c2925 (New England Biolabs)


Name:
dam dcm Competent E coli
Description:
dam dcm Competent E coli 20x0 05 ml
Catalog Number:
c2925h
Price:
246
Size:
1 ml
Category:
Competent Bacteria
|
Buy from Supplier |
Structured Review

dam dcm Competent E coli 20x0 05 ml
https://www.bioz.com/result/c2925/product/New England Biolabs
Average 94 stars, based on 1 article reviews
Price from $9.99 to $1999.99
Related Products / Commonly Used Together
Images
Related Articles
Ligation:Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure Article Snippet: .. Ligation product was transformed into dam- Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− Isolation:Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, Methylation:Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, Construct:Article Title: Chlamydia trachomatis Encodes a Dynamic, Ring-Forming Bactofilin Critical for Maintaining Cell Size and Shape Article Snippet: .. For chlamydial transformation, the constructs were transformed into dam - Purification:Article Title: Chlamydia trachomatis Encodes a Dynamic, Ring-Forming Bactofilin Critical for Maintaining Cell Size and Shape Article Snippet: .. For chlamydial transformation, the constructs were transformed into dam - Plasmid Preparation:Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− Sequencing:Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− other:Article Title: Sources of artifact in measurements of 6mA and 4mC abundance in eukaryotic genomic DNA Article Snippet: Worms were grown on dam − Cell Culture:Article Title: Engineered dual selection for directed evolution of SpCas9 PAM specificity Article Snippet: .. Microbial strains and growth conditions Except as noted otherwise, E. coli strains XL1-Blue, TOP10, Polymerase Chain Reaction:Article Title: Transcriptomic Profiles of Zymomonas mobilis 8b to Furfural Acute and Long-Term Stress in Both Glucose and Xylose Conditions Article Snippet: .. Transformation Assay:Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells Article Snippet: .. The two products were then ligated and transformed in Article Title: The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure Article Snippet: .. Ligation product was transformed into dam- Article Title: Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars Article Snippet: .. Due to the presence of restriction/modification systems in Z. mobilis [ ] that can decrease transformation efficiency, all plasmids were built in and isolated from a methylation-deficient E. coli strain, Article Title: Chlamydia trachomatis Encodes a Dynamic, Ring-Forming Bactofilin Critical for Maintaining Cell Size and Shape Article Snippet: .. For chlamydial transformation, the constructs were transformed into dam - Article Title: Transcriptomic Profiles of Zymomonas mobilis 8b to Furfural Acute and Long-Term Stress in Both Glucose and Xylose Conditions Article Snippet: .. Homologous Recombination:Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis Article Snippet: .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− |