles, using New World monkeys as an outgroup. c We then cloned all 20 present-day or ancestral orthologs per tile and performed STARR-seq again in HepG2 cells. After collecting DNA and RNA from cells, we calculated enrichment scores as the log 2 ratio of RNA to DNA for each ortholog. Each shade of red represents a different ortholog tested
    Figure Legend Snippet: Schematic of Experimental Design. a We identified potential hominoid-specific enhancers by intersecting hominoid-specific ChIP-seq predicted enhancers from primary human liver with ChromHMM-predicted strong enhancers in HepG2 cells (screenshot from http://genome.ucsc.edu ) [ 54 ]. We then tiled across each candidate enhancer using 194 nt sequences and identified 697 tiles that were active in the STARR-seq reporter assay in HepG2 cells. b We located orthologous sequences in 11 primates and computationally reconstructed 9 ancestral sequences for 348 of the active tiles, using New World monkeys as an outgroup. c We then cloned all 20 present-day or ancestral orthologs per tile and performed STARR-seq again in HepG2 cells. After collecting DNA and RNA from cells, we calculated enrichment scores as the log 2 ratio of RNA to DNA for each ortholog. Each shade of red represents a different ortholog tested

    Techniques Used: Chromatin Immunoprecipitation, Reporter Assay, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: TPXL-1 activates Aurora A to clear contractile ring components from the polar cortex during cytokinesis
    Article Snippet: .. Transgene construction Gibson cloning (E2611; NEB) was used to construct transgenes encoding WT and mNeonGreen tagged TPXL-1 (isoform A) in pCFJ350. ..

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose *
    Article Snippet: .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. The cloning strategy excluded signal peptides and/or transmembrane domains; oligonucleotide primers used for cloning are listed in .

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: .. Generation of C-terminally HA-tagged clones of AGA1 gene Gibson assembly master mix (NEB# E2611) was used to generate C-terminally HA-tagged AGA1 clones [AGA 1-HA (WT), see plasmid #12, Additional file : Table S2]. ..

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: Paragraph title: Cloning of BGCs with the CATCH technique ... Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA).

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: Paragraph title: (v) Cloning for expression in Lactococcus lactis . ... RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs).

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3
    Article Snippet: Construction of robo3TcRobo2/3 donor plasmid The initial robo3 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs E2611). .. To make the HA-tagged robo3 TcRobo2/3 donor, the robo3 coding sequence was excised with BglII and a 4xHA sequence flanked by BamHI (upstream) and BglII (downstream) sites was cloned into the BglII site, thus retaining a single BglII cloning site immediately downstream of the 4xHA tag.

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Paragraph title: In vitro DNA assembly cloning reactions ... Assembly with NEBuilder HiFi assembly master mix or Gibson assembly master mix was performed according to manufacturer’s recommendations (NEB).

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Construction and purification of an improved IgG-affinity/MNase fusion protein Hemagglutinin and 6-histidine tags were added to the carboxyl-terminus of pA-MNase ( ) using a commercially synthesized dsDNA fragment (gBlock) from Integrated DNA Technologies (IDT), which contains the coding sequence for both tags, glycine-rich flexible linkers and includes restriction sites for cloning. .. Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions.

    Amplification:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: The pNY326 backbone was amplified with the two primers pNY326‐F (5′‐ GAATTCGGTACCCCGGGTTCGA) and pNY326‐R (5′‐ GGATCCTGCAGCGAAAGCCATGGGAGC). .. A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω.

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: The backbone of the pSET154 vector was amplified from plasmid pSET154 using primers BGC1-p15A-F and BGC1-p15A-R, which include a ~ 30 bp overlap with one end of the target fragment. .. Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA).

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: .. RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs). .. Reaction products were ethanol precipitated and suspended in double-distilled water before transformation into L. lactis by electroporation as described by Holo and Nes ( ).

    Article Title: Chromobodies to Quantify Changes of Endogenous Protein Concentration in Living Cells
    Article Snippet: The expression construct coding for Ubiquitin-Methionine-BC1-TagGFP2 (hereafter referred as Ub-M-BC1-TagGFP2, B ) was generated by Gibson assembly cloning ( ) of the following four fragments: fragment1 - pEGFP-N1 vector backbone digested with NheI and XbaI, fragment 2 - ubiquitin amplified from Ub-M-eGFP, a gift from Nico Dantuma (plasmid # 11938, Addgene, Cambridge, MA) , with the primer set ubiquitin-for and ubiquitin-rev, fragment 3 - BC1-NB amplified from the BC1-CB expression construct described in ( ) with the primer set BC1-for and BC1-rev, fragment 4 - TagGFP2 amplified from the BC1-CB plasmid described in ( ) with the primer set TagGFP2-for and TagGFP2-rev. .. Fragments were assembled using the Gibson-Assembly Master Mix (New England Biolabs GmbH, Frankfurt, Germany) according to the manufacturer's protocol.

    Whole Genome Amplification:

    Article Title: Macropinosome formation by tent pole ruffling in macrophages
    Article Snippet: Alexa Fluor 488–phalloidin (A12379), wheat germ agglutinin (WGA) 488 (W11261) and tetramethylrhodamine (TMR; W849), DAPI (Dilactate; D3571), and 70,000 MW Oregon Green 488 (D7173) or 10,000 MW Alexa Fluor 555–Dextran (D34679) were purchased from Life Technologies. .. Gibson Assembly Master Mix was from New England Biolabs (E2611).

    Synthesized:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: The artificially synthesized, codon‐optimized cDNAs encoding the VL and VH domains were amplified with primers that included 5′ overhangs (27 bp) complementing the upstream and downstream sequences to the pBIM2 vector junctions. .. A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω.

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Construction and purification of an improved IgG-affinity/MNase fusion protein Hemagglutinin and 6-histidine tags were added to the carboxyl-terminus of pA-MNase ( ) using a commercially synthesized dsDNA fragment (gBlock) from Integrated DNA Technologies (IDT), which contains the coding sequence for both tags, glycine-rich flexible linkers and includes restriction sites for cloning. .. Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions.

    Construct:

    Article Title: TPXL-1 activates Aurora A to clear contractile ring components from the polar cortex during cytokinesis
    Article Snippet: .. Transgene construction Gibson cloning (E2611; NEB) was used to construct transgenes encoding WT and mNeonGreen tagged TPXL-1 (isoform A) in pCFJ350. ..

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω. .. For SPR experiments, a derivative of Fv 4D111 with an HA tag at the C‐terminus of the VH domain was constructed.

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs). .. The plasmids were obtained and maintained in NZ9000 , and the gene sequences of the different constructs were verified by sequencing.

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3
    Article Snippet: .. Construction of robo3TcRobo2/3 donor plasmid The initial robo3 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs E2611). .. The four fragments were derived from pBluescript (plasmid backbone; primer pair 417–418), the wild-type robo3 genomic locus (5′ and 3′ homology regions; primer pairs 501–502 and 505–506), and the robo3 cDNA (robo3 coding region; primer pair 503–504).

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The sequence-verified construct was transformed into JM101 cells (Agilent Technologies cat. #200234) for expression, cultured in NZCYM-Kanamycin (50 µg/ml) and induced with 2 mM Isopropyl β-D-1-thiogalactopyranoside following standard protein expression and purification protocols.

    Article Title: Chromobodies to Quantify Changes of Endogenous Protein Concentration in Living Cells
    Article Snippet: Paragraph title: Expression Constructs ... Fragments were assembled using the Gibson-Assembly Master Mix (New England Biolabs GmbH, Frankfurt, Germany) according to the manufacturer's protocol.

    Incubation:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: .. A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω. ..

    Expressing:

    Article Title: TPXL-1 activates Aurora A to clear contractile ring components from the polar cortex during cytokinesis
    Article Snippet: Transgene construction Gibson cloning (E2611; NEB) was used to construct transgenes encoding WT and mNeonGreen tagged TPXL-1 (isoform A) in pCFJ350. .. Because tpxl-1 is the second gene in an operon, the mex-5 promoter (488 nt) and the tbb-2 3′ UTR (330 nt; ) were used to drive expression (Fig. S1 D).

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: Residues 1‐107 (Kabat numbering scheme) of the VL domain and 1‐113 of the VH domain derived from monoclonal antibodies were used for Fv fragment expression. .. A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω.

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: Paragraph title: (v) Cloning for expression in Lactococcus lactis . ... RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs).

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The sequence-verified construct was transformed into JM101 cells (Agilent Technologies cat. #200234) for expression, cultured in NZCYM-Kanamycin (50 µg/ml) and induced with 2 mM Isopropyl β-D-1-thiogalactopyranoside following standard protein expression and purification protocols.

    Article Title: Chromobodies to Quantify Changes of Endogenous Protein Concentration in Living Cells
    Article Snippet: Paragraph title: Expression Constructs ... Fragments were assembled using the Gibson-Assembly Master Mix (New England Biolabs GmbH, Frankfurt, Germany) according to the manufacturer's protocol.

    Transformation Assay:

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose *
    Article Snippet: Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. Resulting clones were transformed into competent S. cerevisiae strain EBY100, using the Frozen-EZ Yeast Transformation II kit (Zymo Research).

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA). .. After ligation, the product was transformed into electrocompetent E. coli EPI300 cells.

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs). .. Reaction products were ethanol precipitated and suspended in double-distilled water before transformation into L. lactis by electroporation as described by Holo and Nes ( ).

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Assembly with NEBuilder HiFi assembly master mix or Gibson assembly master mix was performed according to manufacturer’s recommendations (NEB). .. Appropriate volumes of the SLiCE, NEBuilder HiFi or Gibson DNA assembled products were transformed into TOP10 E . coli (Invitrogen) or NEB5α (NEB) by electroporation or heat shock according to the manufacturer’s protocols.

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The sequence-verified construct was transformed into JM101 cells (Agilent Technologies cat. #200234) for expression, cultured in NZCYM-Kanamycin (50 µg/ml) and induced with 2 mM Isopropyl β-D-1-thiogalactopyranoside following standard protein expression and purification protocols.

    Derivative Assay:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: Residues 1‐107 (Kabat numbering scheme) of the VL domain and 1‐113 of the VH domain derived from monoclonal antibodies were used for Fv fragment expression. .. A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω.

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3
    Article Snippet: Construction of robo3TcRobo2/3 donor plasmid The initial robo3 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs E2611). .. The four fragments were derived from pBluescript (plasmid backbone; primer pair 417–418), the wild-type robo3 genomic locus (5′ and 3′ homology regions; primer pairs 501–502 and 505–506), and the robo3 cDNA (robo3 coding region; primer pair 503–504).

    Electroporation:

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined. ..

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs). .. Reaction products were ethanol precipitated and suspended in double-distilled water before transformation into L. lactis by electroporation as described by Holo and Nes ( ).

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Assembly with NEBuilder HiFi assembly master mix or Gibson assembly master mix was performed according to manufacturer’s recommendations (NEB). .. Appropriate volumes of the SLiCE, NEBuilder HiFi or Gibson DNA assembled products were transformed into TOP10 E . coli (Invitrogen) or NEB5α (NEB) by electroporation or heat shock according to the manufacturer’s protocols.

    Ligation:

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose *
    Article Snippet: .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. The cloning strategy excluded signal peptides and/or transmembrane domains; oligonucleotide primers used for cloning are listed in .

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA). .. After ligation, the product was transformed into electrocompetent E. coli EPI300 cells.

    Protease Inhibitor:

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The cell pellet was resuspended in 10 ml Lysis Buffer, consisting of 10 mM Tris-HCl pH 7.5, 300 mM NaCl, 10 mM Imidazole, 5 mM beta-mercaptoethanol, and EDTA-free protease inhibitor tablets at the recommended concentration (Sigma-Aldrich cat. #5056489001).

    Cell Culture:

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The sequence-verified construct was transformed into JM101 cells (Agilent Technologies cat. #200234) for expression, cultured in NZCYM-Kanamycin (50 µg/ml) and induced with 2 mM Isopropyl β-D-1-thiogalactopyranoside following standard protein expression and purification protocols.

    Generated:

    Article Title: Chromobodies to Quantify Changes of Endogenous Protein Concentration in Living Cells
    Article Snippet: The expression construct coding for Ubiquitin-Methionine-BC1-TagGFP2 (hereafter referred as Ub-M-BC1-TagGFP2, B ) was generated by Gibson assembly cloning ( ) of the following four fragments: fragment1 - pEGFP-N1 vector backbone digested with NheI and XbaI, fragment 2 - ubiquitin amplified from Ub-M-eGFP, a gift from Nico Dantuma (plasmid # 11938, Addgene, Cambridge, MA) , with the primer set ubiquitin-for and ubiquitin-rev, fragment 3 - BC1-NB amplified from the BC1-CB expression construct described in ( ) with the primer set BC1-for and BC1-rev, fragment 4 - TagGFP2 amplified from the BC1-CB plasmid described in ( ) with the primer set TagGFP2-for and TagGFP2-rev. .. Fragments were assembled using the Gibson-Assembly Master Mix (New England Biolabs GmbH, Frankfurt, Germany) according to the manufacturer's protocol.

    Polymerase Chain Reaction:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: .. A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω. ..

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: Generation of C-terminally HA-tagged clones of AGA1 gene Gibson assembly master mix (NEB# E2611) was used to generate C-terminally HA-tagged AGA1 clones [AGA 1-HA (WT), see plasmid #12, Additional file : Table S2]. .. The four fragments assembled are as follows: double-stranded HA tag (~ 108 nt), high-copy vector (pRS426 digested with BamHI and SacI, followed by gel extraction), a PCR product (P1, ~ 3000 bp) obtained by using a forward primer binding 650 nt upstream of the start codon and reverse primer binding immediately downstream of stop codon (on the Crick strand) of the AGA1 coding region, and a PCR product (P2, 300 bp) obtained by using a forward primer binding immediately downstream of the stop codon and reverse primer binding 300 nt upstream of stop codon (on the Crick strand) of the AGA1 coding region.

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: The BGC1-sgRNAF and BGC1-sgRNAR in vitro transcription templates were prepared by overlapping PCR of 3 primers: a primer (BGC1-gF-P or BGC1-gR-P) containing the target sequence, and 2 others (guide RNA-F and guide RNA-R) carrying the crRNA-tracrRNA chimera sequence. .. Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA).

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: .. RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs). .. Reaction products were ethanol precipitated and suspended in double-distilled water before transformation into L. lactis by electroporation as described by Holo and Nes ( ).

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3
    Article Snippet: .. Construction of robo3TcRobo2/3 donor plasmid The initial robo3 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs E2611). .. The four fragments were derived from pBluescript (plasmid backbone; primer pair 417–418), the wild-type robo3 genomic locus (5′ and 3′ homology regions; primer pairs 501–502 and 505–506), and the robo3 cDNA (robo3 coding region; primer pair 503–504).

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: .. Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The sequence-verified construct was transformed into JM101 cells (Agilent Technologies cat. #200234) for expression, cultured in NZCYM-Kanamycin (50 µg/ml) and induced with 2 mM Isopropyl β-D-1-thiogalactopyranoside following standard protein expression and purification protocols.

    Sonication:

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. Lysis using chicken egg white lysozyme (10 mg/mL solution, EMD cat. #71412 solution) was followed by sonication with a Branson Sonifier blunt-end adapter at output level 4, 45 s intervals for 5–10 rounds or until turbidity was reduced.

    Binding Assay:

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: Generation of C-terminally HA-tagged clones of AGA1 gene Gibson assembly master mix (NEB# E2611) was used to generate C-terminally HA-tagged AGA1 clones [AGA 1-HA (WT), see plasmid #12, Additional file : Table S2]. .. The four fragments assembled are as follows: double-stranded HA tag (~ 108 nt), high-copy vector (pRS426 digested with BamHI and SacI, followed by gel extraction), a PCR product (P1, ~ 3000 bp) obtained by using a forward primer binding 650 nt upstream of the start codon and reverse primer binding immediately downstream of stop codon (on the Crick strand) of the AGA1 coding region, and a PCR product (P2, 300 bp) obtained by using a forward primer binding immediately downstream of the stop codon and reverse primer binding 300 nt upstream of stop codon (on the Crick strand) of the AGA1 coding region.

    Cleavage Assay:

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: Paragraph title: 2.3. Two-plasmid cleavage assay in bacteria ... 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    Mutagenesis:

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined. .. GoTaq DNA Polymerase (Promega) GeneMorph II Random Mutagenesis Kit (Agilent Technologies) ElectroMax DH10B T1 phage-resistant competent cells (Life Technologies) SOC medium 150-mm petri dish Glass beads autoclaved for 15 minutes Plasmid Maxi Kit

    Article Title: Chromobodies to Quantify Changes of Endogenous Protein Concentration in Living Cells
    Article Snippet: Fragments were assembled using the Gibson-Assembly Master Mix (New England Biolabs GmbH, Frankfurt, Germany) according to the manufacturer's protocol. .. The corresponding N-terminal mutants of the Ub-M-BC1-TagGFP2 expression construct were generated by site-directed mutagenesis of the Ub-M-BC1-TagGFP2 plasmid with the primer pair NB-N-term-X-mut-for (X represents the corresponding N-terminal amino acid) and NB-N-term-rev using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer's protocol.

    Purification:

    Article Title: Macropinosome formation by tent pole ruffling in macrophages
    Article Snippet: HRP-conjugated goat anti-mouse and anti-rabbit antibodies (81-6520) were obtained from Zymed Laboratories Inc. LPS purified from Salmonella enterica serotype Minnesota Re 595 was purchased from Sigma-Aldrich and used at 100 ng/ml unless otherwise stated. .. Gibson Assembly Master Mix was from New England Biolabs (E2611).

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Paragraph title: Construction and purification of an improved IgG-affinity/MNase fusion protein ... Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions.

    Sequencing:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: The iRAT cassette encoded the N‐terminal TEV cleavage site, His6 tag, a 9‐residue Gly/Ser‐rich linker, the MBP coding sequence (residues 27 to 392 from UniProt ID: ), a 25‐residue Asn/Gly/Ser‐rich linker and a C‐terminal TEV cleavage site (Supporting Information Fig. S1). .. A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω.

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: The BGC1-sgRNAF and BGC1-sgRNAR in vitro transcription templates were prepared by overlapping PCR of 3 primers: a primer (BGC1-gF-P or BGC1-gR-P) containing the target sequence, and 2 others (guide RNA-F and guide RNA-R) carrying the crRNA-tracrRNA chimera sequence. .. Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA).

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs). .. The plasmids were obtained and maintained in NZ9000 , and the gene sequences of the different constructs were verified by sequencing.

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3
    Article Snippet: Construction of robo3TcRobo2/3 donor plasmid The initial robo3 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs E2611). .. To make the HA-tagged robo3 TcRobo2/3 donor, the robo3 coding sequence was excised with BglII and a 4xHA sequence flanked by BamHI (upstream) and BglII (downstream) sites was cloned into the BglII site, thus retaining a single BglII cloning site immediately downstream of the 4xHA tag.

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: .. Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The sequence-verified construct was transformed into JM101 cells (Agilent Technologies cat. #200234) for expression, cultured in NZCYM-Kanamycin (50 µg/ml) and induced with 2 mM Isopropyl β-D-1-thiogalactopyranoside following standard protein expression and purification protocols.

    Gel Extraction:

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: Generation of C-terminally HA-tagged clones of AGA1 gene Gibson assembly master mix (NEB# E2611) was used to generate C-terminally HA-tagged AGA1 clones [AGA 1-HA (WT), see plasmid #12, Additional file : Table S2]. .. The four fragments assembled are as follows: double-stranded HA tag (~ 108 nt), high-copy vector (pRS426 digested with BamHI and SacI, followed by gel extraction), a PCR product (P1, ~ 3000 bp) obtained by using a forward primer binding 650 nt upstream of the start codon and reverse primer binding immediately downstream of stop codon (on the Crick strand) of the AGA1 coding region, and a PCR product (P2, 300 bp) obtained by using a forward primer binding immediately downstream of the stop codon and reverse primer binding 300 nt upstream of stop codon (on the Crick strand) of the AGA1 coding region.

    Activated Clotting Time Assay:

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    SPR Assay:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω. .. For SPR experiments, a derivative of Fv 4D111 with an HA tag at the C‐terminus of the VH domain was constructed.

    Plasmid Preparation:

    Article Title: The intervening removable affinity tag (iRAT) production system facilitates Fv antibody fragment‐mediated crystallography
    Article Snippet: Paragraph title: Plasmid construction ... A total of four PCR‐amplified DNA fragments for each antibody clone were added to Gibson Assembly Master Mix (New England Biolabs) and incubated at 50°C for 60 min. B. choshinensis HPD31‐SP3 cells (Clontech) were electroporated with the assembled DNA under conditions of 7.5 kV/cm, 25 μF, and 1000 Ω.

    Article Title: Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose *
    Article Snippet: .. Tāpirins (Calkro_0844, Calkro_0845) were cloned into the vector pCTCON , using conventional ligation (Calkro_0845) or Gibson Assembly® master mix (Calkro_0844) (New England Biolabs), according to the manufacturer's directions. .. The cloning strategy excluded signal peptides and/or transmembrane domains; oligonucleotide primers used for cloning are listed in .

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: .. Generation of C-terminally HA-tagged clones of AGA1 gene Gibson assembly master mix (NEB# E2611) was used to generate C-terminally HA-tagged AGA1 clones [AGA 1-HA (WT), see plasmid #12, Additional file : Table S2]. ..

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: The backbone of the pSET154 vector was amplified from plasmid pSET154 using primers BGC1-p15A-F and BGC1-p15A-R, which include a ~ 30 bp overlap with one end of the target fragment. .. Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA).

    Article Title: Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae
    Article Snippet: .. RsTALLl and RmXALLl genes and the vector were PCR amplified using the primers listed in and assembled in a single-tube isothermal reaction using the Gibson Assembly master mix (New England BioLabs). .. Reaction products were ethanol precipitated and suspended in double-distilled water before transformation into L. lactis by electroporation as described by Holo and Nes ( ).

    Article Title: CRISPR-based gene replacement reveals evolutionarily conserved axon guidance functions of Drosophila Robo3 and Tribolium Robo2/3
    Article Snippet: .. Construction of robo3TcRobo2/3 donor plasmid The initial robo3 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs E2611). .. The four fragments were derived from pBluescript (plasmid backbone; primer pair 417–418), the wild-type robo3 genomic locus (5′ and 3′ homology regions; primer pairs 501–502 and 505–506), and the robo3 cDNA (robo3 coding region; primer pair 503–504).

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Assembly with NEBuilder HiFi assembly master mix or Gibson assembly master mix was performed according to manufacturer’s recommendations (NEB). .. Assembly reaction contained 50–500 ng of linear vector, an appropriate amount of insert DNA in a 1: 2 to 1: 10 vector to insert molar ratio and 2x NEBuilder HiFi or Gibson DNA Assembly Master Mix.

    Recombinant:

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA). .. Recombinant colonies were screened using primers BG1F/kana-RV and F2d1cxF/BG1R.

    In Vitro:

    Article Title: An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters
    Article Snippet: The BGC1-sgRNAF and BGC1-sgRNAR in vitro transcription templates were prepared by overlapping PCR of 3 primers: a primer (BGC1-gF-P or BGC1-gR-P) containing the target sequence, and 2 others (guide RNA-F and guide RNA-R) carrying the crRNA-tracrRNA chimera sequence. .. Fifty nanograms backbone and 1 μg digested genome fragment were assembled using Gibson Assembly Master Mix (NEB, Ipswich, MA).

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Paragraph title: In vitro DNA assembly cloning reactions ... Assembly with NEBuilder HiFi assembly master mix or Gibson assembly master mix was performed according to manufacturer’s recommendations (NEB).

    Produced:

    Article Title: Chromobodies to Quantify Changes of Endogenous Protein Concentration in Living Cells
    Article Snippet: Fragments were assembled using the Gibson-Assembly Master Mix (New England Biolabs GmbH, Frankfurt, Germany) according to the manufacturer's protocol. .. The noncleavable mutant UbG76V -M-BC1-TagGFP2 was produced by site-directed mutagenesis using the primer set BC1-for and Ub-G76V-mut-rev.

    Concentration Assay:

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The cell pellet was resuspended in 10 ml Lysis Buffer, consisting of 10 mM Tris-HCl pH 7.5, 300 mM NaCl, 10 mM Imidazole, 5 mM beta-mercaptoethanol, and EDTA-free protease inhibitor tablets at the recommended concentration (Sigma-Aldrich cat. #5056489001).

    DNA Purification:

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    CTG Assay:

    Article Title: Engineering of customized meganucleases via in vitro compartmentalization and in cellulo optimization
    Article Snippet: These plasmid maps were drawn using Flex Plasmid Draw ( DNA Clean & Concentrator-5 (Zymo Research) Restriction enzymes (AflIII, BglII, NheI, SacII, NcoI, and NotI; New England Biolabs) Quick Ligation Kit (New England Biolabs) NovaXGF’ competent cells (EMD Millipore) DNA purification Miniprep Kit Oligonucleotides (used for cloning, PCR and sequencing): ‘CcdB_seq1’ (5′-GTT ATC GGG GAA GAA GTG GC-3′), ‘CcdB_seq2’ (5′-CGG GTG ATG CTG CCA ACT TA-3′), ‘Endo_colonyPCR_fwd’ (5′-CAC GGC AGA AAA GTC CAC ATT G-3′), Endo_colonyPCR_rev (5′-TGA GGG AGC CAC GGT TGA TG-3′), ‘Endo_seq_fwd’ (5′-CGG CGT CAC ACT TTG CTA TG-3′), and ‘Endo_seq_rev’ (5′-GAG CCA CGG TTG ATG AGA GCT TTG-3′). .. 10 %(v/v) glycerol (autoclaved for 15 minutes) Gel DNA Recovery Kit (Zymo Research) 1kb DNA ladder 2 × Gibson Assembly Master Mix (New England Biolabs) DH5α and DH10B chemical competent cells Sterilized water Cell scraper Electroporation cuvette (0.2-cm path) 2 × YT medium 20 % L -arabinose filtered through a 0.2 μm PVDF membrane 10 × M9 salts: 60 g/l Na2 HPO4 , 30 g/l KH2 PO4 , 5 g/l NaCl, and 10 g/l NH4 Cl 1 M Mg2 SO4 autoclaved for 30 minutes 1 M CaCl2 autoclaved for 30 minutes 1 % (w/v) thiamine filtered through a 0.2 μm PVDF membrane 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) filtered through a 0.2 μm PVDF membrane Control plate: 100 mL of 3 %(w/v) agar and 100 mL of 2 × M9 salt supplemented with 2 %(v/v) glycerol and 1.6 %(w/v) tryptone are separately autoclaved for 30 minutes, and combined.

    Lysis:

    Article Title: Improved CUT RUN chromatin profiling tools
    Article Snippet: Another IDT gBlock containing the optimized protein-G coding sequence and homologous flanking regions to the site of insertion, was introduced via PCR overlap extension using Gibson Assembly Master Mix (New England Biolabs cat. #E2611), following the manufacturer’s instructions. .. The cell pellet was resuspended in 10 ml Lysis Buffer, consisting of 10 mM Tris-HCl pH 7.5, 300 mM NaCl, 10 mM Imidazole, 5 mM beta-mercaptoethanol, and EDTA-free protease inhibitor tablets at the recommended concentration (Sigma-Aldrich cat. #5056489001).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs electrocompetent 10 beta cells
    Electrocompetent 10 Beta Cells, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/electrocompetent 10 beta cells/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    electrocompetent 10 beta cells - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results