e coli bacteria neb 5 alpha  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    NEB 5-alpha Competent E.coli (High Efficiency) - 20x
    Description:

    Catalog Number:
    C2987H
    Price:
    None
    Buy from Supplier


    Structured Review

    New England Biolabs e coli bacteria neb 5 alpha

    https://www.bioz.com/result/e coli bacteria neb 5 alpha/product/New England Biolabs
    Average 99 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    e coli bacteria neb 5 alpha - by Bioz Stars, 2019-09
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: Initially the GFP was amplified by PCR using Phusion® High-Fidelity DNA polymerase (New England Biolabs) and primers designed to add the correct restriction sites for subsequent cloning (Thermo Fisher Scientific). .. Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs).

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: The DNA template used to produce the mouse STARS DNA fragment was the pBluescript-mouseSTARS plasmid, which was previously cloned by our group. .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC).

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: Paragraph title: En masse recombinational cloning‐based creation of barcoded strain pools ... The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK). .. The transformed bacteria were plated onto Luria Agar plates with 100 μg/ml ampicillin, 100 μM IPTG and 50 μg/ml X-Gal, and incubated at 37°C for 18 h, until colonies were visible; the plates were transferred to the refrigerator (4°C) in order to visualize the blue/white staining.

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: To complement the PA0180, PA2864, PA3160 and PA3435 transposon mutants, the corresponding genes with their own promoter and terminator were amplified by PCR from the PAO1 genomic DNA using the Q5® High-Fidelity DNA Polymerase and primers listed in . .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli . .. Transformants were selected onto LB agar containing 100 μg/mL ampicillin.

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid.

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: The resulting DNA fragment was cloned into the pACT3 vector using Sac I and Hin dIII restriction sites. .. The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB).

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: Paragraph title: Cloning the baiF and baiK genes ... Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University.

    Article Title: Overexpression of fetA (ybbL) and fetB (ybbM), Encoding an Iron Exporter, Enhances Resistance to Oxidative Stress in Escherichia coli
    Article Snippet: The plasmid genomic libraries utilized in this study were previously constructed ( ). .. The libraries were methylated in NEB 5-alpha competent E. coli cells (New England BioLabs, Ipswich, MA, USA) and were transformed into E. coli K-12 strain MG1655 to obtain 2.6 × 108 clones with both plasmid libraries. .. A 2% inoculum of a coexisting frozen dual-plasmid library stock was cultured in 125 ml LB medium in a baffled flask to an OD600 of 1.

    Amplification:

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions.

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: These include, for instance, SOSIP mutations ( , ), stabilizing mutations , enhanced furin cleavage site RRRRRR , and various truncations shown in and described under “Results.” The JRFL gp120 clone was also constructed from the same template by PCR amplification of the appropriate sequence corresponding to gp120. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: Initially the GFP was amplified by PCR using Phusion® High-Fidelity DNA polymerase (New England Biolabs) and primers designed to add the correct restriction sites for subsequent cloning (Thermo Fisher Scientific). .. Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs).

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: The mouse STARS DNA fragment and pFLAG-CMV4 plasmid were digested using the EcoRI and BamHI restriction enzymes (NEB, Ipswich, MA) and subsequently ligated to produce the pFLAG-mSTARS plasmid. .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC). .. Finally, automated sequencing (Applied Genetic Diagnostics, Parkville, VIC) was performed.

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: Differentially expressed cDNAs with different adaptor sequences at two ends, were selectively amplified by PCR, and a second PCR was done with the nested primers to further reduce the background. .. However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK).

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: Construction of pDHBop(Mj-asd*)-ppc* and pDHBop(Ec-asd*)-ppc*: TheMj-asd E210Q gene was PCR amplified from pET28-Mj-asd E210Q using Phusion polymerase (Thermo-Scientific) and the forward and reverse primers Mj-asd_clon_for and Mj-asd_clon_rev , respectively. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ).

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: To complement the PA0180, PA2864, PA3160 and PA3435 transposon mutants, the corresponding genes with their own promoter and terminator were amplified by PCR from the PAO1 genomic DNA using the Q5® High-Fidelity DNA Polymerase and primers listed in . .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli . .. Transformants were selected onto LB agar containing 100 μg/mL ampicillin.

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: Amplification of the 3C protease gene from an FMDV Asia1 Lebanon 1989 (GenBank accession no. AY593798 ) noninfectious template was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers XmaI-3C-F (CTACCCGGGCCGAGTGGTGCCCCAC) and 3C-NotI-R (TAGCGGCCGCTACTCGTGGTGTGGTTC). .. Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs).

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: To replace the original ribosome-binding site (RBS) of pACT3 in front of the ppcK620S gene by a stronger one, ppcK620S was PCR amplified using primers ppc_sRBS_for and ppc_sRBS_for, respectively, and cloned into the pACT3 and pEXT20 vectors using Sma I and Xba I restriction sites. .. The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB).

    Reporter Assay:

    Article Title: Identification of potential regulatory mutations using multi-omics analysis and haplotyping of lung adenocarcinoma cell lines
    Article Snippet: Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions. .. Transfection was done by ViaFectTM Transfection Reagent (E4981, Promega) according to manufacturer instructions with medium to final volume ratio of 4:1.

    Synthesized:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: The BG505 (BG505.W6M.ENV.C2) ( , ) gp140 envelope sequence was codon-optimized and the optimized sequence was synthesized using the GenArt Strings technology (Life Technologies). .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: The superfolder-GFP gene of 717 bp was synthesized by GeneArt™ Gene Synthesis (Thermo Fisher Scientific, Paisley, UK; Additional file : Figure S3). .. Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs).

    Construct:

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: A linear pUC19 vector was constructed by inverse PCR. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions.

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: During this process, a series of mutations were also introduced, as follows: Asn at aa 332 to introduce an N -linked glycosylation site that allows binding of BG505 gp140 to 2G12 ( ) BnAb; SOSIP ( ); RRRRRR ( ); and various other mutations described under “Results.” A series of modified pcDNA3.1(−) vectors were constructed, each containing the CD5 secretion signal, a linker containing three alanines, and various Strep-tag II and octahistidine tags described under “Results.” Restriction sites NheI and NotI were introduced between the CD5 signal and the alanine linker. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: The resulting DNA fragment was ligated into pDHBop-ppc* using SpeI and BglII restriction sites. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ). .. Escherichia coli K-12 substr.

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: Paragraph title: Preparation of pTarget GLuc-Δ1D2A-3C constructs. ... Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: PAFAH2 (Origene, #RC200355) and ESD (Origene, #RC200533) constructs were digested using EcoR1-HF (New England BioLabs, #R3101S) and Fse1 (New England BioLabs, #R0588S), followed by heat inactivation. .. NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid.

    Article Title: Overexpression of fetA (ybbL) and fetB (ybbM), Encoding an Iron Exporter, Enhances Resistance to Oxidative Stress in Escherichia coli
    Article Snippet: The libraries were methylated in NEB 5-alpha competent E. coli cells (New England BioLabs, Ipswich, MA, USA) and were transformed into E. coli K-12 strain MG1655 to obtain 2.6 × 108 clones with both plasmid libraries. .. The libraries were methylated in NEB 5-alpha competent E. coli cells (New England BioLabs, Ipswich, MA, USA) and were transformed into E. coli K-12 strain MG1655 to obtain 2.6 × 108 clones with both plasmid libraries.

    Electrophoresis:

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid. .. NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid.

    Article Title: Strep-tag II fusion technology for the modification and immobilization of lipase B from Candida antarctica (CALB)
    Article Snippet: Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs. .. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs.

    Incubation:

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: Reactions were incubated in a thermocycler with the parameters: 1 cycle at 98 °C for 10 s followed by 25 cycles of denaturation at 98 °C for 10 s, annealing at 68 °C for 10 s and extension at 72 °C for 15 s concluding with a final extension cycle at 72 °C for 10 min. Inverse PCR primers used were Forward: TGGCGTAATC ATGGTCATAGC and Reverse: CCCGGGTACC GAGCTCGAAT TC. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions. .. Miniprep DNA was prepared and sequenced using primers 1224 (CGCCAGGGTT TTCCCAGTCA CGAC) and 1233 (AGCGGATAAC AATTTCACAC AGGA).

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: In each of the following 4 days, 150 ng of destination plasmid pool in 4 μl of TE and 1 μl of the enzyme was added to each reaction and incubated overnight at room temperature to saturate the reaction for each ORF and normalize ORF‐dependent Gateway LR reaction efficiencies. .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: The secondary PCR products of SSH were inserted into pGEM-T easy vector (Promega, Madison, WI, USA). .. However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK). .. The transformed bacteria were plated onto Luria Agar plates with 100 μg/ml ampicillin, 100 μM IPTG and 50 μg/ml X-Gal, and incubated at 37°C for 18 h, until colonies were visible; the plates were transferred to the refrigerator (4°C) in order to visualize the blue/white staining.

    Luciferase:

    Article Title: Identification of potential regulatory mutations using multi-omics analysis and haplotyping of lung adenocarcinoma cell lines
    Article Snippet: Paragraph title: Luciferase assay ... Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions.

    Expressing:

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs). .. For cloning into P. pastoris 5–10 μg of plasmid DNA was linearized with Pme I at a single restriction site within the AOX1 promoter.

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: Paragraph title: Construction of pFLAG-mSTARS expression vector ... Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC).

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: In each of the following 4 days, 150 ng of destination plasmid pool in 4 μl of TE and 1 μl of the enzyme was added to each reaction and incubated overnight at room temperature to saturate the reaction for each ORF and normalize ORF‐dependent Gateway LR reaction efficiencies. .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics). .. Barcode sequences and ORFs of the entire colonies were then identified by kiloSEQ (seqWell Inc.).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Paragraph title: Lentiviral expression vector cloning ... NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: Expression vector pSport-1 was double-digested with the same restriction enzymes, and both inserts and pSport-1 linear plasmid were gel-purified using the GENECLEAN Spin Kit (MP Biomedicals). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University.

    Modification:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: During this process, a series of mutations were also introduced, as follows: Asn at aa 332 to introduce an N -linked glycosylation site that allows binding of BG505 gp140 to 2G12 ( ) BnAb; SOSIP ( ); RRRRRR ( ); and various other mutations described under “Results.” A series of modified pcDNA3.1(−) vectors were constructed, each containing the CD5 secretion signal, a linker containing three alanines, and various Strep-tag II and octahistidine tags described under “Results.” Restriction sites NheI and NotI were introduced between the CD5 signal and the alanine linker. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Transformation Assay:

    Article Title: Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito
    Article Snippet: The secondary PCR was performed with nested primer 1 and 2R on 1 μl of the primary PCR products for 15 cycles with an initial denaturation step at 93°C for 1 min, followed by denaturation at 93°C for 15 s, annealing at 68°C for 30 s and extension at 72°C for 90 s, plus a final extension step at 72°C for 7 min. .. Resulting PCR products of the secondary subtractive PCR were purified using the NucleoSpin Extract II kit (Macherey Nagel, Düren, Germany), ligated into the pGEM-T easy vector (Promega, Mannheim, Germany) and transformed into NEB 5-alpha competent E. coli (New England BioLabs, Frankfurt, Germany). .. The library was plated on 2×YT agar plates containing 100 μg/ml ampicillin and incubated at 37°C for 16 h.

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: Reactions were incubated in a thermocycler with the parameters: 1 cycle at 98 °C for 10 s followed by 25 cycles of denaturation at 98 °C for 10 s, annealing at 68 °C for 10 s and extension at 72 °C for 15 s concluding with a final extension cycle at 72 °C for 10 min. Inverse PCR primers used were Forward: TGGCGTAATC ATGGTCATAGC and Reverse: CCCGGGTACC GAGCTCGAAT TC. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions. .. Miniprep DNA was prepared and sequenced using primers 1224 (CGCCAGGGTT TTCCCAGTCA CGAC) and 1233 (AGCGGATAAC AATTTCACAC AGGA).

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: Alternatively, pPICZα A and superfolder-GFP were digested with PmlI and Acc65I and ligated to generate the pPICZα-GFP (pZαGFP) vector. pKANαB and pKANB were a kind gift from Geoff and Joan Lin-Cereghino (University of the Pacific) and along with GFP were digested with PmlI and Acc65 I and Pst I or Acc65 I and ligated to form pKANα-GFP (pKαGFP) and pKAN-GFP (pKGFP), respectively. .. Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs). .. For cloning into P. pastoris 5–10 μg of plasmid DNA was linearized with Pme I at a single restriction site within the AOX1 promoter.

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: The mouse STARS DNA fragment and pFLAG-CMV4 plasmid were digested using the EcoRI and BamHI restriction enzymes (NEB, Ipswich, MA) and subsequently ligated to produce the pFLAG-mSTARS plasmid. .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC). .. Finally, automated sequencing (Applied Genetic Diagnostics, Parkville, VIC) was performed.

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: In each of the following 4 days, 150 ng of destination plasmid pool in 4 μl of TE and 1 μl of the enzyme was added to each reaction and incubated overnight at room temperature to saturate the reaction for each ORF and normalize ORF‐dependent Gateway LR reaction efficiencies. .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics). .. Barcode sequences and ORFs of the entire colonies were then identified by kiloSEQ (seqWell Inc.).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: The secondary PCR products of SSH were inserted into pGEM-T easy vector (Promega, Madison, WI, USA). .. However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK). .. The transformed bacteria were plated onto Luria Agar plates with 100 μg/ml ampicillin, 100 μM IPTG and 50 μg/ml X-Gal, and incubated at 37°C for 18 h, until colonies were visible; the plates were transferred to the refrigerator (4°C) in order to visualize the blue/white staining.

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: The resulting DNA fragment was ligated into pDHBop-ppc* using SpeI and BglII restriction sites. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ). .. Escherichia coli K-12 substr.

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: To complement the PA0180, PA2864, PA3160 and PA3435 transposon mutants, the corresponding genes with their own promoter and terminator were amplified by PCR from the PAO1 genomic DNA using the Q5® High-Fidelity DNA Polymerase and primers listed in . .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli . .. Transformants were selected onto LB agar containing 100 μg/mL ampicillin.

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: Both the PCR product and pTarget GLuc-Δ1D2A vector were digested with XmaI and NotI-HF restriction enzymes (New England BioLabs). .. Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs). .. Plasmids were isolated using a QIAprep Spin Mini-prep kit (Qiagen) and were amplified with primers T7 (TAATACGACTCACTATAGGG) and Seq-R (TTACGCCAAGTTATTTAGGTGACA) for sequencing, and results were analyzed with Sequencher 4.8 software (Genecodes).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202). .. NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid. .. Transformed bacteria were plated on LB + Amp (100 µg/mL) agar plates and incubated at 37 °C overnight.

    Article Title: Identification of potential regulatory mutations using multi-omics analysis and haplotyping of lung adenocarcinoma cell lines
    Article Snippet: Mutant and Wildtype fragment DNAs were inserted into pNL3.1 vector by Quick Ligation Protocol (M2200, New England Biolabs) using NheI-HF (R3131S, New England Biolabs) and HindII-HF (R3104S, New England Biolabs) according to manufacturer instructions (see Supplementary Table for fragment sequences). .. Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions. .. Transfection was done by ViaFectTM Transfection Reagent (E4981, Promega) according to manufacturer instructions with medium to final volume ratio of 4:1.

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: The amino acid exchange R164L was introduced into the gltA gene by site directed PCR mutagenesis using primers gltA_R164L_for and gltA_R164L_rev. .. The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB). .. The resulting plasmid, pACT3-gltAR164L was isolated and verified by DNA sequencing to contain the desired mutation.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: Ligation was performed using T4 DNA ligase according to the manufacturer (New England Biolabs). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University. .. Expression vectors were transformed into E. coli BL21 (DE3)RIL by heat shock.

    Article Title: Overexpression of fetA (ybbL) and fetB (ybbM), Encoding an Iron Exporter, Enhances Resistance to Oxidative Stress in Escherichia coli
    Article Snippet: The plasmid genomic libraries utilized in this study were previously constructed ( ). .. The libraries were methylated in NEB 5-alpha competent E. coli cells (New England BioLabs, Ipswich, MA, USA) and were transformed into E. coli K-12 strain MG1655 to obtain 2.6 × 108 clones with both plasmid libraries. .. A 2% inoculum of a coexisting frozen dual-plasmid library stock was cultured in 125 ml LB medium in a baffled flask to an OD600 of 1.

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: PCR was performed using a high fidelity enzyme ExTaq with the following program: initial heat inactivation = 95 °C, 5 minutes; 16 cycles of heat inactivation [95 °C, 30 seconds]; annealing [Tm , 1 minute], extension [72 °C, 10 minutes]. .. The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility. .. Confirmed sequences were amplified and purified using MidiPrep and expression vectors were tested in chick embryos using in ovo electroporation method.

    Derivative Assay:

    Article Title: A fungal avirulence factor encoded in a highly plastic genomic region triggers partial resistance to septoria tritici blotch
    Article Snippet: The Swiss strains ST99CH_3D1 (3D1) and ST99CH_3D7 (3D7, described by Linde et al ., ) or mutant lines derived from them were used in this study. .. For molecular cloning and plasmid propagation, Escherichia coli strains HST08 (Takara Bio, Shiga, Japan) or NEB 5‐alpha (New England Biolabs, Ipswich, MA, USA) were used.

    Hybridization:

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: Paragraph title: Construction of cDNA library by suppression subtractive hybridization (SSH) ... However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK).

    Electroporation:

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs). .. For cloning into P. pastoris 5–10 μg of plasmid DNA was linearized with Pme I at a single restriction site within the AOX1 promoter.

    Inverse PCR:

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: Reactions were incubated in a thermocycler with the parameters: 1 cycle at 98 °C for 10 s followed by 25 cycles of denaturation at 98 °C for 10 s, annealing at 68 °C for 10 s and extension at 72 °C for 15 s concluding with a final extension cycle at 72 °C for 10 min. Inverse PCR primers used were Forward: TGGCGTAATC ATGGTCATAGC and Reverse: CCCGGGTACC GAGCTCGAAT TC. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions.

    Chromatography:

    Article Title: Strep-tag II fusion technology for the modification and immobilization of lipase B from Candida antarctica (CALB)
    Article Snippet: Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs. .. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs.

    Ligation:

    Article Title: Identification of potential regulatory mutations using multi-omics analysis and haplotyping of lung adenocarcinoma cell lines
    Article Snippet: Mutant and Wildtype fragment DNAs were inserted into pNL3.1 vector by Quick Ligation Protocol (M2200, New England Biolabs) using NheI-HF (R3131S, New England Biolabs) and HindII-HF (R3104S, New England Biolabs) according to manufacturer instructions (see Supplementary Table for fragment sequences). .. Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: Ligation was performed using T4 DNA ligase according to the manufacturer (New England Biolabs). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University.

    Introduce:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: During this process, a series of mutations were also introduced, as follows: Asn at aa 332 to introduce an N -linked glycosylation site that allows binding of BG505 gp140 to 2G12 ( ) BnAb; SOSIP ( ); RRRRRR ( ); and various other mutations described under “Results.” A series of modified pcDNA3.1(−) vectors were constructed, each containing the CD5 secretion signal, a linker containing three alanines, and various Strep-tag II and octahistidine tags described under “Results.” Restriction sites NheI and NotI were introduced between the CD5 signal and the alanine linker. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Generated:

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics). .. An expression plasmid pool of known barcode and ORF combinations was then purified from a pool of the bacterial cells.

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: Mutations were generated by deleting one or four base pairs or core-binding sequences. .. The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility.

    DNA Sequencing:

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: The resulting DNA fragment was ligated into pDHBop-ppc* using SpeI and BglII restriction sites. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ). .. Escherichia coli K-12 substr.

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli . .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli .

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid. .. Transformed bacteria were plated on LB + Amp (100 µg/mL) agar plates and incubated at 37 °C overnight.

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: PCR was performed using a high fidelity enzyme ExTaq with the following program: initial heat inactivation = 95 °C, 5 minutes; 16 cycles of heat inactivation [95 °C, 30 seconds]; annealing [Tm , 1 minute], extension [72 °C, 10 minutes]. .. The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility. .. Confirmed sequences were amplified and purified using MidiPrep and expression vectors were tested in chick embryos using in ovo electroporation method.

    Sequencing:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: The BG505 (BG505.W6M.ENV.C2) ( , ) gp140 envelope sequence was codon-optimized and the optimized sequence was synthesized using the GenArt Strings technology (Life Technologies). .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: Polymerase chain reaction (PCR) using specifically designed primers (Geneworks, Hindmarsh, SA) was performed to amplify the mouse STARS DNA sequence and incorporate the desired restriction enzyme sites, EcoRI, and BamHI. .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC).

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics). .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK). .. The transformed bacteria were plated onto Luria Agar plates with 100 μg/ml ampicillin, 100 μM IPTG and 50 μg/ml X-Gal, and incubated at 37°C for 18 h, until colonies were visible; the plates were transferred to the refrigerator (4°C) in order to visualize the blue/white staining.

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: The forward primer contained an RBS sequence which had been optimized by the RBS calculator web-tool. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ).

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli . .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli .

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid. .. Transformed bacteria were plated on LB + Amp (100 µg/mL) agar plates and incubated at 37 °C overnight.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: The streptavidin tag sequence (bold) was incorporated into the C terminus of bile acid CoA transferases for one-step purification ( ). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University.

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: The deletion of position 235–239 served as a negative control since this region contains no known core-binding sequence. .. The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility.

    Binding Assay:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: During this process, a series of mutations were also introduced, as follows: Asn at aa 332 to introduce an N -linked glycosylation site that allows binding of BG505 gp140 to 2G12 ( ) BnAb; SOSIP ( ); RRRRRR ( ); and various other mutations described under “Results.” A series of modified pcDNA3.1(−) vectors were constructed, each containing the CD5 secretion signal, a linker containing three alanines, and various Strep-tag II and octahistidine tags described under “Results.” Restriction sites NheI and NotI were introduced between the CD5 signal and the alanine linker. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: According to , primers were designed based on the 399 bp sequence of CR2 with deletions that targeted the core-binding site of Brn3/Barx2/Gsh1 (position 91–94) and Dlx2 (position 76–79) as well as the peripheral binding sequence of Brn3/Barx2/Gsh1 (position 95–96). .. The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility.

    DNA Extraction:

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: The mouse STARS DNA fragment and pFLAG-CMV4 plasmid were digested using the EcoRI and BamHI restriction enzymes (NEB, Ipswich, MA) and subsequently ligated to produce the pFLAG-mSTARS plasmid. .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC). .. Finally, automated sequencing (Applied Genetic Diagnostics, Parkville, VIC) was performed.

    Molecular Cloning:

    Article Title: A fungal avirulence factor encoded in a highly plastic genomic region triggers partial resistance to septoria tritici blotch
    Article Snippet: Standard conditions for Z. tritici cultivation consisted of yeast‐sucrose broth (YSB) medium (10 g l−1 yeast extract, 10 g l−1 sucrose, 50 μg ml−1 kanamycin sulfate) at 18°C or yeast‐malt‐sucrose (YMS) medium (4 g l−1 yeast extract, 4 g l−1 malt extract, 4 g l−1 sucrose, 12 g l−1 agar) at 18°C. .. For molecular cloning and plasmid propagation, Escherichia coli strains HST08 (Takara Bio, Shiga, Japan) or NEB 5‐alpha (New England Biolabs, Ipswich, MA, USA) were used. .. Agrobacterium tumefaciens ‐mediated transformation was performed with A. tumefaciens strain AGL1.

    Methylation:

    Article Title: Overexpression of fetA (ybbL) and fetB (ybbM), Encoding an Iron Exporter, Enhances Resistance to Oxidative Stress in Escherichia coli
    Article Snippet: The plasmid genomic libraries utilized in this study were previously constructed ( ). .. The libraries were methylated in NEB 5-alpha competent E. coli cells (New England BioLabs, Ipswich, MA, USA) and were transformed into E. coli K-12 strain MG1655 to obtain 2.6 × 108 clones with both plasmid libraries. .. A 2% inoculum of a coexisting frozen dual-plasmid library stock was cultured in 125 ml LB medium in a baffled flask to an OD600 of 1.

    Mutagenesis:

    Article Title: A fungal avirulence factor encoded in a highly plastic genomic region triggers partial resistance to septoria tritici blotch
    Article Snippet: The Swiss strains ST99CH_3D1 (3D1) and ST99CH_3D7 (3D7, described by Linde et al ., ) or mutant lines derived from them were used in this study. .. For molecular cloning and plasmid propagation, Escherichia coli strains HST08 (Takara Bio, Shiga, Japan) or NEB 5‐alpha (New England Biolabs, Ipswich, MA, USA) were used.

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: In addition, they have the human CD5 secretion signal at the 5′-end, furin cleavage-resistant mutation SEKS at the junction of gp120 and gp41, and FD followed by the hexahistidine tag at the C terminus ( ). .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: The mutant strains were obtained from the P . aeruginosa PAO1 transposon mutant library whose the quality was checked [ ]. .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli .

    Article Title: A generic HTS assay for kinase screening: Validation for the isolation of an engineered malate kinase
    Article Snippet: Unless otherwise specified, all materials were purchased from Sigma-Aldrich (St-Louis, MO). .. NEB 5-α Competent E . coli (New England Biolabs) was used for mutant library construction. .. One shot® E . coli BL21 Star™ (DE3) (Invitrogen) was used to set-up the screening method for library screening and the larger scale production of selected variants.

    Article Title: Identification of potential regulatory mutations using multi-omics analysis and haplotyping of lung adenocarcinoma cell lines
    Article Snippet: Mutant and Wildtype fragment DNAs were inserted into pNL3.1 vector by Quick Ligation Protocol (M2200, New England Biolabs) using NheI-HF (R3131S, New England Biolabs) and HindII-HF (R3104S, New England Biolabs) according to manufacturer instructions (see Supplementary Table for fragment sequences). .. Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions.

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: The amino acid exchange R164L was introduced into the gltA gene by site directed PCR mutagenesis using primers gltA_R164L_for and gltA_R164L_rev. .. The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB).

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: Paragraph title: Site-directed mutagenesis ... The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility.

    Isolation:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: During this process, a series of mutations were also introduced, as follows: Asn at aa 332 to introduce an N -linked glycosylation site that allows binding of BG505 gp140 to 2G12 ( ) BnAb; SOSIP ( ); RRRRRR ( ); and various other mutations described under “Results.” A series of modified pcDNA3.1(−) vectors were constructed, each containing the CD5 secretion signal, a linker containing three alanines, and various Strep-tag II and octahistidine tags described under “Results.” Restriction sites NheI and NotI were introduced between the CD5 signal and the alanine linker. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies). .. The gp140 (and gp120) clones were constructed by either overlap extension PCR ( ) or gene assembly PCR ( ) using appropriate sets of primers.

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: In each of the following 4 days, 150 ng of destination plasmid pool in 4 μl of TE and 1 μl of the enzyme was added to each reaction and incubated overnight at room temperature to saturate the reaction for each ORF and normalize ORF‐dependent Gateway LR reaction efficiencies. .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics). .. Barcode sequences and ORFs of the entire colonies were then identified by kiloSEQ (seqWell Inc.).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK). .. The transformed bacteria were plated onto Luria Agar plates with 100 μg/ml ampicillin, 100 μM IPTG and 50 μg/ml X-Gal, and incubated at 37°C for 18 h, until colonies were visible; the plates were transferred to the refrigerator (4°C) in order to visualize the blue/white staining.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: Plasmids were isolated using the Qiaprep Miniprep Kit (Qiagen) and double-digested with PstI and BamHI (New England Biolabs). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University.

    Subcloning:

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: Subcloning into the pEXT20 vector was achieved using Sal I and Kpn I restriction sites. .. The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB).

    Article Title: Strep-tag II fusion technology for the modification and immobilization of lipase B from Candida antarctica (CALB)
    Article Snippet: Fast digest restriction endonucleases (Esp3I, Hind III, NdeI, Xho I) and T4 DNA ligase enzymes were from Thermo Fisher Scientific. .. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs. .. Anhydrotetracycline hydrochloride, 4-morpholineethanesulfonic (MES) acid monohydrate and MES sodium salt were purchased from Acros Organics.

    Functional Assay:

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli . .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli .

    Purification:

    Article Title: Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito
    Article Snippet: The secondary PCR was performed with nested primer 1 and 2R on 1 μl of the primary PCR products for 15 cycles with an initial denaturation step at 93°C for 1 min, followed by denaturation at 93°C for 15 s, annealing at 68°C for 30 s and extension at 72°C for 90 s, plus a final extension step at 72°C for 7 min. .. Resulting PCR products of the secondary subtractive PCR were purified using the NucleoSpin Extract II kit (Macherey Nagel, Düren, Germany), ligated into the pGEM-T easy vector (Promega, Mannheim, Germany) and transformed into NEB 5-alpha competent E. coli (New England BioLabs, Frankfurt, Germany). .. The library was plated on 2×YT agar plates containing 100 μg/ml ampicillin and incubated at 37°C for 16 h.

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies). .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: The mouse STARS DNA fragment and pFLAG-CMV4 plasmid were digested using the EcoRI and BamHI restriction enzymes (NEB, Ipswich, MA) and subsequently ligated to produce the pFLAG-mSTARS plasmid. .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC). .. Finally, automated sequencing (Applied Genetic Diagnostics, Parkville, VIC) was performed.

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics). .. According to the sequencing result, barcoded clones were selected, re‐arrayed, and incubated overnight on LB+ampicillin plates to reduce the bias in number of different barcodes per each ORF.

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: The resulting PCR fragments were purified (GeneJet Gel Extraction Kit, Thermo) and used in two successive rounds of overlap PCRs to assemble a DNA fragment which contained all three genes, and which was ligated into the XbaI/Xho I digested vector pACT3-ppc*. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ).

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: The PCR product was purified using a PCR purification kit (Qiagen). .. Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs).

    Article Title: Identification of potential regulatory mutations using multi-omics analysis and haplotyping of lung adenocarcinoma cell lines
    Article Snippet: Mutant and Wildtype fragment DNAs were inserted into pNL3.1 vector by Quick Ligation Protocol (M2200, New England Biolabs) using NheI-HF (R3131S, New England Biolabs) and HindII-HF (R3104S, New England Biolabs) according to manufacturer instructions (see Supplementary Table for fragment sequences). .. Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions. .. Transfection was done by ViaFectTM Transfection Reagent (E4981, Promega) according to manufacturer instructions with medium to final volume ratio of 4:1.

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB). .. For construction of vector pACT3w-ppcK620S-gltAR164L, the mutant gltAR164L gene was amplified from the pACT3-gltAR164L plasmid using Phusion polymerase (Biolabs) and primers gltA_R164L_for_1 and gltA_R164L_for_2.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: The streptavidin tag sequence (bold) was incorporated into the C terminus of bile acid CoA transferases for one-step purification ( ). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University.

    Protein Purification:

    Article Title: Strep-tag II fusion technology for the modification and immobilization of lipase B from Candida antarctica (CALB)
    Article Snippet: 2.1 pASG-IBA2 Star Gate Acceptor Vector, Strep-Tactin Superflow (high capacity; 6% crosslinked agarose; 60–160 µm) resin and Strep-tag protein purification buffer set were purchased from IBA Life Sciences. p-nitrophenyl butyrate (p-NPB) was from Sigma. .. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs.

    Polymerase Chain Reaction:

    Article Title: Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito
    Article Snippet: The secondary PCR was performed with nested primer 1 and 2R on 1 μl of the primary PCR products for 15 cycles with an initial denaturation step at 93°C for 1 min, followed by denaturation at 93°C for 15 s, annealing at 68°C for 30 s and extension at 72°C for 90 s, plus a final extension step at 72°C for 7 min. .. Resulting PCR products of the secondary subtractive PCR were purified using the NucleoSpin Extract II kit (Macherey Nagel, Düren, Germany), ligated into the pGEM-T easy vector (Promega, Mannheim, Germany) and transformed into NEB 5-alpha competent E. coli (New England BioLabs, Frankfurt, Germany). .. The library was plated on 2×YT agar plates containing 100 μg/ml ampicillin and incubated at 37°C for 16 h.

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: Reactions were incubated in a thermocycler with the parameters: 1 cycle at 98 °C for 10 s followed by 25 cycles of denaturation at 98 °C for 10 s, annealing at 68 °C for 10 s and extension at 72 °C for 15 s concluding with a final extension cycle at 72 °C for 10 min. Inverse PCR primers used were Forward: TGGCGTAATC ATGGTCATAGC and Reverse: CCCGGGTACC GAGCTCGAAT TC. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions. .. Miniprep DNA was prepared and sequenced using primers 1224 (CGCCAGGGTT TTCCCAGTCA CGAC) and 1233 (AGCGGATAAC AATTTCACAC AGGA).

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: These include, for instance, SOSIP mutations ( , ), stabilizing mutations , enhanced furin cleavage site RRRRRR , and various truncations shown in and described under “Results.” The JRFL gp120 clone was also constructed from the same template by PCR amplification of the appropriate sequence corresponding to gp120. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: The PCR fragments were gel extracted using the Zymoclean™ Gel DNA Recovery kit (Zymo Research Corporation, Irvine, USA). .. Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs).

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: PCR products were separated on a 1.0% agarose gel and the ~1000 base mouse STARS DNA fragment was extracted and purified using the QIAquick Gel extraction Kit (QIAGEN, Doncaster, VIC). .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: The secondary PCR products of SSH were inserted into pGEM-T easy vector (Promega, Madison, WI, USA). .. However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK). .. The transformed bacteria were plated onto Luria Agar plates with 100 μg/ml ampicillin, 100 μM IPTG and 50 μg/ml X-Gal, and incubated at 37°C for 18 h, until colonies were visible; the plates were transferred to the refrigerator (4°C) in order to visualize the blue/white staining.

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: Construction of pDHBop(Mj-asd*)-ppc* and pDHBop(Ec-asd*)-ppc*: TheMj-asd E210Q gene was PCR amplified from pET28-Mj-asd E210Q using Phusion polymerase (Thermo-Scientific) and the forward and reverse primers Mj-asd_clon_for and Mj-asd_clon_rev , respectively. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ).

    Article Title: Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation
    Article Snippet: To complement the PA0180, PA2864, PA3160 and PA3435 transposon mutants, the corresponding genes with their own promoter and terminator were amplified by PCR from the PAO1 genomic DNA using the Q5® High-Fidelity DNA Polymerase and primers listed in . .. The amplified fragments digested by EcoRI and HindIII were cloned into EcoRI/HindIII-digested pUCP20 [ ] and transformed into NEB® 5-alpha Competent Escherichia coli .

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: Both the PCR product and pTarget GLuc-Δ1D2A vector were digested with XmaI and NotI-HF restriction enzymes (New England BioLabs). .. Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs).

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: The amino acid exchange R164L was introduced into the gltA gene by site directed PCR mutagenesis using primers gltA_R164L_for and gltA_R164L_rev. .. The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB). .. The resulting plasmid, pACT3-gltAR164L was isolated and verified by DNA sequencing to contain the desired mutation.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: PCR products were cloned into a pCR8GW TOPO TA vector (Invitrogen) and transformed by heat shock at 42°C into One Shot Chemically competent E. coli that accompanies the vector. .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University.

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: PCR was performed using a high fidelity enzyme ExTaq with the following program: initial heat inactivation = 95 °C, 5 minutes; 16 cycles of heat inactivation [95 °C, 30 seconds]; annealing [Tm , 1 minute], extension [72 °C, 10 minutes]. .. The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility. .. Confirmed sequences were amplified and purified using MidiPrep and expression vectors were tested in chick embryos using in ovo electroporation method.

    Gel Extraction:

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: PCR products were separated on a 1.0% agarose gel and the ~1000 base mouse STARS DNA fragment was extracted and purified using the QIAquick Gel extraction Kit (QIAGEN, Doncaster, VIC). .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC).

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: The resulting PCR fragments were purified (GeneJet Gel Extraction Kit, Thermo) and used in two successive rounds of overlap PCRs to assemble a DNA fragment which contained all three genes, and which was ligated into the XbaI/Xho I digested vector pACT3-ppc*. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ).

    cDNA Library Assay:

    Article Title: Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito
    Article Snippet: Paragraph title: Construction of a subtracted cDNA library using the SSH method ... Resulting PCR products of the secondary subtractive PCR were purified using the NucleoSpin Extract II kit (Macherey Nagel, Düren, Germany), ligated into the pGEM-T easy vector (Promega, Mannheim, Germany) and transformed into NEB 5-alpha competent E. coli (New England BioLabs, Frankfurt, Germany).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: Paragraph title: Construction of cDNA library by suppression subtractive hybridization (SSH) ... However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK).

    Plasmid Preparation:

    Article Title: A fungal avirulence factor encoded in a highly plastic genomic region triggers partial resistance to septoria tritici blotch
    Article Snippet: Standard conditions for Z. tritici cultivation consisted of yeast‐sucrose broth (YSB) medium (10 g l−1 yeast extract, 10 g l−1 sucrose, 50 μg ml−1 kanamycin sulfate) at 18°C or yeast‐malt‐sucrose (YMS) medium (4 g l−1 yeast extract, 4 g l−1 malt extract, 4 g l−1 sucrose, 12 g l−1 agar) at 18°C. .. For molecular cloning and plasmid propagation, Escherichia coli strains HST08 (Takara Bio, Shiga, Japan) or NEB 5‐alpha (New England Biolabs, Ipswich, MA, USA) were used. .. Agrobacterium tumefaciens ‐mediated transformation was performed with A. tumefaciens strain AGL1.

    Article Title: Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito
    Article Snippet: The secondary PCR was performed with nested primer 1 and 2R on 1 μl of the primary PCR products for 15 cycles with an initial denaturation step at 93°C for 1 min, followed by denaturation at 93°C for 15 s, annealing at 68°C for 30 s and extension at 72°C for 90 s, plus a final extension step at 72°C for 7 min. .. Resulting PCR products of the secondary subtractive PCR were purified using the NucleoSpin Extract II kit (Macherey Nagel, Düren, Germany), ligated into the pGEM-T easy vector (Promega, Mannheim, Germany) and transformed into NEB 5-alpha competent E. coli (New England BioLabs, Frankfurt, Germany). .. The library was plated on 2×YT agar plates containing 100 μg/ml ampicillin and incubated at 37°C for 16 h.

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: Reactions were incubated in a thermocycler with the parameters: 1 cycle at 98 °C for 10 s followed by 25 cycles of denaturation at 98 °C for 10 s, annealing at 68 °C for 10 s and extension at 72 °C for 15 s concluding with a final extension cycle at 72 °C for 10 min. Inverse PCR primers used were Forward: TGGCGTAATC ATGGTCATAGC and Reverse: CCCGGGTACC GAGCTCGAAT TC. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions. .. Miniprep DNA was prepared and sequenced using primers 1224 (CGCCAGGGTT TTCCCAGTCA CGAC) and 1233 (AGCGGATAAC AATTTCACAC AGGA).

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: During this process, a series of mutations were also introduced, as follows: Asn at aa 332 to introduce an N -linked glycosylation site that allows binding of BG505 gp140 to 2G12 ( ) BnAb; SOSIP ( ); RRRRRR ( ); and various other mutations described under “Results.” A series of modified pcDNA3.1(−) vectors were constructed, each containing the CD5 secretion signal, a linker containing three alanines, and various Strep-tag II and octahistidine tags described under “Results.” Restriction sites NheI and NotI were introduced between the CD5 signal and the alanine linker. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies). .. The gp140 (and gp120) clones were constructed by either overlap extension PCR ( ) or gene assembly PCR ( ) using appropriate sets of primers.

    Article Title: Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris
    Article Snippet: Alternatively, pPICZα A and superfolder-GFP were digested with PmlI and Acc65I and ligated to generate the pPICZα-GFP (pZαGFP) vector. pKANαB and pKANB were a kind gift from Geoff and Joan Lin-Cereghino (University of the Pacific) and along with GFP were digested with PmlI and Acc65 I and Pst I or Acc65 I and ligated to form pKANα-GFP (pKαGFP) and pKAN-GFP (pKGFP), respectively. .. Vectors were ligated with T4 DNA Ligase (New England Biolabs) and transformed into NEB 5-α competent cells (New England Biolabs).

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: The mouse STARS DNA fragment and pFLAG-CMV4 plasmid were digested using the EcoRI and BamHI restriction enzymes (NEB, Ipswich, MA) and subsequently ligated to produce the pFLAG-mSTARS plasmid. .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC). .. Finally, automated sequencing (Applied Genetic Diagnostics, Parkville, VIC) was performed.

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: In each of the following 4 days, 150 ng of destination plasmid pool in 4 μl of TE and 1 μl of the enzyme was added to each reaction and incubated overnight at room temperature to saturate the reaction for each ORF and normalize ORF‐dependent Gateway LR reaction efficiencies. .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics). .. Barcode sequences and ORFs of the entire colonies were then identified by kiloSEQ (seqWell Inc.).

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: The secondary PCR products of SSH were inserted into pGEM-T easy vector (Promega, Madison, WI, USA). .. However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK).

    Article Title: Construction of a synthetic metabolic pathway for biosynthesis of the non-natural methionine precursor 2,4-dihydroxybutyric acid
    Article Snippet: The resulting DNA fragment was ligated into pDHBop-ppc* using SpeI and BglII restriction sites. .. The resulting plasmid was transformed into NEB 5-alpha competent E. coli cells (NEB) and verified by DNA sequencing. pDHBop(Ec-asd*)-ppc* was constructed analogously using the primers Ec-asd_clon_for and Ec-asd_clon_rev ( ). .. Escherichia coli K-12 substr.

    Article Title: Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development
    Article Snippet: Both the PCR product and pTarget GLuc-Δ1D2A vector were digested with XmaI and NotI-HF restriction enzymes (New England BioLabs). .. Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs).

    Article Title: An activity-dependent proximity ligation platform for spatially resolved quantification of active enzymes in single cells
    Article Snippet: Backbone and insert were ligated using T4 DNA ligase (New England BioLabs, #M0202). .. NEB 5-alpha competent Escherichia coli (high efficiency) cells (New England BioLabs, #C2987I) were transformed with the ligated plasmid. .. Transformed bacteria were plated on LB + Amp (100 µg/mL) agar plates and incubated at 37 °C overnight.

    Article Title: A generic HTS assay for kinase screening: Validation for the isolation of an engineered malate kinase
    Article Snippet: NEB 5-α Competent E . coli (New England Biolabs) was used for mutant library construction. .. One shot® E . coli BL21 Star™ (DE3) (Invitrogen) was used to set-up the screening method for library screening and the larger scale production of selected variants.

    Article Title: Identification of potential regulatory mutations using multi-omics analysis and haplotyping of lung adenocarcinoma cell lines
    Article Snippet: Mutant and Wildtype fragment DNAs were inserted into pNL3.1 vector by Quick Ligation Protocol (M2200, New England Biolabs) using NheI-HF (R3131S, New England Biolabs) and HindII-HF (R3104S, New England Biolabs) according to manufacturer instructions (see Supplementary Table for fragment sequences). .. Transformation was done using 5 Minute Transformation Protocol (C2987H/C2987I) (New England Biolabs) and plasmids were purified by PureLink™ HiPure Plasmid Kits (K2100, Thermo Fisher Scientific) according to instructions. .. Transfection was done by ViaFectTM Transfection Reagent (E4981, Promega) according to manufacturer instructions with medium to final volume ratio of 4:1.

    Article Title: Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid
    Article Snippet: Paragraph title: Plasmid construction ... The PCR product was Dpn I digested and transformed into NEB 5-alpha competent E. coli cells (NEB).

    Article Title: Strep-tag II fusion technology for the modification and immobilization of lipase B from Candida antarctica (CALB)
    Article Snippet: 2.1 pASG-IBA2 Star Gate Acceptor Vector, Strep-Tactin Superflow (high capacity; 6% crosslinked agarose; 60–160 µm) resin and Strep-tag protein purification buffer set were purchased from IBA Life Sciences. p-nitrophenyl butyrate (p-NPB) was from Sigma. .. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs.

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: Ligation was performed using T4 DNA ligase according to the manufacturer (New England Biolabs). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University. .. Expression vectors were transformed into E. coli BL21 (DE3)RIL by heat shock.

    Article Title: Overexpression of fetA (ybbL) and fetB (ybbM), Encoding an Iron Exporter, Enhances Resistance to Oxidative Stress in Escherichia coli
    Article Snippet: The plasmid genomic libraries utilized in this study were previously constructed ( ). .. The libraries were methylated in NEB 5-alpha competent E. coli cells (New England BioLabs, Ipswich, MA, USA) and were transformed into E. coli K-12 strain MG1655 to obtain 2.6 × 108 clones with both plasmid libraries. .. A 2% inoculum of a coexisting frozen dual-plasmid library stock was cultured in 125 ml LB medium in a baffled flask to an OD600 of 1.

    Software:

    Article Title: Characterization of Family D DNA polymerase from Thermococcus sp. 9?N
    Article Snippet: Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions. .. Fidelity PCR products (0.5 pmol) and linear pUC19 vector (0.5 pmol) in 10 µl dH2 0 were mixed with 10 µl 2× Gibson Assembly Master Mix (NEB) and incubated at 50 °C for 15 min. NEB 5-alpha Competent E. coli were transformed with 1 µl of completed assembly reactions.

    Negative Control:

    Article Title: A cis-element in the Notch1 locus is involved in the regulation of gene expression in interneuron progenitors
    Article Snippet: The deletion of position 235–239 served as a negative control since this region contains no known core-binding sequence. .. The PCR product was transformed into NEB5 α competent cells (NEB), colonies were analyzed by cPCR, and their sequences were confirmed at the DNA Sequencing Core Facility.

    Recombinant:

    Article Title: SSH Analysis of Endosperm Transcripts and Characterization of Heat Stress Regulated Expressed Sequence Tags in Bread Wheat
    Article Snippet: However, prior to the insertion, the forward subtracted PCR cDNA mix was incubated at 72°C for an extra 1 h, with additional dATP and Taq DNA polymerase (Invitrogen, Calsbad, USA) to ensure that most of the cDNA fragments contained 3'A overhangs; the recombinants were transformed into NEB 5-alpha competent E. coli cells (NEB, UK). .. The transformed bacteria were plated onto Luria Agar plates with 100 μg/ml ampicillin, 100 μM IPTG and 50 μg/ml X-Gal, and incubated at 37°C for 18 h, until colonies were visible; the plates were transferred to the refrigerator (4°C) in order to visualize the blue/white staining.

    Agarose Gel Electrophoresis:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies). .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Overexpression of Striated Muscle Activator of Rho Signaling (STARS) Increases C2C12 Skeletal Muscle Cell Differentiation
    Article Snippet: PCR products were separated on a 1.0% agarose gel and the ~1000 base mouse STARS DNA fragment was extracted and purified using the QIAquick Gel extraction Kit (QIAGEN, Doncaster, VIC). .. Amplification of pFLAG-mSTARS was achieved by transformation into 5-α Competent E. coli (High Efficiency) cells (NEB, Ipswich, MA) and plasmid DNA extraction and purification was performed using the QIAGEN plasmid kit (QIAGEN, Doncaster, VIC).

    Article Title: Identification and characterization of two bile acid coenzyme A transferases from Clostridium scindens, a bile acid 7?-dehydroxylating intestinal bacterium
    Article Snippet: Ligation was performed using T4 DNA ligase according to the manufacturer (New England Biolabs). .. Ligated vector was transformed into E. coli DH5 (NEB 5α; New England Biolabs) and cultivated in LB medium containing 100 μg/ml ampicillin. pSport vectors containing insert (hereafter referred to as pSportbaiFCTSBP and pSportbaiKCTSBP) as determined by double-digestion and agarose gel electrophoresis were sequenced at the Nucleic Acid Core Facility at Virginia Commonwealth University. .. Expression vectors were transformed into E. coli BL21 (DE3)RIL by heat shock.

    In Vitro:

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: Pools of random barcode fragments were prepared by the protocol described above (primers listed in ) and assembled with SacI‐digested bait or prey destination plasmid DNAs by in vitro DNA assembly. .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics).

    Concentration Assay:

    Article Title: Environmental changes bridge evolutionary valleys
    Article Snippet: MIC testing was performed in NEB 5-alpha cells by growing 1 ml of each culture to be tested overnight in LB broth in the presence of spectinomycin (50 μg/ml). .. MIC testing was performed in NEB 5-alpha cells by growing 1 ml of each culture to be tested overnight in LB broth in the presence of spectinomycin (50 μg/ml).

    DNA Purification:

    Article Title: Pooled‐matrix protein interaction screens using Barcode Fusion Genetics
    Article Snippet: Bacterial strains harboring Gateway entry plasmids for a given ORF space were arrayed on LB–spectinomycin plates using a BioMatrix robot (S & P Robotics), incubated overnight at 37°C, pooled, and harvested for plasmid DNA purification. .. The randomly barcoded bait or prey expression plasmid pool was transformed to NEB 5‐alpha Competent E. coli cells (New England Biolabs), and colonies were isolated and arrayed in 384‐well format on LB+ampicillin plates using a BioMatrix robot (S & P Robotics).

    Strep-tag:

    Article Title: A New Approach to Produce HIV-1 Envelope Trimers
    Article Snippet: During this process, a series of mutations were also introduced, as follows: Asn at aa 332 to introduce an N -linked glycosylation site that allows binding of BG505 gp140 to 2G12 ( ) BnAb; SOSIP ( ); RRRRRR ( ); and various other mutations described under “Results.” A series of modified pcDNA3.1(−) vectors were constructed, each containing the CD5 secretion signal, a linker containing three alanines, and various Strep-tag II and octahistidine tags described under “Results.” Restriction sites NheI and NotI were introduced between the CD5 signal and the alanine linker. .. These plasmid vector DNAs isolated from 5-α competent E. coli cells (New England BioLabs, Inc.) were digested with NheI and NotI and dephosphorylated with FastAP alkaline phosphatase (Life Technologies).

    Article Title: Strep-tag II fusion technology for the modification and immobilization of lipase B from Candida antarctica (CALB)
    Article Snippet: 2.1 pASG-IBA2 Star Gate Acceptor Vector, Strep-Tactin Superflow (high capacity; 6% crosslinked agarose; 60–160 µm) resin and Strep-tag protein purification buffer set were purchased from IBA Life Sciences. p-nitrophenyl butyrate (p-NPB) was from Sigma. .. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs.

    Staining:

    Article Title: Strep-tag II fusion technology for the modification and immobilization of lipase B from Candida antarctica (CALB)
    Article Snippet: Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs. .. Q5 Hot Start High-Fidelity DNA Polymerase, Deoxynucleotide (dNTP) Solution Mix, Shrimp Alkaline phosphatase, NEB® 5-alpha Competent E. coli (Subcloning Efficiency) and NEB® Express Competent E. coli (High Efficiency) cells were purchased from New England Biolabs.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    NEB 5 alpha F Iq Competent E coli High Efficiency 20x0 05 ml
      Buy from Supplier

    99
    New England Biolabs competent e coli cells
    Competent E Coli Cells, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/competent e coli cells/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    competent e coli cells - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs e coli bacteria neb 5 alpha
    E Coli Bacteria Neb 5 Alpha, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bacteria neb 5 alpha/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli bacteria neb 5 alpha - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs coli cells
    Coli Cells, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/coli cells/product/New England Biolabs
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    coli cells - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results