c2925  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
    Name:
    dam dcm Competent E coli
    Description:
    dam dcm Competent E coli 20x0 05 ml
    Catalog Number:
    c2925h
    Price:
    246
    Size:
    1 ml
    Category:
    Competent Bacteria
    		Buy from Supplier

    Structured Review

    New England Biolabs c2925
    dam dcm Competent E coli
    dam dcm Competent E coli 20x0 05 ml
    https://www.bioz.com/result/c2925/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c2925 - by Bioz Stars, 2021-02
    94/100 stars

    Related Products / Commonly Used Together

    edta vacutainer tube
    methylation-deficient e. coli strain
    z. mobilis
    restriction/modification systems

    Images

    Related Articles

    Ligation:

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: .. Ligation product was transformed into dam- /dcm- competent E. coli (NEB C2925H). ..

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    Isolation:

    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. For single colony isolation, transformants grown on the selective plates containing spectinomycin were further streaked on RMG plates with spectinomycin at a final concentration of 200 μg/mL (RMGSp).

    Methylation:

    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. For single colony isolation, transformants grown on the selective plates containing spectinomycin were further streaked on RMG plates with spectinomycin at a final concentration of 200 μg/mL (RMGSp).

    Construct:

    Article Title: Chlamydia trachomatis Encodes a Dynamic, Ring-Forming Bactofilin Critical for Maintaining Cell Size and Shape
    Article Snippet: .. For chlamydial transformation, the constructs were transformed into dam - dcm - competent cells (NEB) and purified as de-methylated constructs. .. To create the mCherry fusion construct, mCherry was amplified from pBOMB-tet-mCherry ( ) and inserted into the expression vector pREF100 ( ) (a kind gift from Dr. Anthony Maurelli).

    Purification:

    Article Title: Chlamydia trachomatis Encodes a Dynamic, Ring-Forming Bactofilin Critical for Maintaining Cell Size and Shape
    Article Snippet: .. For chlamydial transformation, the constructs were transformed into dam - dcm - competent cells (NEB) and purified as de-methylated constructs. .. To create the mCherry fusion construct, mCherry was amplified from pBOMB-tet-mCherry ( ) and inserted into the expression vector pREF100 ( ) (a kind gift from Dr. Anthony Maurelli).

    Plasmid Preparation:

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    Sequencing:

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    other:

    Article Title: Sources of artifact in measurements of 6mA and 4mC abundance in eukaryotic genomic DNA
    Article Snippet: Worms were grown on dam − dcm − bacteria (NEB C2925) on standard NGM plates in all experiments.

    Cell Culture:

    Article Title: Engineered dual selection for directed evolution of SpCas9 PAM specificity
    Article Snippet: .. Microbial strains and growth conditions Except as noted otherwise, E. coli strains XL1-Blue, TOP10, C2925 (dam-/dcm- from NEB), or US0 ΔhisB, ΔpyrF , ΔrpoZ::zeo(Zeo R ), F ′[lacI q Z∆MI5 Tn10(Tet R )] (ref. ) were cultured for 16 h at 37 °C on a roller drum in sterile 14 mL round-bottom Falcon tubes (Corning) containing 5 mL 2xYT broth (Fisher), or for 12–16 h at 37 °C on sterile petri dish plates containing 2xYT/Bacto agar media (2xYT broth granules + Bacto agar powder, Fisher, adjusted to pH 7.0 after dissolution but before autoclaving) supplemented with glucose (2%) after autoclaving. ..

    Polymerase Chain Reaction:

    Article Title: Transcriptomic Profiles of Zymomonas mobilis 8b to Furfural Acute and Long-Term Stress in Both Glucose and Xylose Conditions
    Article Snippet: .. NEB C2925 competent cells (NEB, Ipswich, MA, United States) were used for E. coli transformation, and transformants were confirmed by colony PCR using the primers of 130_SF/SR. .. The gene-specific primers were used to confirm that the targeted genes were cloned into the vector.

    Transformation Assay:

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ). .. The minimum CFTR promoter (372 bp) was inserted into the newly created plasmid by digestion of both the plasmid and the PCR product with EcoRI and AgeI.

    Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure
    Article Snippet: .. Ligation product was transformed into dam- /dcm- competent E. coli (NEB C2925H). ..

    Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars
    Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, C2925 (NEB, MA), for efficient transformation into Z. mobilis 8b or its derivatives. .. For single colony isolation, transformants grown on the selective plates containing spectinomycin were further streaked on RMG plates with spectinomycin at a final concentration of 200 μg/mL (RMGSp).

    Article Title: Chlamydia trachomatis Encodes a Dynamic, Ring-Forming Bactofilin Critical for Maintaining Cell Size and Shape
    Article Snippet: .. For chlamydial transformation, the constructs were transformed into dam - dcm - competent cells (NEB) and purified as de-methylated constructs. .. To create the mCherry fusion construct, mCherry was amplified from pBOMB-tet-mCherry ( ) and inserted into the expression vector pREF100 ( ) (a kind gift from Dr. Anthony Maurelli).

    Article Title: Transcriptomic Profiles of Zymomonas mobilis 8b to Furfural Acute and Long-Term Stress in Both Glucose and Xylose Conditions
    Article Snippet: .. NEB C2925 competent cells (NEB, Ipswich, MA, United States) were used for E. coli transformation, and transformants were confirmed by colony PCR using the primers of 130_SF/SR. .. The gene-specific primers were used to confirm that the targeted genes were cloned into the vector.

    Homologous Recombination:

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • dam dcm competent e coli  (New England Biolabs)
    94
    New England Biolabs dam dcm competent e coli
    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam − <t>/dcm</t> − E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).
    Dam Dcm Competent E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dam dcm competent e coli/product/New England Biolabs
    Average 94 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    dam dcm competent e coli - by Bioz Stars, 2021-02
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam − /dcm − E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).

    Journal: Current protocols in microbiology

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis

    doi: 10.1002/cpmc.31

    Figure Lengend Snippet: Schematic of overall cloning strategy (Basic Protocol 1) used for constructing suicide plasmids. 1. The gene of interest ( ct00X ) is amplified from C. trachomatis L2 genomic DNA with 3 kb of up (us)- and down (ds)-stream homology arm (HR) DNA (steps 1–3). 2. The PCR product is used in an insertion/deletion PCR reaction using pUC18A as template such that the chlamydial DNA sequence replaces plasmid-encoded bla . (steps 4–7). 3. The target gene ( ct00X ) is deleted using Away primers, annealing immediately outside the ct00X coding sequence, in a divergent PCR reaction to amplify the remaining pUC18@ct00X construct. The divergent PCR product is then ligated to the bla and gfp cassette amplified from pUC19G to generate a pUC18 plasmid where ct00X has been replaced by bla-gfp (steps 8–13). 4. The chlamydial DNA required for homologous recombination plus the bla-gfp selection marker is PCR amplified using engineered primers (Step 14). 5. An insertion PCR is used to replace the bla gene in pSuMc with the homologous-recombination construct (steps 15–18). 6. The completed suicide plasmid is propagated in dam − /dcm − E. coli prior to the transformation of chlamydiae outlined in protocol 2 (step 19).

    Article Snippet: pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A.

    Techniques: Clone Assay, Amplification, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Construct, Homologous Recombination, Selection, Marker, Transformation Assay