bl21  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    BL21 DE3 Competent E coli
    Description:
    BL21 DE3 Competent E coli 20x0 05 ml
    Catalog Number:
    c2527h
    Price:
    204
    Size:
    1 ml
    Category:
    Competent Bacteria
    Buy from Supplier


    Structured Review

    New England Biolabs bl21
    BL21 DE3 Competent E coli
    BL21 DE3 Competent E coli 20x0 05 ml
    https://www.bioz.com/result/bl21/product/New England Biolabs
    Average 95 stars, based on 81 article reviews
    Price from $9.99 to $1999.99
    bl21 - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Protein expression and purification The PDZ domain of human DVL2 wild type (aa 265–361) and phosphorylation-mimicking variant S286E + S329E were cloned into pET vector containing an N-terminal His6 -tag and a lipoyl domain separated by a Tobacco Etch Virus (TEV) protease digestion site from the N-terminus of the inserts. .. Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: .. Purification of Cas12b protein Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). ..

    Article Title: Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment
    Article Snippet: .. Bacterial expression of full-length Sid4 and purification The sid4 + ORF was cloned into pET41 vector and transformed into BL21 (C2527I; New England Biolabs, Inc.) competent Escherichia coli cells together with the pLysS vector ( ). ..

    Article Title: The Biochemical Basis of Vitamin A Production from the Asymmetric Carotenoid β-Cryptoxanthin
    Article Snippet: Murine BCO2 or human BCO1 gene was cloned into a pTrcHis-TOPO expression vector (Invitrogen) using primer sets (BCO1: for, 5’-ATGGATATAATATTTGGCAGGAATAGG-3’ and rev, 5’-GGTCAGAGGAGCCCCGTGGCA-3’; BCO2, for, 5’-ATGTTGGGACCGAAGCAAAGC-3’ and rev, 5’-GATAGGCACAAAGGTGCCATG-3’). .. The plasmids were transformed into BL21 (DE3) competent E. coli (New England BioLabs) using a standard protocol.

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: Paragraph title: Cloning, Site-Directed Mutagenesis, Expression and Purification of Proteins ... E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: Paragraph title: Cloning and expression of recombinant proteins ... The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: .. Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). ..

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: To generate Panx1 C-terminus (Panx1CT)-GST plasmid, Panx1CT sequence (amino acids 299–426) was cloned from the Panx1-EGFP plasmid (forward primer: ACTTTGGAATTCTCGGCAGAAAACGGAC, reverse primer: TGCTATCTCGAGTTAGCAGGACGGAT). .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I).

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: Paragraph title: Cloning and Protein Expression for Decarboxylase RLP ( ) and Transcarboxylase RLP : ... The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media .

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: A cDNA for the full of SOG1 was generated by PCR with PfuTurbo Taq DNA polymerase (Agilent Technologies), cloned into pGEM-T EZ (Promega), and sequenced. .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside.

    Centrifugation:

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media . .. Cells were harvested by centrifugation at 6,500xg and suspended in buffer containing 20 mM HEPES (pH 7.5), 500 mM NaCl, 20 mM imidazole, 0.1% IGEPAL, 20% sucrose, 1 mM β-mercaptoethanol (βME).

    Amplification:

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: The inserted coding region of the corresponding RLPs was sequenced (GENEWIZ) completely to exclude the acquisition of unwanted coding changes during DNA amplification and cloning. .. The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media .

    Construct:

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: Single amino acid substitutions of LdtMt2 (fragment ΔN55) were constructed by site directed mutagenesis as follows. .. E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: Arginine to glycine mutants in the ACD of the DmHsp22WT were constructed by using suitable oligomers (Invitrogen) (Table ) and site-directed mutagenesis. .. The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs).

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Nuclear Magnetic Resonance:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I). .. For the NMR studies, 13 C- and 15 N-labeled proteins were prepared by growing cells in minimal medium supplemented with 15 NH4 Cl (1 g/l) and 13 C6 glucose (2 g/l) as the sole nitrogen and carbon sources, respectively.

    Expressing:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Paragraph title: Protein expression and purification ... Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: .. Purification of Cas12b protein Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). ..

    Article Title: Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment
    Article Snippet: .. Bacterial expression of full-length Sid4 and purification The sid4 + ORF was cloned into pET41 vector and transformed into BL21 (C2527I; New England Biolabs, Inc.) competent Escherichia coli cells together with the pLysS vector ( ). ..

    Article Title: The Biochemical Basis of Vitamin A Production from the Asymmetric Carotenoid β-Cryptoxanthin
    Article Snippet: Paragraph title: Expression of human BCO1 and murine BCO2 in E. coli. ... The plasmids were transformed into BL21 (DE3) competent E. coli (New England BioLabs) using a standard protocol.

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: Paragraph title: Cloning, Site-Directed Mutagenesis, Expression and Purification of Proteins ... E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: TYW1: A radical SAM enzyme involved in the biosynthesis of wybutosine bases
    Article Snippet: Paragraph title: Protocol for Expression of TYW1 Gene ... Co-transform E. coli cell line BL21(DE3) T1 phage resistant (New England Biolabs C2527) with pAY613 and pDB1282.

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: Paragraph title: Cloning and expression of recombinant proteins ... The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: .. Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). ..

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: .. The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media . .. For large-scale protein preparations, 2-liter bacterial cultures were grown in PSAM-5052 auto-induction media supplemented with 100 μg/ml carbenicillin, 100 μg/ml chloramphenicol and 1 ml/l antifoam 204 (Sigma) at 37°C in LEX 48 airlift bioreactors (Epiphyte3, Canada).

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: In brief, BL21 competent Escherichia coli cells (New England Biolabs, Cat#C2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer. .. When the bacterial culture reached an OD600 of 0.6, recombinant protein expression was induced overnight at 25 °C with 0.5 mM IPTG.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Transformation Assay:

    Article Title: Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment
    Article Snippet: .. Bacterial expression of full-length Sid4 and purification The sid4 + ORF was cloned into pET41 vector and transformed into BL21 (C2527I; New England Biolabs, Inc.) competent Escherichia coli cells together with the pLysS vector ( ). ..

    Article Title: The Biochemical Basis of Vitamin A Production from the Asymmetric Carotenoid β-Cryptoxanthin
    Article Snippet: .. The plasmids were transformed into BL21 (DE3) competent E. coli (New England BioLabs) using a standard protocol. .. Transformed bacterial cells were grown in Luria Bertani broth at 37°C with constant shaking until reaching optical density of A600 =0.6.

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs). .. Transformed bacteria were grown in 10 ml LB broth Miller (EMD Chemicals Inc) containing 100 μg/ml ampicillin (Biobasic Canada) at 37 °C overnight.

    Article Title: Analysis of Sry duplications on the Rattus norvegicus Y-chromosome
    Article Snippet: .. Vector was transformed into BL21 (DE3) competent E. coli (NEB). .. A single isolated colony of cells was inoculated into 5 mL terrific broth containing 50 ug/mL Ampicillin and grown to OD600 of 0.8 at 37°C.

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I). .. BL21 E. coli were transformed with plasmids encoding Panx1CT-GST, Crmp2-GST (a generous gift from Dr. Rajesh Khanna, University of Arizona, Tucson, AZ, USA), or GST control plasmid (pGEX-4T-3) according to the manufacturer’s instructions, and grown up overnight on LB agar at 37°C.

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: .. The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media . .. For large-scale protein preparations, 2-liter bacterial cultures were grown in PSAM-5052 auto-induction media supplemented with 100 μg/ml carbenicillin, 100 μg/ml chloramphenicol and 1 ml/l antifoam 204 (Sigma) at 37°C in LEX 48 airlift bioreactors (Epiphyte3, Canada).

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: .. In brief, BL21 competent Escherichia coli cells (New England Biolabs, Cat#C2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer. .. When the bacterial culture reached an OD600 of 0.6, recombinant protein expression was induced overnight at 25 °C with 0.5 mM IPTG.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Article Title: Production of Phosphorylated Ric-8A Proteins using Protein Kinase CK2.
    Article Snippet: .. BL21 (DE3) competent E. coli (NEB) were transformed with plasmids encoding rat Ric-8A amino-terminally tagged with Glutathione S-transferase and a tobacco etch virus (TEV) protease cleavage site (GST-TEV) and selected on LB agar containing carbenicillin (50 μg/mL). .. GST-TEV-Ric-8A cassette was produced by restriction digestion of pFastBac-1 vector harboring the corresponding gene using BamHI and SalI, and was subcloned into the T7 bacterial promoter vector, pET21a (Millipore).

    Chromatography:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I). .. Three purification steps were used for both proteins: Ni-NTA chromatography followed by overnight TEV cleavage to remove the N-terminal His6 -tag and the lipoyl domain, ion exchange chromatography, and size exclusion chromatography.

    Ligation:

    Article Title: Analysis of Sry duplications on the Rattus norvegicus Y-chromosome
    Article Snippet: Electrophoretic mobility shift assays (EMSA) Sry1 DNA was inserted into the pIVEX 2.4 with GoTaq (Promega) PCR using 5’- gcgcccgggctagtggaactggtgct and 5’- gcggcccatggagggccatgtcaag with Nco I and Sma I digests, followed by T4 ligation. .. Vector was transformed into BL21 (DE3) competent E. coli (NEB).

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: DNAs encoding , and were inserted in frame into a T7 promoter based pNYCOMPS23 vector using ligation independent cloning ; the RLP genes were fused to a leader sequence encoding an TEV cleavable C-terminal His10 tag. .. The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media .

    Protease Inhibitor:

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: Purification of Cas12b protein Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). .. Cell paste was resuspended in lysis buffer (50 mM TRIS, pH 8, 500 mM NaCl, 5% glycerol, and 1 mM DTT) supplemented with EDTA-free complete protease inhibitor (Roche).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). .. Cell paste was resuspended in lysis buffer (50 mM TRIS, pH 8, 500 mM NaCl, 5% glycerol, and 1 mM DTT) supplemented with EDTA-free complete protease inhibitor (Roche).

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: In brief, BL21 competent Escherichia coli cells (New England Biolabs, Cat#C2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer. .. Subsequently, cells were lysed in 50 mM HEPES pH7.6, 25 mM MgCl2 , 0.5 M NaCl, 20% glycerol, 0.1% N-P40, 50 mM imidazole, 1 mM phenylmethanesulfonylfluoride (PMSF), and protease inhibitor cocktail without EDTA (Complete Mini protease inhibitor cocktail, Sigma-Aldrich, 11836170001).

    Transferring:

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Cell Culture:

    Article Title: The Biochemical Basis of Vitamin A Production from the Asymmetric Carotenoid β-Cryptoxanthin
    Article Snippet: The plasmids were transformed into BL21 (DE3) competent E. coli (New England BioLabs) using a standard protocol. .. Protein production was induced in the cultured cells with the addition of 0.1 mM isopropyl-1-thio-β-d-galactopyranoside and 5 μM FeSO4 .

    Generated:

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I). .. BL21 E. coli were transformed with plasmids encoding Panx1CT-GST, Crmp2-GST (a generous gift from Dr. Rajesh Khanna, University of Arizona, Tucson, AZ, USA), or GST control plasmid (pGEX-4T-3) according to the manufacturer’s instructions, and grown up overnight on LB agar at 37°C.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: A cDNA for the full of SOG1 was generated by PCR with PfuTurbo Taq DNA polymerase (Agilent Technologies), cloned into pGEM-T EZ (Promega), and sequenced. .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside.

    Sequencing:

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: For each mutagenesis, two separate PCR reactions, each with forward or reverse primer, using NEB high-fidelity buffer was used to amplify the pET28a+ vector carrying wild-type sequence for LdtMt2 (fragment ΔN55). .. E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: The Panx1CT sequence and pGEX-4T-3 plasmid (GE Healthcare Lifesciences, 27-4583) were digested with EcoRI and XhoI, gel purified (Qiagen, 28704), and ligated overnight. .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I).

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: DNAs encoding , and were inserted in frame into a T7 promoter based pNYCOMPS23 vector using ligation independent cloning ; the RLP genes were fused to a leader sequence encoding an TEV cleavable C-terminal His10 tag. .. The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media .

    Sonication:

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Recombinant:

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: Paragraph title: Cloning and expression of recombinant proteins ... The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs).

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I). .. BL21 E. coli were transformed with plasmids encoding Panx1CT-GST, Crmp2-GST (a generous gift from Dr. Rajesh Khanna, University of Arizona, Tucson, AZ, USA), or GST control plasmid (pGEX-4T-3) according to the manufacturer’s instructions, and grown up overnight on LB agar at 37°C.

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: In brief, BL21 competent Escherichia coli cells (New England Biolabs, Cat#C2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer. .. When the bacterial culture reached an OD600 of 0.6, recombinant protein expression was induced overnight at 25 °C with 0.5 mM IPTG.

    Ion Exchange Chromatography:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I). .. Three purification steps were used for both proteins: Ni-NTA chromatography followed by overnight TEV cleavage to remove the N-terminal His6 -tag and the lipoyl domain, ion exchange chromatography, and size exclusion chromatography.

    Mutagenesis:

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: Paragraph title: Cloning, Site-Directed Mutagenesis, Expression and Purification of Proteins ... E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: Arginine to glycine mutants in the ACD of the DmHsp22WT were constructed by using suitable oligomers (Invitrogen) (Table ) and site-directed mutagenesis. .. The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs).

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. In order to generate the mutant forms of MBP-SOG1, SOG1 in the pMAL-C2 vector was mutagenized using the QuikChange II mutagenesis kit (Agilent Technologies) after which candidates were sequenced.

    Isolation:

    Article Title: Analysis of Sry duplications on the Rattus norvegicus Y-chromosome
    Article Snippet: Vector was transformed into BL21 (DE3) competent E. coli (NEB). .. A single isolated colony of cells was inoculated into 5 mL terrific broth containing 50 ug/mL Ampicillin and grown to OD600 of 0.8 at 37°C.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Size-exclusion Chromatography:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I). .. Three purification steps were used for both proteins: Ni-NTA chromatography followed by overnight TEV cleavage to remove the N-terminal His6 -tag and the lipoyl domain, ion exchange chromatography, and size exclusion chromatography.

    Article Title: Acetylation Regulates Thioredoxin Reductase Oligomerization and Activity
    Article Snippet: In an attempt to enhance UAG translation with acK, we expressed TrxR1 variants in an E. coli RF1 deletion strain and in E. coli BL21 (DE3) (C2527H; New England Biolabs, Ipswich, MA). .. Site-specific insertion of Sec relies on the translational read-through and site-specific recoding of the stop codon UGA ( ).

    Electrophoretic Mobility Shift Assay:

    Article Title: Analysis of Sry duplications on the Rattus norvegicus Y-chromosome
    Article Snippet: Paragraph title: Electrophoretic mobility shift assays (EMSA) ... Vector was transformed into BL21 (DE3) competent E. coli (NEB).

    Purification:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Paragraph title: Protein expression and purification ... Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: .. Purification of Cas12b protein Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). ..

    Article Title: Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment
    Article Snippet: .. Bacterial expression of full-length Sid4 and purification The sid4 + ORF was cloned into pET41 vector and transformed into BL21 (C2527I; New England Biolabs, Inc.) competent Escherichia coli cells together with the pLysS vector ( ). ..

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: Paragraph title: Cloning, Site-Directed Mutagenesis, Expression and Purification of Proteins ... E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: Paragraph title: Purification of Cas12b protein ... Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956).

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: The Panx1CT sequence and pGEX-4T-3 plasmid (GE Healthcare Lifesciences, 27-4583) were digested with EcoRI and XhoI, gel purified (Qiagen, 28704), and ligated overnight. .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I).

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: Paragraph title: Purification of His10-SUMO-trimer binding proteins ... In brief, BL21 competent Escherichia coli cells (New England Biolabs, Cat#C2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Polymerase Chain Reaction:

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: For each mutagenesis, two separate PCR reactions, each with forward or reverse primer, using NEB high-fidelity buffer was used to amplify the pET28a+ vector carrying wild-type sequence for LdtMt2 (fragment ΔN55). .. E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: DNA encoding D. melanogaster Hsp22WT was cloned in pETHSUK vector (generously provided by Dr. Stephen D. Weeks, KU Leuven, Belgium) at Hin dIII and Kpn I sites by PCR (TransGen Biotech) (Weeks et al. ) and Gibson assembly (New England Biolabs). .. The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs).

    Article Title: Analysis of Sry duplications on the Rattus norvegicus Y-chromosome
    Article Snippet: Electrophoretic mobility shift assays (EMSA) Sry1 DNA was inserted into the pIVEX 2.4 with GoTaq (Promega) PCR using 5’- gcgcccgggctagtggaactggtgct and 5’- gcggcccatggagggccatgtcaag with Nco I and Sma I digests, followed by T4 ligation. .. Vector was transformed into BL21 (DE3) competent E. coli (NEB).

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: A cDNA for the full of SOG1 was generated by PCR with PfuTurbo Taq DNA polymerase (Agilent Technologies), cloned into pGEM-T EZ (Promega), and sequenced. .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside.

    Positron Emission Tomography:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Protein expression and purification The PDZ domain of human DVL2 wild type (aa 265–361) and phosphorylation-mimicking variant S286E + S329E were cloned into pET vector containing an N-terminal His6 -tag and a lipoyl domain separated by a Tobacco Etch Virus (TEV) protease digestion site from the N-terminus of the inserts. .. Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I).

    Article Title: Acetylation Regulates Thioredoxin Reductase Oligomerization and Activity
    Article Snippet: In an attempt to enhance UAG translation with acK, we expressed TrxR1 variants in an E. coli RF1 deletion strain and in E. coli BL21 (DE3) (C2527H; New England Biolabs, Ipswich, MA). .. We used an E. coli ΔRF1 strain [C321.ΔA.exp, from G. Church ( ) via Addgene strain #49018] that also has all genomic TAG codons mutated to TAA ( ). pET-pylT-GFP, containing sfGFP with an in frame UAG codon at position 2, and pylT as described previously , was used for accessing acK incorporation in E. coli ΔRF1 ( ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: .. In brief, BL21 competent Escherichia coli cells (New England Biolabs, CatC2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer. .. When the bacterial culture reached an OD600 of 0.6, recombinant protein expression was induced overnight at 25 °C with 0.5 mM IPTG.

    SDS Page:

    Article Title: Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment
    Article Snippet: Bacterial expression of full-length Sid4 and purification The sid4 + ORF was cloned into pET41 vector and transformed into BL21 (C2527I; New England Biolabs, Inc.) competent Escherichia coli cells together with the pLysS vector ( ). .. Sid4 was purified from inclusion bodies by separating the proteins of inclusion bodies in a 5-mm-thick 10% acrylamide SDS PAGE gel and excising the protein band corresponding with Sid4 before electroelution into elution buffer (16.8 mM Na2 HPO4 .12H2 O, 11.4 mM NaH2 PO4 .2H2 O, and 0.0288% SDS, pH 7.4).

    Plasmid Preparation:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Protein expression and purification The PDZ domain of human DVL2 wild type (aa 265–361) and phosphorylation-mimicking variant S286E + S329E were cloned into pET vector containing an N-terminal His6 -tag and a lipoyl domain separated by a Tobacco Etch Virus (TEV) protease digestion site from the N-terminus of the inserts. .. Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: .. Purification of Cas12b protein Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). ..

    Article Title: Dialogue between centrosomal entrance and exit scaffold pathways regulates mitotic commitment
    Article Snippet: .. Bacterial expression of full-length Sid4 and purification The sid4 + ORF was cloned into pET41 vector and transformed into BL21 (C2527I; New England Biolabs, Inc.) competent Escherichia coli cells together with the pLysS vector ( ). ..

    Article Title: The Biochemical Basis of Vitamin A Production from the Asymmetric Carotenoid β-Cryptoxanthin
    Article Snippet: Murine BCO2 or human BCO1 gene was cloned into a pTrcHis-TOPO expression vector (Invitrogen) using primer sets (BCO1: for, 5’-ATGGATATAATATTTGGCAGGAATAGG-3’ and rev, 5’-GGTCAGAGGAGCCCCGTGGCA-3’; BCO2, for, 5’-ATGTTGGGACCGAAGCAAAGC-3’ and rev, 5’-GATAGGCACAAAGGTGCCATG-3’). .. The plasmids were transformed into BL21 (DE3) competent E. coli (New England BioLabs) using a standard protocol.

    Article Title: Non-classical transpeptidases yield insight into new antibacterials
    Article Snippet: For each mutagenesis, two separate PCR reactions, each with forward or reverse primer, using NEB high-fidelity buffer was used to amplify the pET28a+ vector carrying wild-type sequence for LdtMt2 (fragment ΔN55). .. E. coli BL21δɛ3 (C2527H, NEB Labs) was used to overproduce proteins as described .

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: DNA encoding D. melanogaster Hsp22WT was cloned in pETHSUK vector (generously provided by Dr. Stephen D. Weeks, KU Leuven, Belgium) at Hin dIII and Kpn I sites by PCR (TransGen Biotech) (Weeks et al. ) and Gibson assembly (New England Biolabs). .. The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: .. Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). ..

    Article Title: Analysis of Sry duplications on the Rattus norvegicus Y-chromosome
    Article Snippet: .. Vector was transformed into BL21 (DE3) competent E. coli (NEB). .. A single isolated colony of cells was inoculated into 5 mL terrific broth containing 50 ug/mL Ampicillin and grown to OD600 of 0.8 at 37°C.

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: The Panx1CT sequence and pGEX-4T-3 plasmid (GE Healthcare Lifesciences, 27-4583) were digested with EcoRI and XhoI, gel purified (Qiagen, 28704), and ligated overnight. .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I).

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: DNAs encoding , and were inserted in frame into a T7 promoter based pNYCOMPS23 vector using ligation independent cloning ; the RLP genes were fused to a leader sequence encoding an TEV cleavable C-terminal His10 tag. .. The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media .

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Article Title: Production of Phosphorylated Ric-8A Proteins using Protein Kinase CK2.
    Article Snippet: BL21 (DE3) competent E. coli (NEB) were transformed with plasmids encoding rat Ric-8A amino-terminally tagged with Glutathione S-transferase and a tobacco etch virus (TEV) protease cleavage site (GST-TEV) and selected on LB agar containing carbenicillin (50 μg/mL). .. GST-TEV-Ric-8A cassette was produced by restriction digestion of pFastBac-1 vector harboring the corresponding gene using BamHI and SalI, and was subcloned into the T7 bacterial promoter vector, pET21a (Millipore).

    Binding Assay:

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I). .. BL21 E. coli were transformed with plasmids encoding Panx1CT-GST, Crmp2-GST (a generous gift from Dr. Rajesh Khanna, University of Arizona, Tucson, AZ, USA), or GST control plasmid (pGEX-4T-3) according to the manufacturer’s instructions, and grown up overnight on LB agar at 37°C.

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: Paragraph title: Purification of His10-SUMO-trimer binding proteins ... In brief, BL21 competent Escherichia coli cells (New England Biolabs, Cat#C2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer.

    In Vitro:

    Article Title: Probenecid Disrupts a Novel Pannexin 1-Collapsin Response Mediator Protein 2 Interaction and Increases Microtubule Stability
    Article Snippet: .. All recombinant proteins for in vitro binding assays were generated in BL21 Escherichia coli ( E. coli ; New England Biolabs, C2527I). .. BL21 E. coli were transformed with plasmids encoding Panx1CT-GST, Crmp2-GST (a generous gift from Dr. Rajesh Khanna, University of Arizona, Tucson, AZ, USA), or GST control plasmid (pGEX-4T-3) according to the manufacturer’s instructions, and grown up overnight on LB agar at 37°C.

    Incubation:

    Article Title: Analysis of Sry duplications on the Rattus norvegicus Y-chromosome
    Article Snippet: Vector was transformed into BL21 (DE3) competent E. coli (NEB). .. Cells were induced with 0.75 mM IPTG and incubated at 37°C for three hours.

    Article Title: Functional assignment of multiple catabolic pathways for D-apiose
    Article Snippet: The resultant plasmids were transformed into E. coli C2527 (DE3) (New England Biolab), which contained an additional pRIL (STRATAGEN) for optimal protein expression and used as pre-cultures grown 37°C overnight in 25 ml selenomethionine containing PSAM media . .. After 6 hours of growth, the temperature of the cultures was increased to 42°C, incubated for 30 min (heat-shock) to activate E. coli chaperon systems for optimal protein folding and then reduced to 22°C for overnight incubation.

    Article Title: The poly-SUMO2/3 protease SENP6 enables assembly of the constitutive centromere-associated network by group deSUMOylation
    Article Snippet: In brief, BL21 competent Escherichia coli cells (New England Biolabs, Cat#C2527I) were transformed with pHIS-TEV30a:His10-ΔN11-SUMO2-trimer. .. The His10-SUMO2-trimer was purified from lysate by incubation with Ni-NTA beads for 3 h at 4 °C.

    Produced:

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Article Title: Production of Phosphorylated Ric-8A Proteins using Protein Kinase CK2.
    Article Snippet: BL21 (DE3) competent E. coli (NEB) were transformed with plasmids encoding rat Ric-8A amino-terminally tagged with Glutathione S-transferase and a tobacco etch virus (TEV) protease cleavage site (GST-TEV) and selected on LB agar containing carbenicillin (50 μg/mL). .. GST-TEV-Ric-8A cassette was produced by restriction digestion of pFastBac-1 vector harboring the corresponding gene using BamHI and SalI, and was subcloned into the T7 bacterial promoter vector, pET21a (Millipore).

    Concentration Assay:

    Article Title: Oligomeric structure and chaperone-like activity of Drosophila melanogaster mitochondrial small heat shock protein Hsp22 and arginine mutants in the alpha-crystallin domain
    Article Snippet: The DmHsp22WT and its arginine mutants were expressed in BL21 (DE3)-competent Escherichia coli (New England Biolabs). .. Protein expression was done at 30 °C for 5 h with isopropyl-β-thiogalactoside (IPTG; Roche Applied Science) at a final concentration of 0.4 mM.

    Lysis:

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: Purification of Cas12b protein Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). .. Cell paste was resuspended in lysis buffer (50 mM TRIS, pH 8, 500 mM NaCl, 5% glycerol, and 1 mM DTT) supplemented with EDTA-free complete protease inhibitor (Roche).

    Article Title: Engineering of CRISPR-Cas12b for human genome editing
    Article Snippet: Cas12b genes were cloned into bacterial expression plasmids (T7-TwinStrep-SUMO-NLS-Cas12b-NLS-3xHA) and expressed in BL21(DE3) cells (NEB #C2527H) containing a pLysS-tRNA plasmid (from Novagen #70956). .. Cell paste was resuspended in lysis buffer (50 mM TRIS, pH 8, 500 mM NaCl, 5% glycerol, and 1 mM DTT) supplemented with EDTA-free complete protease inhibitor (Roche).

    Variant Assay:

    Article Title: Dishevelled-3 conformation dynamics analyzed by FRET-based biosensors reveals a key role of casein kinase 1
    Article Snippet: Protein expression and purification The PDZ domain of human DVL2 wild type (aa 265–361) and phosphorylation-mimicking variant S286E + S329E were cloned into pET vector containing an N-terminal His6 -tag and a lipoyl domain separated by a Tobacco Etch Virus (TEV) protease digestion site from the N-terminus of the inserts. .. Both proteins were expressed at high yields in E. coli BL21 (DE3) strain (New England Biolabs, #C2527I).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs e coli bl21 de3 cells
    E Coli Bl21 De3 Cells, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21 de3 cells/product/New England Biolabs
    Average 90 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 de3 cells - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results