t7 express lysy e coli  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    T7 Express lysY Competent E coli High Efficiency
    Description:
    T7 Express lysY Competent E coli High Efficiency 6x0 2 ml
    Catalog Number:
    c3010i
    Price:
    173
    Size:
    1 2 ml
    Category:
    Competent Bacteria
    Buy from Supplier


    Structured Review

    New England Biolabs t7 express lysy e coli
    T7 Express lysY Competent E coli High Efficiency
    T7 Express lysY Competent E coli High Efficiency 6x0 2 ml
    https://www.bioz.com/result/t7 express lysy e coli/product/New England Biolabs
    Average 95 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    t7 express lysy e coli - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: Paragraph title: MBP-GbdR fusion protein: cloning and protein preparation. ... To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli .

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: E . cloni 10G electrocompetent cells (E . coli strain optimized by Lucigen for high efficiency transformation: F- mcrA Δ(mrr-hsd RMS-mcr BC) end A1 rec A1 ϕ80d lacZΔM15 Δlac X74 ara D139 Δ(ara ,leu )7697 gal U gal K rps L nup G λ- ton A) were used for cloning of L35Ae 6X (rWT L35Ae with amino acid substitutions R12K, V22E, K47R, V53D, R60E, R69K) and L35Ae 10X (rWT L35Ae with substitutions R3Y, I4V, R12K, V22E, K47R, V53D, R60E, R65T, R69K, R71T) mutants. .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: Paragraph title: Cloning, expression and purification of recombinant streptokinase ... Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK).

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: .. Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purified protein concentrations were measured by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Article Title: Immunogenicity of a chimeric Plasmodium falciparum merozoite surface protein vaccine in Aotus monkeys
    Article Snippet: .. Recombinant antigens The production and purification of the chimeric rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) (P. falciparum FVO strain) followed the same protocol, using codon-harmonized, synthetic gene sequences cloned into pET-28 (EMD Biosciences, San Diego, CA, USA) and SHuffle™ T7 Express lysY E. coli cells (New England Biolabs, Ipswich, MA, USA) as host. .. Expression of the recombinant proteins was accomplished using a BioFLo115 bench-top bioreactor (New Brunswick Scientific, Edison, NJ, USA).

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47. ..

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: Paragraph title: Cloning and expression ... Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs).

    Centrifugation:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli . .. The cell pellet was harvested by centrifugation and then washed twice with ice-cold buffer 1 (20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA [pH 8.0]).

    Article Title: Scavenging of superoxide by a membrane bound superoxide oxidase
    Article Snippet: The new construct was transformed into chemically competent T7 express lysY (New England Biolabs) and grown at 37° C, either in LB supplemented with 25 mg/L kanamycin and 0.01% Antifoam 204 (for non-Se-Met labeled CybB) or in minimal media supplemented with 0.4% glucose, 2 mM MgSO4 , 0.1 mM CaCl2 , 1 μM MnCl2 , 10 μM FeSO4 , 25 mg/L kanamycin and 0.01% Antifoam 204 (for production of selenomethionine labeled protein for structural determination). .. The cells were harvested by centrifugation at 7500 g in a JLA 8.1000 rotor (Beckman Coulter), transferred to 50 ml tubes and frozen at -20°C.

    Article Title: Engineering selective competitors for the discrimination of highly conserved protein-protein interaction modules
    Article Snippet: Isotopically labelled proteins production For minimal media expression and purification of isotopically labelled proteins, isotopically labelled constructs were expressed in BL21 pLysY (New England Biolabs, C3010I) from LB plates containing 30 µg mL−1 kanamycin. .. At an OD600 of ~0.8, the cells were induced for protein expression with 0.5 mM IPTG, and incubated at 20 °C, 200 rpm for 12–16 h. The cells were collected by centrifugation for 15 min at 4500 × g and resuspended in sonication buffer (500 mM NaCl, 20 mM imidazole, 50 mM phosphate buffer, pH 7.5) and lysed by sonication (45 cycles with 10 s ON/10 s OFF at 45% Amplitude).

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG. .. The supernatant after centrifugation was applied onto 5 ml of Ni-sepharose column (Sigma) for each purification.

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47. .. Cells were collected by centrifugation, rinsed twice in MOPS, and resuspended in 3 ml of cold (150 mM) Tris HCl (pH 7.2) containing Halt 1× protease inhibitor cocktail (Thermo Scientific).

    Amplification:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: The GbdR coding sequence ( gbdR , PA5380 ) was amplified from PAO1 genomic DNA using the primers pMAL-c2X-GbdR-F-EcoRI and pMAL-c2X-GbdR-R-HindIII (for sequences, see Table S1 in the supplemental material), and the product was cloned into pMAL-c2X (NEB) using the EcoRI and HindIII restriction sites, creating an N-terminal maltose binding protein (MBP) fusion construct that eliminated the ATG start codon from the original gbdR sequence. .. To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli .

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: Cloning, expression and purification of recombinant streptokinase The coding region for mature recombinant streptokinase from the H46A strain of Streptococcus equisimilis (rSK) protein (414 amino acids, amino-terminal isoleucine) was amplified from genomic DNA (a gift from Biocon, Bangalore, India) by PCR and cloned in frame with the amino-terminal SUMOstar fusion tag in the vector pI-SUMOstar (Lifesensors, Malvern, PA, USA). .. Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK).

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: Briefly, souR was amplified from genomic DNA with primers (souR_MBP_F and souR_MBP_R) designed to exclude the start codon and incorporate flanking restriction sites to facilitate ligation in frame with the MBP ORF, generating pGW015. .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47.

    Filtration:

    Article Title: F1-ATPase of Escherichia coli
    Article Snippet: Wild-type and mutant forms of H6 -ϵ were expressed in E. coli BL21 strain “T7 Express lysY” (New England Biolabs). .. Residual impurities were removed from H6 -ϵ by gel filtration (HiPrep-16/60, Sephacryl S100 HR, GE Healthcare Life Sciences), and pure H6 -ϵ was exchanged into ϵ-buffer + 10% (v/v) glycerol before storage at −80 °C.

    Article Title: Immunogenicity of a chimeric Plasmodium falciparum merozoite surface protein vaccine in Aotus monkeys
    Article Snippet: Recombinant antigens The production and purification of the chimeric rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) (P. falciparum FVO strain) followed the same protocol, using codon-harmonized, synthetic gene sequences cloned into pET-28 (EMD Biosciences, San Diego, CA, USA) and SHuffle™ T7 Express lysY E. coli cells (New England Biolabs, Ipswich, MA, USA) as host. .. For this study, rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) were further purified by gel filtration (Superdex 75, GE Healthcare Bio-Sciences Corp, Piscataway, NJ, USA) followed by a second round of Ni–NTA affinity chromatography (Qiagen, Valencia, CA, USA).

    Acetylene Reduction Assay:

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: E . cloni 10G electrocompetent cells (E . coli strain optimized by Lucigen for high efficiency transformation: F- mcrA Δ(mrr-hsd RMS-mcr BC) end A1 rec A1 ϕ80d lacZΔM15 Δlac X74 ara D139 Δ(ara ,leu )7697 gal U gal K rps L nup G λ- ton A) were used for cloning of L35Ae 6X (rWT L35Ae with amino acid substitutions R12K, V22E, K47R, V53D, R60E, R69K) and L35Ae 10X (rWT L35Ae with substitutions R3Y, I4V, R12K, V22E, K47R, V53D, R60E, R65T, R69K, R71T) mutants. .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Construct:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: The GbdR coding sequence ( gbdR , PA5380 ) was amplified from PAO1 genomic DNA using the primers pMAL-c2X-GbdR-F-EcoRI and pMAL-c2X-GbdR-R-HindIII (for sequences, see Table S1 in the supplemental material), and the product was cloned into pMAL-c2X (NEB) using the EcoRI and HindIII restriction sites, creating an N-terminal maltose binding protein (MBP) fusion construct that eliminated the ATG start codon from the original gbdR sequence. .. To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli .

    Article Title: Scavenging of superoxide by a membrane bound superoxide oxidase
    Article Snippet: .. The new construct was transformed into chemically competent T7 express lysY (New England Biolabs) and grown at 37° C, either in LB supplemented with 25 mg/L kanamycin and 0.01% Antifoam 204 (for non-Se-Met labeled CybB) or in minimal media supplemented with 0.4% glucose, 2 mM MgSO4 , 0.1 mM CaCl2 , 1 μM MnCl2 , 10 μM FeSO4 , 25 mg/L kanamycin and 0.01% Antifoam 204 (for production of selenomethionine labeled protein for structural determination). ..

    Article Title: Engineering selective competitors for the discrimination of highly conserved protein-protein interaction modules
    Article Snippet: .. Isotopically labelled proteins production For minimal media expression and purification of isotopically labelled proteins, isotopically labelled constructs were expressed in BL21 pLysY (New England Biolabs, C3010I) from LB plates containing 30 µg mL−1 kanamycin. ..

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: Paragraph title: MBP-SouR fusion construct and protein purification. ... Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47.

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: Therefore DNA encoding an HRV3C protease cleavable N-terminal Strep-tag with ICP4 residues 258–487 (ICP4N) was obtained by gene synthesis (Invitrogen), codon optimized for expression in Escherichia coli , a shorter construct of residues 288–487 (ICP4NΔIDR) was similarly obtained. .. Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs).

    Incubation:

    Article Title: Engineering selective competitors for the discrimination of highly conserved protein-protein interaction modules
    Article Snippet: Isotopically labelled proteins production For minimal media expression and purification of isotopically labelled proteins, isotopically labelled constructs were expressed in BL21 pLysY (New England Biolabs, C3010I) from LB plates containing 30 µg mL−1 kanamycin. .. At an OD600 of ~0.8, the cells were induced for protein expression with 0.5 mM IPTG, and incubated at 20 °C, 200 rpm for 12–16 h. The cells were collected by centrifugation for 15 min at 4500 × g and resuspended in sonication buffer (500 mM NaCl, 20 mM imidazole, 50 mM phosphate buffer, pH 7.5) and lysed by sonication (45 cycles with 10 s ON/10 s OFF at 45% Amplitude).

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs). .. Culture density was monitored at 600 nm until OD 0.6, at which point protein expression was induced with 1 mM IPTG and incubation continued for 5 h at 37 °C.

    Luciferase:

    Article Title: F1-ATPase of Escherichia coli
    Article Snippet: At this stage, upon dilution and passage through two sequential centrifuge columns, luciferase assays ( ) showed that F1 (−δϵ) had the following endogenous nucleotide content (mol/mol F1 (−δϵ) ± S.E. from four different samples): noncatalytic sites, 0.89 ± 0.13 ATP and 0.83 ± 0.04 ADP; catalytic sites, 0.1 ± 0.08 ATP and 1.49 ± 0.17 ADP. .. Wild-type and mutant forms of H6 -ϵ were expressed in E. coli BL21 strain “T7 Express lysY” (New England Biolabs).

    Activity Assay:

    Article Title: Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation
    Article Snippet: For bacterial expression of the M.Sss I protein, T7 Express lysY Competent E. coli (High Efficiency) cells from NEB (cat. C3010I), harboring the pET15b‐M.Sss I plasmid, were grown at 37 °C in LB medium containing 100 μg·mL−1 ampicillin and 2% glucose. .. The specific activity of the purified M.Sss I enzyme was determined using CpG146 DNA as substrate, in comparison with the activity unit of the NEB M.Sss I enzyme (cat. M0226M), by quantifying the amounts of the Eco72 I‐digested DNA fragments.

    Expressing:

    Article Title: Scavenging of superoxide by a membrane bound superoxide oxidase
    Article Snippet: Paragraph title: Plasmids and expression ... The new construct was transformed into chemically competent T7 express lysY (New England Biolabs) and grown at 37° C, either in LB supplemented with 25 mg/L kanamycin and 0.01% Antifoam 204 (for non-Se-Met labeled CybB) or in minimal media supplemented with 0.4% glucose, 2 mM MgSO4 , 0.1 mM CaCl2 , 1 μM MnCl2 , 10 μM FeSO4 , 25 mg/L kanamycin and 0.01% Antifoam 204 (for production of selenomethionine labeled protein for structural determination).

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X. .. Human Embryonic Kidney 293 (HEK293) cell line was obtained from the Russian Cell Culture Collection (Institute of Cytology of the Russian Academy of Sciences, St. Petersburg, Russia).

    Article Title: Engineering selective competitors for the discrimination of highly conserved protein-protein interaction modules
    Article Snippet: .. Isotopically labelled proteins production For minimal media expression and purification of isotopically labelled proteins, isotopically labelled constructs were expressed in BL21 pLysY (New England Biolabs, C3010I) from LB plates containing 30 µg mL−1 kanamycin. ..

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: Paragraph title: Cloning, expression and purification of recombinant streptokinase ... Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK).

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: .. Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purified protein concentrations were measured by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Article Title: Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation
    Article Snippet: .. For bacterial expression of the M.Sss I protein, T7 Express lysY Competent E. coli (High Efficiency) cells from NEB (cat. C3010I), harboring the pET15b‐M.Sss I plasmid, were grown at 37 °C in LB medium containing 100 μg·mL−1 ampicillin and 2% glucose. .. When the cells reached an OD600 of approximately 0.6, M.Sss I expression was induced by the addition of 50 μm IPTG, and the cells were further cultured at 16 °C for 16 h. Purification of the M.Sss I protein was performed essentially as described previously .

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: .. For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG. .. The harvested cells were lysed by sonication in lysis buffer (50 mM Tris-HCl pH 8.5, 500 mM NaCl, 10 mM imidazole, 5mM β-mercaptoethanol and 1 mM benzamidine chloride).

    Article Title: Immunogenicity of a chimeric Plasmodium falciparum merozoite surface protein vaccine in Aotus monkeys
    Article Snippet: Recombinant antigens The production and purification of the chimeric rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) (P. falciparum FVO strain) followed the same protocol, using codon-harmonized, synthetic gene sequences cloned into pET-28 (EMD Biosciences, San Diego, CA, USA) and SHuffle™ T7 Express lysY E. coli cells (New England Biolabs, Ipswich, MA, USA) as host. .. Expression of the recombinant proteins was accomplished using a BioFLo115 bench-top bioreactor (New Brunswick Scientific, Edison, NJ, USA).

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47. ..

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: Paragraph title: Cloning and expression ... Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs).

    BIA-KA:

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purified protein concentrations were measured by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Transformation Assay:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: .. To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli . ..

    Article Title: Scavenging of superoxide by a membrane bound superoxide oxidase
    Article Snippet: .. The new construct was transformed into chemically competent T7 express lysY (New England Biolabs) and grown at 37° C, either in LB supplemented with 25 mg/L kanamycin and 0.01% Antifoam 204 (for non-Se-Met labeled CybB) or in minimal media supplemented with 0.4% glucose, 2 mM MgSO4 , 0.1 mM CaCl2 , 1 μM MnCl2 , 10 μM FeSO4 , 25 mg/L kanamycin and 0.01% Antifoam 204 (for production of selenomethionine labeled protein for structural determination). ..

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: E . cloni 10G electrocompetent cells (E . coli strain optimized by Lucigen for high efficiency transformation: F- mcrA Δ(mrr-hsd RMS-mcr BC) end A1 rec A1 ϕ80d lacZΔM15 Δlac X74 ara D139 Δ(ara ,leu )7697 gal U gal K rps L nup G λ- ton A) were used for cloning of L35Ae 6X (rWT L35Ae with amino acid substitutions R12K, V22E, K47R, V53D, R60E, R69K) and L35Ae 10X (rWT L35Ae with substitutions R3Y, I4V, R12K, V22E, K47R, V53D, R60E, R65T, R69K, R71T) mutants. .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: .. For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG. .. The harvested cells were lysed by sonication in lysis buffer (50 mM Tris-HCl pH 8.5, 500 mM NaCl, 10 mM imidazole, 5mM β-mercaptoethanol and 1 mM benzamidine chloride).

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47. ..

    Chromatography:

    Article Title: F1-ATPase of Escherichia coli
    Article Snippet: F1 (−δ) was depleted of subunit ϵ by immunoaffinity chromatography , using three passages of 5–7 mg of F1 −δ through an anti-ϵ column (3 ml). .. Wild-type and mutant forms of H6 -ϵ were expressed in E. coli BL21 strain “T7 Express lysY” (New England Biolabs).

    Ligation:

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: Briefly, souR was amplified from genomic DNA with primers (souR_MBP_F and souR_MBP_R) designed to exclude the start codon and incorporate flanking restriction sites to facilitate ligation in frame with the MBP ORF, generating pGW015. .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47.

    Protease Inhibitor:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli . .. The final pellet was resuspended in buffer 1 and then amended to 1× Halt protease inhibitor cocktail (Thermo-Fisher) and 3 mg/ml lysozyme.

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47. .. Cells were collected by centrifugation, rinsed twice in MOPS, and resuspended in 3 ml of cold (150 mM) Tris HCl (pH 7.2) containing Halt 1× protease inhibitor cocktail (Thermo Scientific).

    Synthesized:

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: Materials Gene of 6×His-tagged recombinant wild type 50S ribosomal protein L35Ae from Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3 ; UniProt entry O74099) was codon optimized for the expression in E . coli using Optimizer server ( http://genomes.urv.es/OPTIMIZER/ [ ]) and synthesized by Bio Basic Canada Inc. (Markham, Ontario, Canada): ATGGGTCGCATTAAAGGCGTGGTGCTGAGCTATCGCCGCAGCAAGGAAAACCAGCATACCAACGTGATGATTATCAAGCCGCTGGACATTAACAGCCGCGAGGAAGCGAGCAAACTGATTGGCCGCCTGGTGGTCTGGAAAAGCCCGAGCGGCAAGGTGCTGAAAGGCAAAATCGTGCGCGTGCATGGCACCCGCGGCGCGGTGCGCGCGCGCTTCGAGAAAGGCCTGCCGGGTCAGGCGCTGGGCGATTACGTGGAAATCATCGGCGGTCTCGAGCACCACCACCACCACCACTGA The L35Ae gene was cloned into pET-28b(+) vector (Novagen) between the Nco I and Xho I restriction sites. .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Cell Culture:

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X. .. Human Embryonic Kidney 293 (HEK293) cell line was obtained from the Russian Cell Culture Collection (Institute of Cytology of the Russian Academy of Sciences, St. Petersburg, Russia).

    Article Title: Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation
    Article Snippet: For bacterial expression of the M.Sss I protein, T7 Express lysY Competent E. coli (High Efficiency) cells from NEB (cat. C3010I), harboring the pET15b‐M.Sss I plasmid, were grown at 37 °C in LB medium containing 100 μg·mL−1 ampicillin and 2% glucose. .. When the cells reached an OD600 of approximately 0.6, M.Sss I expression was induced by the addition of 50 μm IPTG, and the cells were further cultured at 16 °C for 16 h. Purification of the M.Sss I protein was performed essentially as described previously .

    DNA Sequencing:

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: Nucleotide sequences of the resulting genes were verified by automatic DNA sequencing. .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Protein Concentration:

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK). .. Protein purity was determined visually by SDS PAGE, and protein concentrations were determined using Coomassie plus reagent (Thermo Fisher Scientific) relative to a standard curve of rSK of known protein concentration determined by amino acid analysis (Alta Bioscience, Birmingham, UK).

    Polymerase Chain Reaction:

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: SUMOstar-streptokinase fusion sequences were sub-cloned into the EcoRV site of the expression vector pET-Blue-1 (Novagen (Merck), Darmstadt, Germany) by PCR. .. Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK).

    Sonication:

    Article Title: Engineering selective competitors for the discrimination of highly conserved protein-protein interaction modules
    Article Snippet: Isotopically labelled proteins production For minimal media expression and purification of isotopically labelled proteins, isotopically labelled constructs were expressed in BL21 pLysY (New England Biolabs, C3010I) from LB plates containing 30 µg mL−1 kanamycin. .. At an OD600 of ~0.8, the cells were induced for protein expression with 0.5 mM IPTG, and incubated at 20 °C, 200 rpm for 12–16 h. The cells were collected by centrifugation for 15 min at 4500 × g and resuspended in sonication buffer (500 mM NaCl, 20 mM imidazole, 50 mM phosphate buffer, pH 7.5) and lysed by sonication (45 cycles with 10 s ON/10 s OFF at 45% Amplitude).

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG. .. The harvested cells were lysed by sonication in lysis buffer (50 mM Tris-HCl pH 8.5, 500 mM NaCl, 10 mM imidazole, 5mM β-mercaptoethanol and 1 mM benzamidine chloride).

    Binding Assay:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: The GbdR coding sequence ( gbdR , PA5380 ) was amplified from PAO1 genomic DNA using the primers pMAL-c2X-GbdR-F-EcoRI and pMAL-c2X-GbdR-R-HindIII (for sequences, see Table S1 in the supplemental material), and the product was cloned into pMAL-c2X (NEB) using the EcoRI and HindIII restriction sites, creating an N-terminal maltose binding protein (MBP) fusion construct that eliminated the ATG start codon from the original gbdR sequence. .. To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli .

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: A maltose binding protein-SouR fusion (MBP-SouR) was engineered into the pMALc2x vector, as previously described for AraC family transcription factors ( , ). .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47.

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: Cloning and expression Sequence conservation , predictions of secondary structure and disorder ( ) (Figure and ) along with data from the literature ( , , , , ) suggested the complete DNA binding domain (DBD) of ICP4 is comprised within residues 258–487. .. Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs).

    Mutagenesis:

    Article Title: F1-ATPase of Escherichia coli
    Article Snippet: .. Wild-type and mutant forms of H6 -ϵ were expressed in E. coli BL21 strain “T7 Express lysY” (New England Biolabs). .. H6 -ϵ was purified by affinity chromatography (column with 10 ml of TALON resin; Clontech) as described ( ) but with ϵ-buffer at pH 7.5 (20 m m Tris-HCl, 100 m m NaCl, pH 7.5).

    Isolation:

    Article Title: Context-dependent function of a conserved translational regulatory module
    Article Snippet: .. GST fusion proteins were isolated from T7 Express lysY competent E. coli (New England BioLabs) and purified using the following elution buffer: 1×PBS, 0.2% Tween 20, 150 mM NaCl, 0.1% 2-mercaptoethanol, 50 mM glutathione (reduced, pH 8.0). .. Twenty femtomoles 32 P end-labeled oligoribonucleotides (Dharmacon) were combined with GST-Cbr-PUF-2 or GST-Cbr-PUF-1.2 at various concentrations as described ( ).

    Labeling:

    Article Title: Scavenging of superoxide by a membrane bound superoxide oxidase
    Article Snippet: .. The new construct was transformed into chemically competent T7 express lysY (New England Biolabs) and grown at 37° C, either in LB supplemented with 25 mg/L kanamycin and 0.01% Antifoam 204 (for non-Se-Met labeled CybB) or in minimal media supplemented with 0.4% glucose, 2 mM MgSO4 , 0.1 mM CaCl2 , 1 μM MnCl2 , 10 μM FeSO4 , 25 mg/L kanamycin and 0.01% Antifoam 204 (for production of selenomethionine labeled protein for structural determination). ..

    Purification:

    Article Title: Engineering selective competitors for the discrimination of highly conserved protein-protein interaction modules
    Article Snippet: .. Isotopically labelled proteins production For minimal media expression and purification of isotopically labelled proteins, isotopically labelled constructs were expressed in BL21 pLysY (New England Biolabs, C3010I) from LB plates containing 30 µg mL−1 kanamycin. ..

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: Paragraph title: Cloning, expression and purification of recombinant streptokinase ... Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK).

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: .. Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purified protein concentrations were measured by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Article Title: Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation
    Article Snippet: Paragraph title: Purification of the de novo CpG methyltransferase M.Sss I ... For bacterial expression of the M.Sss I protein, T7 Express lysY Competent E. coli (High Efficiency) cells from NEB (cat. C3010I), harboring the pET15b‐M.Sss I plasmid, were grown at 37 °C in LB medium containing 100 μg·mL−1 ampicillin and 2% glucose.

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG. .. The supernatant after centrifugation was applied onto 5 ml of Ni-sepharose column (Sigma) for each purification.

    Article Title: F1-ATPase of Escherichia coli
    Article Snippet: Paragraph title: Purification of Proteins ... Wild-type and mutant forms of H6 -ϵ were expressed in E. coli BL21 strain “T7 Express lysY” (New England Biolabs).

    Article Title: Context-dependent function of a conserved translational regulatory module
    Article Snippet: .. GST fusion proteins were isolated from T7 Express lysY competent E. coli (New England BioLabs) and purified using the following elution buffer: 1×PBS, 0.2% Tween 20, 150 mM NaCl, 0.1% 2-mercaptoethanol, 50 mM glutathione (reduced, pH 8.0). .. Twenty femtomoles 32 P end-labeled oligoribonucleotides (Dharmacon) were combined with GST-Cbr-PUF-2 or GST-Cbr-PUF-1.2 at various concentrations as described ( ).

    Article Title: Immunogenicity of a chimeric Plasmodium falciparum merozoite surface protein vaccine in Aotus monkeys
    Article Snippet: .. Recombinant antigens The production and purification of the chimeric rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) (P. falciparum FVO strain) followed the same protocol, using codon-harmonized, synthetic gene sequences cloned into pET-28 (EMD Biosciences, San Diego, CA, USA) and SHuffle™ T7 Express lysY E. coli cells (New England Biolabs, Ipswich, MA, USA) as host. .. Expression of the recombinant proteins was accomplished using a BioFLo115 bench-top bioreactor (New Brunswick Scientific, Edison, NJ, USA).

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47. ..

    Protein Purification:

    Article Title: Three Mycobacterium tuberculosis Rel Toxin-Antitoxin Modules Inhibit Mycobacterial Growth and Are Expressed in Infected Human Macrophages ▿
    Article Snippet: .. T7 Express lysY -competent E. coli cells were used for protein purification (New England Biolabs, Ipswich, MA) and production of whole-cell lysates (WCL) for far-Western analysis. .. M. tuberculosis H37Rv (ATCC no. 25618) and M. smegmatis mc2 155 (obtained from William R. Jacobs, Jr., Albert Einstein College of Medicine, New York, NY) were used in the present study.

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: .. Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purified protein concentrations were measured by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: Paragraph title: Protein purification ... For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG.

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: Paragraph title: MBP-SouR fusion construct and protein purification. ... Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47.

    Sequencing:

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: The GbdR coding sequence ( gbdR , PA5380 ) was amplified from PAO1 genomic DNA using the primers pMAL-c2X-GbdR-F-EcoRI and pMAL-c2X-GbdR-R-HindIII (for sequences, see Table S1 in the supplemental material), and the product was cloned into pMAL-c2X (NEB) using the EcoRI and HindIII restriction sites, creating an N-terminal maltose binding protein (MBP) fusion construct that eliminated the ATG start codon from the original gbdR sequence. .. To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli .

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: The final protein sequence, referred to as ‘rWT L35Ae’, contained a Gly residue inserted between the residues M1 and R2 and the C-terminal GGLE sequence, followed by a 6×His tag (see ). .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: Cloning and expression Sequence conservation , predictions of secondary structure and disorder ( ) (Figure and ) along with data from the literature ( , , , , ) suggested the complete DNA binding domain (DBD) of ICP4 is comprised within residues 258–487. .. Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs).

    Affinity Chromatography:

    Article Title: Immunogenicity of a chimeric Plasmodium falciparum merozoite surface protein vaccine in Aotus monkeys
    Article Snippet: Recombinant antigens The production and purification of the chimeric rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) (P. falciparum FVO strain) followed the same protocol, using codon-harmonized, synthetic gene sequences cloned into pET-28 (EMD Biosciences, San Diego, CA, USA) and SHuffle™ T7 Express lysY E. coli cells (New England Biolabs, Ipswich, MA, USA) as host. .. For this study, rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) were further purified by gel filtration (Superdex 75, GE Healthcare Bio-Sciences Corp, Piscataway, NJ, USA) followed by a second round of Ni–NTA affinity chromatography (Qiagen, Valencia, CA, USA).

    Affinity Column:

    Article Title: F1-ATPase of Escherichia coli
    Article Snippet: Wild-type and mutant forms of H6 -ϵ were expressed in E. coli BL21 strain “T7 Express lysY” (New England Biolabs). .. H6 -ϵ was purified by affinity chromatography (column with 10 ml of TALON resin; Clontech) as described ( ) but with ϵ-buffer at pH 7.5 (20 m m Tris-HCl, 100 m m NaCl, pH 7.5).

    Staining:

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purity of each fraction was confirmed by SDS-PAGE and Coomassie staining.

    SDS Page:

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK). .. Recombinant SUMO star-streptokinase fusion proteins were purified by Ni-affinity and cleaved with SUMOstar Protease I (Lifesensors) over 4 h (assessed by SDS PAGE) at 30°C in the recommended buffer.

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purity of each fraction was confirmed by SDS-PAGE and Coomassie staining.

    Plasmid Preparation:

    Article Title: Three Mycobacterium tuberculosis Rel Toxin-Antitoxin Modules Inhibit Mycobacterial Growth and Are Expressed in Infected Human Macrophages ▿
    Article Snippet: E. coli strain JM109 was used as a host for plasmid constructions (Stratagene, La Jolla, CA). .. T7 Express lysY -competent E. coli cells were used for protein purification (New England Biolabs, Ipswich, MA) and production of whole-cell lysates (WCL) for far-Western analysis.

    Article Title: Characterization of the GbdR Regulon in Pseudomonas aeruginosa
    Article Snippet: This plasmid is designated pKH10. .. To express the MBP-GbdR fusion protein, pKH10 was transformed into New England BioLabs T7 Express lysY / I q competent E. coli .

    Article Title: Scavenging of superoxide by a membrane bound superoxide oxidase
    Article Snippet: The expression plasmid pCybB-His was engineered from a GFP-tagged E. coli CybB construct by replacing the GFP moiety with a 8x His-tag, as described previously . .. The new construct was transformed into chemically competent T7 express lysY (New England Biolabs) and grown at 37° C, either in LB supplemented with 25 mg/L kanamycin and 0.01% Antifoam 204 (for non-Se-Met labeled CybB) or in minimal media supplemented with 0.4% glucose, 2 mM MgSO4 , 0.1 mM CaCl2 , 1 μM MnCl2 , 10 μM FeSO4 , 25 mg/L kanamycin and 0.01% Antifoam 204 (for production of selenomethionine labeled protein for structural determination).

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: SUMOstar-streptokinase fusion sequences were sub-cloned into the EcoRV site of the expression vector pET-Blue-1 (Novagen (Merck), Darmstadt, Germany) by PCR. .. Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK).

    Article Title: Mechanisms of Ca2+/calmodulin-dependent kinase II activation in single dendritic spines
    Article Snippet: .. Protein purification His-tagged mCherry-synapsin 1 peptide (a gift from Dr. Murakoshi) , His-tagged mCherry-CaM and His-tagged calmodulin were cloned into pRSET bacterial expression vector (Thermo Fisher Scientific) and expressed in T7 Express lysY Competent Escherichia Coli (New England BioLabs Inc.), purified with a Ni-NTA column (HisTrap™ HP; GE Healthcare) and desalted with PD-10 column (GE Healthcare). .. The purified protein concentrations were measured by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).

    Article Title: Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation
    Article Snippet: .. For bacterial expression of the M.Sss I protein, T7 Express lysY Competent E. coli (High Efficiency) cells from NEB (cat. C3010I), harboring the pET15b‐M.Sss I plasmid, were grown at 37 °C in LB medium containing 100 μg·mL−1 ampicillin and 2% glucose. .. When the cells reached an OD600 of approximately 0.6, M.Sss I expression was induced by the addition of 50 μm IPTG, and the cells were further cultured at 16 °C for 16 h. Purification of the M.Sss I protein was performed essentially as described previously .

    Article Title: Sarcosine Catabolism in Pseudomonas aeruginosa Is Transcriptionally Regulated by SouR
    Article Snippet: A maltose binding protein-SouR fusion (MBP-SouR) was engineered into the pMALc2x vector, as previously described for AraC family transcription factors ( , ). .. Following cloning in E. coli DH5α, purified pGW015 was transformed into chemically competent E. coli T7 lysY lysI q (New England BioLabs) to generate the MBP-SouR expression strain, GGW47.

    Recombinant:

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: Materials Gene of 6×His-tagged recombinant wild type 50S ribosomal protein L35Ae from Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3 ; UniProt entry O74099) was codon optimized for the expression in E . coli using Optimizer server ( http://genomes.urv.es/OPTIMIZER/ [ ]) and synthesized by Bio Basic Canada Inc. (Markham, Ontario, Canada): ATGGGTCGCATTAAAGGCGTGGTGCTGAGCTATCGCCGCAGCAAGGAAAACCAGCATACCAACGTGATGATTATCAAGCCGCTGGACATTAACAGCCGCGAGGAAGCGAGCAAACTGATTGGCCGCCTGGTGGTCTGGAAAAGCCCGAGCGGCAAGGTGCTGAAAGGCAAAATCGTGCGCGTGCATGGCACCCGCGGCGCGGTGCGCGCGCGCTTCGAGAAAGGCCTGCCGGGTCAGGCGCTGGGCGATTACGTGGAAATCATCGGCGGTCTCGAGCACCACCACCACCACCACTGA The L35Ae gene was cloned into pET-28b(+) vector (Novagen) between the Nco I and Xho I restriction sites. .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: .. Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK). .. Recombinant SUMO star-streptokinase fusion proteins were purified by Ni-affinity and cleaved with SUMOstar Protease I (Lifesensors) over 4 h (assessed by SDS PAGE) at 30°C in the recommended buffer.

    Article Title: Immunogenicity of a chimeric Plasmodium falciparum merozoite surface protein vaccine in Aotus monkeys
    Article Snippet: .. Recombinant antigens The production and purification of the chimeric rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) (P. falciparum FVO strain) followed the same protocol, using codon-harmonized, synthetic gene sequences cloned into pET-28 (EMD Biosciences, San Diego, CA, USA) and SHuffle™ T7 Express lysY E. coli cells (New England Biolabs, Ipswich, MA, USA) as host. .. Expression of the recombinant proteins was accomplished using a BioFLo115 bench-top bioreactor (New Brunswick Scientific, Edison, NJ, USA).

    Protein Binding:

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG. .. After protein binding, the column was washed thoroughly with 100 column volumes of lysis buffer followed by 10 volumes of lysis buffer supplemented with 40 mM imidazole.

    Mobility Shift:

    Article Title: Context-dependent function of a conserved translational regulatory module
    Article Snippet: Paragraph title: Gel mobility shift assays ... GST fusion proteins were isolated from T7 Express lysY competent E. coli (New England BioLabs) and purified using the following elution buffer: 1×PBS, 0.2% Tween 20, 150 mM NaCl, 0.1% 2-mercaptoethanol, 50 mM glutathione (reduced, pH 8.0).

    Strep-tag:

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: Therefore DNA encoding an HRV3C protease cleavable N-terminal Strep-tag with ICP4 residues 258–487 (ICP4N) was obtained by gene synthesis (Invitrogen), codon optimized for expression in Escherichia coli , a shorter construct of residues 288–487 (ICP4NΔIDR) was similarly obtained. .. Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs).

    Lysis:

    Article Title: Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in Escherichia coli
    Article Snippet: For biochemical studies, Cas protein expression vectors were transformed into T7 Express lysY host cells (New England Biolabs) and expression was induced at 15 C for 20 hr with 0.3 mM IPTG. .. The harvested cells were lysed by sonication in lysis buffer (50 mM Tris-HCl pH 8.5, 500 mM NaCl, 10 mM imidazole, 5mM β-mercaptoethanol and 1 mM benzamidine chloride).

    Positron Emission Tomography:

    Article Title: Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold
    Article Snippet: Materials Gene of 6×His-tagged recombinant wild type 50S ribosomal protein L35Ae from Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3 ; UniProt entry O74099) was codon optimized for the expression in E . coli using Optimizer server ( http://genomes.urv.es/OPTIMIZER/ [ ]) and synthesized by Bio Basic Canada Inc. (Markham, Ontario, Canada): ATGGGTCGCATTAAAGGCGTGGTGCTGAGCTATCGCCGCAGCAAGGAAAACCAGCATACCAACGTGATGATTATCAAGCCGCTGGACATTAACAGCCGCGAGGAAGCGAGCAAACTGATTGGCCGCCTGGTGGTCTGGAAAAGCCCGAGCGGCAAGGTGCTGAAAGGCAAAATCGTGCGCGTGCATGGCACCCGCGGCGCGGTGCGCGCGCGCTTCGAGAAAGGCCTGCCGGGTCAGGCGCTGGGCGATTACGTGGAAATCATCGGCGGTCTCGAGCACCACCACCACCACCACTGA The L35Ae gene was cloned into pET-28b(+) vector (Novagen) between the Nco I and Xho I restriction sites. .. T7 Express lysY (High Efficiency) E . coli strain (MiniF lysY (CamR ) / fhuA2 lacZ ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73 ::miniTn10— TetS )2 [dcm] R(zgb-210 ::Tn10— TetS ) endA1 ∆(mcrC-mrr)114 ::IS10 ) (New England BioLabs Inc.) was used for expression of rWT L35Ae, L35Ae 6X and L35Ae 10X.

    Article Title: Biosimilars: the process is the product. The example of recombinant streptokinase
    Article Snippet: SUMOstar-streptokinase fusion sequences were sub-cloned into the EcoRV site of the expression vector pET-Blue-1 (Novagen (Merck), Darmstadt, Germany) by PCR. .. Recombinant streptokinase variants were expressed in T7 Express lysY E. coli (NEB, Herts, UK) and cells were lysed using B-PER Direct with enzymes (Thermo Fisher Scientific, Loughborough, UK).

    Article Title: Immunogenicity of a chimeric Plasmodium falciparum merozoite surface protein vaccine in Aotus monkeys
    Article Snippet: .. Recombinant antigens The production and purification of the chimeric rPf MSP1/8 and rPf MSP8 (ΔAsn/Asp) (P. falciparum FVO strain) followed the same protocol, using codon-harmonized, synthetic gene sequences cloned into pET-28 (EMD Biosciences, San Diego, CA, USA) and SHuffle™ T7 Express lysY E. coli cells (New England Biolabs, Ipswich, MA, USA) as host. .. Expression of the recombinant proteins was accomplished using a BioFLo115 bench-top bioreactor (New Brunswick Scientific, Edison, NJ, USA).

    Article Title: The herpes viral transcription factor ICP4 forms a novel DNA recognition complex
    Article Snippet: The DNA fragments were individually cloned into the NdeI and XhoI restriction sites of pET-21a(+) (Merek). .. Both proteins were expressed in the same conditions using E. coli strain T7 Express LysY (New England Biolabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs t7 express lysy e coli
    T7 Express Lysy E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 express lysy e coli/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    t7 express lysy e coli - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results