q5 polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Q5 Reaction Buffer Pack
    Description:
    Q5 Reaction Buffer Pack 6 0 ml
    Catalog Number:
    b9027s
    Price:
    28
    Size:
    6 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs q5 polymerase
    Q5 Reaction Buffer Pack
    Q5 Reaction Buffer Pack 6 0 ml
    https://www.bioz.com/result/q5 polymerase/product/New England Biolabs
    Average 95 stars, based on 213 article reviews
    Price from $9.99 to $1999.99
    q5 polymerase - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: In Vitro Structural and Functional Characterization of the Small Heat Shock Proteins (sHSP) of the Cyanophage S-ShM2 and Its Host, Synechococcus sp. WH7803
    Article Snippet: Paragraph title: Genes cloning, protein production and purification ... Amplifications were carried out by mixing 100 ng of shsp DNA template, 0.5 μl of 10 mM dNTP, 2.5 μl of each corresponding primers. (5 μM), 5 μl of Q5® 5X Reaction Buffer (New England Biolabs, Cat. No: B9027S) and 0.25 μl of Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat. No: M0491S).

    Amplification:

    Article Title: Distinct Anaerobic Bacterial Consumers of Cellobiose-Derived Carbon in Boreal Fens with Different CO2/CH4 Production Ratios
    Article Snippet: Paragraph title: Reverse transcription and 16S rRNA gene amplicon sequencing. ... The first-step PCR was carried out in duplicate in 20-μl reaction mixtures containing 1× Q5 reaction buffer, 0.2 mM dinucleoside triphosphates (dNTPs), 0.5 μM primers, 0.4 U of Q5 high-fidelity DNA polymerase (New England BioLabs), and 1 μl of reverse transcription product (diluted if necessary) as the template.

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. Library preparation and sequencing for amplicons The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Article Title: Physically Triggered Morphology Changes in a Novel Acremonium Isolate Cultivated in Precisely Engineered Microfabricated Environments
    Article Snippet: .. DNA was amplified in 50 μl PCR mixtures containing the following final concentrations or total amounts: 100 ng DNA, 1× Q5 reaction buffer, 200 μM dNTPs, 0.5 μM forward primer and 0.5 μM reverse primer, and 0.02 U/μl Q5 High-Fidelity DNA Polymerase (New England BioLabs). ..

    Article Title: Heterosexual Transmission of Subtype C HIV-1 Selects Consensus-Like Variants without Increased Replicative Capacity or Interferon-α Resistance
    Article Snippet: Paragraph title: Viral RNA extraction and PCR amplification ... Both rounds of PCR were performed in 1x Q5 Reaction Buffer, 1x Q5 High GC Enhancer, 0.35 mM of each dNTP, 0.5 μM of primers and 0.02 U/μl of Q5 Hot Star High-Fidelity DNA Polymerase (NEB) in a total reaction volume of 25 μl.

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. FAM-, NED-, VIC-fluorescence-labelled versions of the universal primer were synthetized by Thermo Fisher Scientific.

    Article Title: Methanogens and Iron-Reducing Bacteria: the Overlooked Members of Mercury-Methylating Microbial Communities in Boreal Lakes
    Article Snippet: The PCR program started with an initial 2-min denaturation at 98°C followed by 35 amplification cycles (10 s at 96°C, 30 s 56.5°C, and 45 s at 72°C), and a final 7-min extension at 72°C. .. These PCRs were performed in 20-μl volumes using 1× Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcoded primers, diluted first PCR products, and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) with an initial denaturation of 30 s at 98°C followed by 18 cycles (10 s at 98°C, 30 s at 66°C, and 30 s at 72°C), and a final 2-min extension at 72°C.

    Article Title: In Vitro Structural and Functional Characterization of the Small Heat Shock Proteins (sHSP) of the Cyanophage S-ShM2 and Its Host, Synechococcus sp. WH7803
    Article Snippet: Primers (Invitrogen™ , Carlsbad, CA) used for hspSP-ShM2-pETHSUK and hspS-WH7803-pETHSUK PCR amplification and cloning are listed in . .. Amplifications were carried out by mixing 100 ng of shsp DNA template, 0.5 μl of 10 mM dNTP, 2.5 μl of each corresponding primers. (5 μM), 5 μl of Q5® 5X Reaction Buffer (New England Biolabs, Cat. No: B9027S) and 0.25 μl of Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat. No: M0491S).

    Article Title: Swift Large-scale Examination of Directed Genome Editing
    Article Snippet: .. 50 μl PCR reaction mixes for the amplification of the desired genomic loci were prepared on ice using 1x Q5 reaction buffer, 200 μM dNTPs, 200 μM primer forward and reverse and 0.6 U/μl Q5 polymerase (New England Biolabs). .. 30 PCR cycles were run in all samples except for A . thaliana , C . riparius and D . melanogaster (35 cycles); annealing temperatures, extension times and primer sequences are given and PCR conditions used are listed in .

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: HgcA was first amplified in 50 μL volume with 1x Phusion GC Buffer, 0.2 mM dNTP mix, 5% DMSO, 0.1 μM of each adaptor-linked primer, 7 μg/μL BSA, 4 μL extracted DNA template, and 1.0 U Phusion high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 2 min at 98 °C followed by 35 cycles (10 s at 96 °C, 30 s 56.5 °C and 45 s at 72 °C), and a final extension at 72 °C for 7 min. .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min.

    Article Title: Duplex Proximity Sequencing (Pro-Seq): A method to improve DNA sequencing accuracy without the cost of molecular barcoding redundancy
    Article Snippet: The desired number of genomic template copies for each sample was mixed into a 40 μL droplet reaction mix, containing final concentrations of 0.02 Units/μL of Q5® Hotstart DNA polymerase (NEB), 0.2 mM dNTP (NEB), 1x RDT Droplet Stabilizer (RainDance Technologies), 1x Q5® Reaction Buffer (NEB), 25 nM each gene specific Index 1 forward primer, 25 nM each gene specific Index 2 forward primer, 50 nM each gene specific reverse primer, 400 nM universal reverse primer ( CAAGCAGAAGACGGCATACGAGAT GCGACGGTTAGACGAACGGTACG, IDT) and 200nM of the universal PEG-linked primer ( 3'-AGTCAACGTCGTCTTCTTCCACATCTAGAGCCACCAGCGGCATAGTAA-5'/Sp9/5'-AATGATACGGCGACCACCGAGATCTACACTCCCTCCTATCATGGACAC-3', IDT) ( ). .. Samples were then amplified on a BioRad T100 thermocycler with an initial denaturation at 98 °C for 30 s, 38 cycles at 98 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s followed by a final hold at 4 °C.

    Incubation:

    Article Title: In Vitro Structural and Functional Characterization of the Small Heat Shock Proteins (sHSP) of the Cyanophage S-ShM2 and Its Host, Synechococcus sp. WH7803
    Article Snippet: Amplifications were carried out by mixing 100 ng of shsp DNA template, 0.5 μl of 10 mM dNTP, 2.5 μl of each corresponding primers. (5 μM), 5 μl of Q5® 5X Reaction Buffer (New England Biolabs, Cat. No: B9027S) and 0.25 μl of Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat. No: M0491S). .. Mixtures were incubated 30 s at 98°C followed by 30 cycles of 10 s at 98°C, 30 s at 62°C, 30 s at 72°C and a final elongation period of 2 min at 72°C.

    Article Title: Swift Large-scale Examination of Directed Genome Editing
    Article Snippet: The ‘hammer’ was pre-cleaned by incubation in hypochlorite solution (1:10 dilution of commercial bleach (Danklorix) reagent) for at least 15 minutes followed by 5 minutes rinsing in Milli-Q water. .. 50 μl PCR reaction mixes for the amplification of the desired genomic loci were prepared on ice using 1x Q5 reaction buffer, 200 μM dNTPs, 200 μM primer forward and reverse and 0.6 U/μl Q5 polymerase (New England Biolabs).

    Touchdown PCR:

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. FAM-, NED-, VIC-fluorescence-labelled versions of the universal primer were synthetized by Thermo Fisher Scientific.

    Modification:

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: The protein-coding gene hgcA which plays an essential role in Hg methylation was amplified with previously published hgcA primers (hgcA_ 261 F and hgcA_912R ) (Table , 34) modified for parallelized high-throughput Illumina sequencing. .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min.

    High Performance Liquid Chromatography:

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: HPLC-purified primers carrying Illumina adaptors at the 5′ end (hgcA_261F_Adaptor and hgcA_912R_Adaptor , Table ) were here used for the 1st stage PCR. .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min.

    Generated:

    Article Title: Physically Triggered Morphology Changes in a Novel Acremonium Isolate Cultivated in Precisely Engineered Microfabricated Environments
    Article Snippet: DNA was amplified in 50 μl PCR mixtures containing the following final concentrations or total amounts: 100 ng DNA, 1× Q5 reaction buffer, 200 μM dNTPs, 0.5 μM forward primer and 0.5 μM reverse primer, and 0.02 U/μl Q5 High-Fidelity DNA Polymerase (New England BioLabs). .. The partial sequences were assembled manually and a consensus sequence was generated by using the SeqMan program 7.0.0 (DNASTAR, Madison, WI, United States).

    Article Title: Duplex Proximity Sequencing (Pro-Seq): A method to improve DNA sequencing accuracy without the cost of molecular barcoding redundancy
    Article Snippet: The desired number of genomic template copies for each sample was mixed into a 40 μL droplet reaction mix, containing final concentrations of 0.02 Units/μL of Q5® Hotstart DNA polymerase (NEB), 0.2 mM dNTP (NEB), 1x RDT Droplet Stabilizer (RainDance Technologies), 1x Q5® Reaction Buffer (NEB), 25 nM each gene specific Index 1 forward primer, 25 nM each gene specific Index 2 forward primer, 50 nM each gene specific reverse primer, 400 nM universal reverse primer ( CAAGCAGAAGACGGCATACGAGAT GCGACGGTTAGACGAACGGTACG, IDT) and 200nM of the universal PEG-linked primer ( 3'-AGTCAACGTCGTCTTCTTCCACATCTAGAGCCACCAGCGGCATAGTAA-5'/Sp9/5'-AATGATACGGCGACCACCGAGATCTACACTCCCTCCTATCATGGACAC-3', IDT) ( ). .. Droplets were generated on the RainDrop Source instrument (RainDance Technologies) using ThunderBolts Open Source consumables (RainDance Technologies) as per manufacturer’s specifications.

    DNA Sequencing:

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. Library preparation and sequencing for amplicons The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Sequencing:

    Article Title: Distinct Anaerobic Bacterial Consumers of Cellobiose-Derived Carbon in Boreal Fens with Different CO2/CH4 Production Ratios
    Article Snippet: Paragraph title: Reverse transcription and 16S rRNA gene amplicon sequencing. ... The first-step PCR was carried out in duplicate in 20-μl reaction mixtures containing 1× Q5 reaction buffer, 0.2 mM dinucleoside triphosphates (dNTPs), 0.5 μM primers, 0.4 U of Q5 high-fidelity DNA polymerase (New England BioLabs), and 1 μl of reverse transcription product (diluted if necessary) as the template.

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. Library preparation and sequencing for amplicons The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: Paragraph title: Library preparation and sequencing for amplicons ... The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL.

    Article Title: Physically Triggered Morphology Changes in a Novel Acremonium Isolate Cultivated in Precisely Engineered Microfabricated Environments
    Article Snippet: DNA was amplified in 50 μl PCR mixtures containing the following final concentrations or total amounts: 100 ng DNA, 1× Q5 reaction buffer, 200 μM dNTPs, 0.5 μM forward primer and 0.5 μM reverse primer, and 0.02 U/μl Q5 High-Fidelity DNA Polymerase (New England BioLabs). .. The partial sequences were assembled manually and a consensus sequence was generated by using the SeqMan program 7.0.0 (DNASTAR, Madison, WI, United States).

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: The universal primer sequence CAGTCGGGCGTCATCACAC was added at the 5′ end of each forward primer sequence. .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions.

    Article Title: CRISPR-Cas9 Mediated Genome Editing in Bicyclus anynana Butterflies
    Article Snippet: .. Reagents for sgRNA Synthesis Ultramers 100 mM (Sigma-Aldrich, St. Louis, MO, USA; En1_G1, En1_G2 and CRISPR_R; see for sequence dNTP mix (Promega, Madison, WI, USA; Cat. no.: U1511; NEB, Ipswich, MA, USA; Cat. no.: N0447S) Q5 high fidelity DNA polymerase (NEB; Cat. no.: M0491S) Q5 polymerase buffer 10X (NEB; Cat. no.: B9027S) Molecular grade water (HyPure Molecular Biology Grade Water, HyClone, Thermo Fisher Scientific; Cat. no.: 7732-18-5) Agarose molecular grade (Vivantis, Selangor Darul Ehsan, Malaysia; Cat. no.: PC0701-500g) Trizma base (Sigma-Aldrich; Cat. no.: T1503-500G) EDTA (ThermoFisher Scientific; Cat. no.: 17892) Acetic acid (Sigma-Aldrich; Cat. no.: 64-19-7) SYBRSafe (Invitrogen, Carlsbad, CA, USA; Cat. no.: S33102) GeneJet PCR purification kit (Thermo Fisher Scientific; Cat. no.: K0702) T7 10× buffer (NEB; Cat. no.: M0251S) T7 RNA polymerase (NEB; Cat. no.: M0251S) ATP, GTP, CTP and UTP: 5 µmol (Thermo Fisher Scientific; Cat. nos. .. : 18330-019, 18331-017, 18332-015, and 18333-013) Ribolock RNase inhibitor (Thermo Fisher Scientific; Cat. no.: EO0381) DNA ladder (GeneDireX Kplus, Keelung City, Taiwan, Cat. No: DM011-R500/; Invitrogen 1 Kb and KbPlus DNA ladder, Thermo Fisher Scientific; Cat. nos.

    Article Title: Methanogens and Iron-Reducing Bacteria: the Overlooked Members of Mercury-Methylating Microbial Communities in Boreal Lakes
    Article Snippet: These PCRs were performed in 20-μl volumes using 1× Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcoded primers, diluted first PCR products, and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) with an initial denaturation of 30 s at 98°C followed by 18 cycles (10 s at 98°C, 30 s at 66°C, and 30 s at 72°C), and a final 2-min extension at 72°C. .. The amplicons were then pooled in equimolar concentrations to obtain similar numbers of sequencing reads per sample.

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: In the 2nd stage PCR, standard Illumina handles and barcode primers (Table ) were used to enable pooling of all the samples for parallelized Illumina sequencing. .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min.

    Binding Assay:

    Article Title: Swift Large-scale Examination of Directed Genome Editing
    Article Snippet: 50 μl PCR reaction mixes for the amplification of the desired genomic loci were prepared on ice using 1x Q5 reaction buffer, 200 μM dNTPs, 200 μM primer forward and reverse and 0.6 U/μl Q5 polymerase (New England Biolabs). .. Filter-in-tips were used to transfer nucleic acids from tissue lysate to the PCR mix in the following steps: Binding: pipetting sufficient tissue lysate (here 50 μl) to soak the paper disc and wait ≈10 seconds before releasing the lysate back for storage.

    Nucleic Acid Electrophoresis:

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min. .. The quality and size of the hgcA amplicons were assessed by gel electrophoresis and GelRed visualization on a 1% agarose gel (Invitrogen, USA) prior to purification by Agencourt AMPure XP (Beckman Coulter, USA) after both PCR steps.

    Methylation:

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: The protein-coding gene hgcA which plays an essential role in Hg methylation was amplified with previously published hgcA primers (hgcA_ 261 F and hgcA_912R ) (Table , 34) modified for parallelized high-throughput Illumina sequencing. .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min.

    Mutagenesis:

    Article Title: A combined computational-experimental approach to define the structural origin of antibody recognition of sialyl-Tn, a tumor-associated carbohydrate antigen
    Article Snippet: NEBaseChanger web tool ( http://nebasechanger.neb.com/ ) was used to design the primers for the mutagenesis and the primers are shown in Supplementary Table . .. PCR reaction was performed in Q5 reaction buffer (New England Biolabs B9027S) supplemented with GC enhancer, with 18 ng plasmid DNA as the template, 200 μM each dNTP, 1U Q5 hot start high fidelity DNA polymerase (New England Biolabs M0493L), 500 nM each primer (Supplementary Table ), in a total volume of 40 μl.

    Isolation:

    Article Title: Physically Triggered Morphology Changes in a Novel Acremonium Isolate Cultivated in Precisely Engineered Microfabricated Environments
    Article Snippet: Paragraph title: Molecular Identification and Phylogenetics of Isolated Strain ... DNA was amplified in 50 μl PCR mixtures containing the following final concentrations or total amounts: 100 ng DNA, 1× Q5 reaction buffer, 200 μM dNTPs, 0.5 μM forward primer and 0.5 μM reverse primer, and 0.02 U/μl Q5 High-Fidelity DNA Polymerase (New England BioLabs).

    Article Title: Methanogens and Iron-Reducing Bacteria: the Overlooked Members of Mercury-Methylating Microbial Communities in Boreal Lakes
    Article Snippet: The isolated DNA used for PCR amplification of the 16S rRNA gene was also used in combination with the primer pair 261F/912R. .. These PCRs were performed in 20-μl volumes using 1× Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcoded primers, diluted first PCR products, and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) with an initial denaturation of 30 s at 98°C followed by 18 cycles (10 s at 98°C, 30 s at 66°C, and 30 s at 72°C), and a final 2-min extension at 72°C.

    Multiplex Assay:

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. Library preparation and sequencing for amplicons The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Labeling:

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. The amplified fragments from the subgenome A, B and D homoeologs of the gene X group (or of the gene Y group) were respectively labeled with the FAM, NED and VIC fluorescent dyes in a second PCR reaction using 0.5 µM of a labeled universal primer together with the appropriate homoeolog-specific reverse primer and 1 µL of first reaction PCR product.

    Purification:

    Article Title: Distinct Anaerobic Bacterial Consumers of Cellobiose-Derived Carbon in Boreal Fens with Different CO2/CH4 Production Ratios
    Article Snippet: The first-step PCR was carried out in duplicate in 20-μl reaction mixtures containing 1× Q5 reaction buffer, 0.2 mM dinucleoside triphosphates (dNTPs), 0.5 μM primers, 0.4 U of Q5 high-fidelity DNA polymerase (New England BioLabs), and 1 μl of reverse transcription product (diluted if necessary) as the template. .. The duplicate products were pooled and purified with the Agencourt AMPure XP purification system (Beckman Coulter).

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: Library preparation and sequencing for amplicons The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. .. Column purification of PCR product: All PCR products were purified using DNA Purification Kit (TIANGEN, Beijing, China, Cat. DP214-03).

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. .. Column purification of PCR product: All PCR products were purified using DNA Purification Kit (TIANGEN, Beijing, China, Cat. DP214-03).

    Article Title: CRISPR-Cas9 Mediated Genome Editing in Bicyclus anynana Butterflies
    Article Snippet: .. Reagents for sgRNA Synthesis Ultramers 100 mM (Sigma-Aldrich, St. Louis, MO, USA; En1_G1, En1_G2 and CRISPR_R; see for sequence dNTP mix (Promega, Madison, WI, USA; Cat. no.: U1511; NEB, Ipswich, MA, USA; Cat. no.: N0447S) Q5 high fidelity DNA polymerase (NEB; Cat. no.: M0491S) Q5 polymerase buffer 10X (NEB; Cat. no.: B9027S) Molecular grade water (HyPure Molecular Biology Grade Water, HyClone, Thermo Fisher Scientific; Cat. no.: 7732-18-5) Agarose molecular grade (Vivantis, Selangor Darul Ehsan, Malaysia; Cat. no.: PC0701-500g) Trizma base (Sigma-Aldrich; Cat. no.: T1503-500G) EDTA (ThermoFisher Scientific; Cat. no.: 17892) Acetic acid (Sigma-Aldrich; Cat. no.: 64-19-7) SYBRSafe (Invitrogen, Carlsbad, CA, USA; Cat. no.: S33102) GeneJet PCR purification kit (Thermo Fisher Scientific; Cat. no.: K0702) T7 10× buffer (NEB; Cat. no.: M0251S) T7 RNA polymerase (NEB; Cat. no.: M0251S) ATP, GTP, CTP and UTP: 5 µmol (Thermo Fisher Scientific; Cat. nos. .. : 18330-019, 18331-017, 18332-015, and 18333-013) Ribolock RNase inhibitor (Thermo Fisher Scientific; Cat. no.: EO0381) DNA ladder (GeneDireX Kplus, Keelung City, Taiwan, Cat. No: DM011-R500/; Invitrogen 1 Kb and KbPlus DNA ladder, Thermo Fisher Scientific; Cat. nos.

    Article Title: Methanogens and Iron-Reducing Bacteria: the Overlooked Members of Mercury-Methylating Microbial Communities in Boreal Lakes
    Article Snippet: These PCRs were performed in 20-μl volumes using 1× Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcoded primers, diluted first PCR products, and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) with an initial denaturation of 30 s at 98°C followed by 18 cycles (10 s at 98°C, 30 s at 66°C, and 30 s at 72°C), and a final 2-min extension at 72°C. .. PCR products were then purified using Agencourt AMPure XP (Beckman Coulter, CA, USA) and quantified using PicoGreen according to the instructions from the manufacturer (Invitrogen, Carlsbad, CA, USA).

    Article Title: In Vitro Structural and Functional Characterization of the Small Heat Shock Proteins (sHSP) of the Cyanophage S-ShM2 and Its Host, Synechococcus sp. WH7803
    Article Snippet: Paragraph title: Genes cloning, protein production and purification ... Amplifications were carried out by mixing 100 ng of shsp DNA template, 0.5 μl of 10 mM dNTP, 2.5 μl of each corresponding primers. (5 μM), 5 μl of Q5® 5X Reaction Buffer (New England Biolabs, Cat. No: B9027S) and 0.25 μl of Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat. No: M0491S).

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min. .. The quality and size of the hgcA amplicons were assessed by gel electrophoresis and GelRed visualization on a 1% agarose gel (Invitrogen, USA) prior to purification by Agencourt AMPure XP (Beckman Coulter, USA) after both PCR steps.

    Polymerase Chain Reaction:

    Article Title: Distinct Anaerobic Bacterial Consumers of Cellobiose-Derived Carbon in Boreal Fens with Different CO2/CH4 Production Ratios
    Article Snippet: .. The first-step PCR was carried out in duplicate in 20-μl reaction mixtures containing 1× Q5 reaction buffer, 0.2 mM dinucleoside triphosphates (dNTPs), 0.5 μM primers, 0.4 U of Q5 high-fidelity DNA polymerase (New England BioLabs), and 1 μl of reverse transcription product (diluted if necessary) as the template. .. The duplicate products were pooled and purified with the Agencourt AMPure XP purification system (Beckman Coulter).

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. Library preparation and sequencing for amplicons The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: .. The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. ..

    Article Title: Physically Triggered Morphology Changes in a Novel Acremonium Isolate Cultivated in Precisely Engineered Microfabricated Environments
    Article Snippet: .. DNA was amplified in 50 μl PCR mixtures containing the following final concentrations or total amounts: 100 ng DNA, 1× Q5 reaction buffer, 200 μM dNTPs, 0.5 μM forward primer and 0.5 μM reverse primer, and 0.02 U/μl Q5 High-Fidelity DNA Polymerase (New England BioLabs). ..

    Article Title: A combined computational-experimental approach to define the structural origin of antibody recognition of sialyl-Tn, a tumor-associated carbohydrate antigen
    Article Snippet: .. PCR reaction was performed in Q5 reaction buffer (New England Biolabs B9027S) supplemented with GC enhancer, with 18 ng plasmid DNA as the template, 200 μM each dNTP, 1U Q5 hot start high fidelity DNA polymerase (New England Biolabs M0493L), 500 nM each primer (Supplementary Table ), in a total volume of 40 μl. ..

    Article Title: Fibrin glue as a local drug-delivery system for bacteriophage PA5
    Article Snippet: .. Each PCR reaction (25 µl) contained 5 µl of 5 × Q5 Reaction Buffer, 0.5 units of Q5 High-Fidelity DNA polymerase (New England Biolabs, USA), 200 nM dNTPs, 0.5 µM of each primer, and 2 µl of the phage DNA. .. PCR conditions were as follows: 4 min at 98 °C followed by 35 cycles at 98 °C for 10 s, 66 °C for 30 s, and 72 °C for 40 s. PCR was performed with T100 thermocycler (Bio-Rad, USA).

    Article Title: Heterosexual Transmission of Subtype C HIV-1 Selects Consensus-Like Variants without Increased Replicative Capacity or Interferon-α Resistance
    Article Snippet: .. Both rounds of PCR were performed in 1x Q5 Reaction Buffer, 1x Q5 High GC Enhancer, 0.35 mM of each dNTP, 0.5 μM of primers and 0.02 U/μl of Q5 Hot Star High-Fidelity DNA Polymerase (NEB) in a total reaction volume of 25 μl. ..

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: .. The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions. .. FAM-, NED-, VIC-fluorescence-labelled versions of the universal primer were synthetized by Thermo Fisher Scientific.

    Article Title: CRISPR-Cas9 Mediated Genome Editing in Bicyclus anynana Butterflies
    Article Snippet: .. Reagents for sgRNA Synthesis Ultramers 100 mM (Sigma-Aldrich, St. Louis, MO, USA; En1_G1, En1_G2 and CRISPR_R; see for sequence dNTP mix (Promega, Madison, WI, USA; Cat. no.: U1511; NEB, Ipswich, MA, USA; Cat. no.: N0447S) Q5 high fidelity DNA polymerase (NEB; Cat. no.: M0491S) Q5 polymerase buffer 10X (NEB; Cat. no.: B9027S) Molecular grade water (HyPure Molecular Biology Grade Water, HyClone, Thermo Fisher Scientific; Cat. no.: 7732-18-5) Agarose molecular grade (Vivantis, Selangor Darul Ehsan, Malaysia; Cat. no.: PC0701-500g) Trizma base (Sigma-Aldrich; Cat. no.: T1503-500G) EDTA (ThermoFisher Scientific; Cat. no.: 17892) Acetic acid (Sigma-Aldrich; Cat. no.: 64-19-7) SYBRSafe (Invitrogen, Carlsbad, CA, USA; Cat. no.: S33102) GeneJet PCR purification kit (Thermo Fisher Scientific; Cat. no.: K0702) T7 10× buffer (NEB; Cat. no.: M0251S) T7 RNA polymerase (NEB; Cat. no.: M0251S) ATP, GTP, CTP and UTP: 5 µmol (Thermo Fisher Scientific; Cat. nos. .. : 18330-019, 18331-017, 18332-015, and 18333-013) Ribolock RNase inhibitor (Thermo Fisher Scientific; Cat. no.: EO0381) DNA ladder (GeneDireX Kplus, Keelung City, Taiwan, Cat. No: DM011-R500/; Invitrogen 1 Kb and KbPlus DNA ladder, Thermo Fisher Scientific; Cat. nos.

    Article Title: Methanogens and Iron-Reducing Bacteria: the Overlooked Members of Mercury-Methylating Microbial Communities in Boreal Lakes
    Article Snippet: .. These PCRs were performed in 20-μl volumes using 1× Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcoded primers, diluted first PCR products, and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) with an initial denaturation of 30 s at 98°C followed by 18 cycles (10 s at 98°C, 30 s at 66°C, and 30 s at 72°C), and a final 2-min extension at 72°C. .. PCR products were then purified using Agencourt AMPure XP (Beckman Coulter, CA, USA) and quantified using PicoGreen according to the instructions from the manufacturer (Invitrogen, Carlsbad, CA, USA).

    Article Title: In Vitro Structural and Functional Characterization of the Small Heat Shock Proteins (sHSP) of the Cyanophage S-ShM2 and Its Host, Synechococcus sp. WH7803
    Article Snippet: Primers (Invitrogen™ , Carlsbad, CA) used for hspSP-ShM2-pETHSUK and hspS-WH7803-pETHSUK PCR amplification and cloning are listed in . .. Amplifications were carried out by mixing 100 ng of shsp DNA template, 0.5 μl of 10 mM dNTP, 2.5 μl of each corresponding primers. (5 μM), 5 μl of Q5® 5X Reaction Buffer (New England Biolabs, Cat. No: B9027S) and 0.25 μl of Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat. No: M0491S).

    Article Title: Swift Large-scale Examination of Directed Genome Editing
    Article Snippet: .. 50 μl PCR reaction mixes for the amplification of the desired genomic loci were prepared on ice using 1x Q5 reaction buffer, 200 μM dNTPs, 200 μM primer forward and reverse and 0.6 U/μl Q5 polymerase (New England Biolabs). .. 30 PCR cycles were run in all samples except for A . thaliana , C . riparius and D . melanogaster (35 cycles); annealing temperatures, extension times and primer sequences are given and PCR conditions used are listed in .

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min. .. The quality and size of the hgcA amplicons were assessed by gel electrophoresis and GelRed visualization on a 1% agarose gel (Invitrogen, USA) prior to purification by Agencourt AMPure XP (Beckman Coulter, USA) after both PCR steps.

    CRISPR:

    Article Title: CRISPR-Cas9 Mediated Genome Editing in Bicyclus anynana Butterflies
    Article Snippet: .. Reagents for sgRNA Synthesis Ultramers 100 mM (Sigma-Aldrich, St. Louis, MO, USA; En1_G1, En1_G2 and CRISPR_R; see for sequence dNTP mix (Promega, Madison, WI, USA; Cat. no.: U1511; NEB, Ipswich, MA, USA; Cat. no.: N0447S) Q5 high fidelity DNA polymerase (NEB; Cat. no.: M0491S) Q5 polymerase buffer 10X (NEB; Cat. no.: B9027S) Molecular grade water (HyPure Molecular Biology Grade Water, HyClone, Thermo Fisher Scientific; Cat. no.: 7732-18-5) Agarose molecular grade (Vivantis, Selangor Darul Ehsan, Malaysia; Cat. no.: PC0701-500g) Trizma base (Sigma-Aldrich; Cat. no.: T1503-500G) EDTA (ThermoFisher Scientific; Cat. no.: 17892) Acetic acid (Sigma-Aldrich; Cat. no.: 64-19-7) SYBRSafe (Invitrogen, Carlsbad, CA, USA; Cat. no.: S33102) GeneJet PCR purification kit (Thermo Fisher Scientific; Cat. no.: K0702) T7 10× buffer (NEB; Cat. no.: M0251S) T7 RNA polymerase (NEB; Cat. no.: M0251S) ATP, GTP, CTP and UTP: 5 µmol (Thermo Fisher Scientific; Cat. nos. .. : 18330-019, 18331-017, 18332-015, and 18333-013) Ribolock RNase inhibitor (Thermo Fisher Scientific; Cat. no.: EO0381) DNA ladder (GeneDireX Kplus, Keelung City, Taiwan, Cat. No: DM011-R500/; Invitrogen 1 Kb and KbPlus DNA ladder, Thermo Fisher Scientific; Cat. nos.

    Plasmid Preparation:

    Article Title: A combined computational-experimental approach to define the structural origin of antibody recognition of sialyl-Tn, a tumor-associated carbohydrate antigen
    Article Snippet: .. PCR reaction was performed in Q5 reaction buffer (New England Biolabs B9027S) supplemented with GC enhancer, with 18 ng plasmid DNA as the template, 200 μM each dNTP, 1U Q5 hot start high fidelity DNA polymerase (New England Biolabs M0493L), 500 nM each primer (Supplementary Table ), in a total volume of 40 μl. ..

    Article Title: In Vitro Structural and Functional Characterization of the Small Heat Shock Proteins (sHSP) of the Cyanophage S-ShM2 and Its Host, Synechococcus sp. WH7803
    Article Snippet: Genes were amplified by PCR for subsequent insertion into pETHSUK vector (generously provided by Dr Stephen D. Weeks, KU Leuven, Belgium) via Gibson assembly® (New England Biolabs, Cat No: E5510S). .. Amplifications were carried out by mixing 100 ng of shsp DNA template, 0.5 μl of 10 mM dNTP, 2.5 μl of each corresponding primers. (5 μM), 5 μl of Q5® 5X Reaction Buffer (New England Biolabs, Cat. No: B9027S) and 0.25 μl of Q5® High-Fidelity DNA Polymerase (New England Biolabs, Cat. No: M0491S).

    RNA Extraction:

    Article Title: Heterosexual Transmission of Subtype C HIV-1 Selects Consensus-Like Variants without Increased Replicative Capacity or Interferon-α Resistance
    Article Snippet: Paragraph title: Viral RNA extraction and PCR amplification ... Both rounds of PCR were performed in 1x Q5 Reaction Buffer, 1x Q5 High GC Enhancer, 0.35 mM of each dNTP, 0.5 μM of primers and 0.02 U/μl of Q5 Hot Star High-Fidelity DNA Polymerase (NEB) in a total reaction volume of 25 μl.

    Agarose Gel Electrophoresis:

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min. .. The quality and size of the hgcA amplicons were assessed by gel electrophoresis and GelRed visualization on a 1% agarose gel (Invitrogen, USA) prior to purification by Agencourt AMPure XP (Beckman Coulter, USA) after both PCR steps.

    Transgenic Assay:

    Article Title: An optimised CRISPR/Cas9 protocol to create targeted mutations in homoeologous genes and an efficient genotyping protocol to identify edited events in wheat
    Article Snippet: Paragraph title: Genotyping of transgenic wheat to identify editing events in TaNFXL1 homoeologous genes ... The primers were used for a first, touchdown PCR using Q5 Reaction Buffer (New England BioLab Inc.), 0.2 mM dNTPs, 0.5 µM each of homoeolog-specific forward and reverse primers, 0.2 U of Q5 High-Fidelity DNA polymerase (New England BioLab Inc) and 240 ng genomic DNA from individual T1 progeny in a 10 µL final volume, with the following amplification conditions: denaturation at 98 °C for 3 min followed by 10 cycles of 98 °C for 10 s, 68 °C (with gradual 1 °C per cycle temperature reduction until it reached 58 °C) for 30 s, 72 °C for 30 s; followed by 30 cycles of 98 °C for 10 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 5 min. PCR products were cleaned up by mixing 3 μL of a PCR reaction product with 1 μL of ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific) and proceeding as per manufacturer’s instructions.

    Concentration Assay:

    Article Title: Distinct Anaerobic Bacterial Consumers of Cellobiose-Derived Carbon in Boreal Fens with Different CO2/CH4 Production Ratios
    Article Snippet: The first-step PCR was carried out in duplicate in 20-μl reaction mixtures containing 1× Q5 reaction buffer, 0.2 mM dinucleoside triphosphates (dNTPs), 0.5 μM primers, 0.4 U of Q5 high-fidelity DNA polymerase (New England BioLabs), and 1 μl of reverse transcription product (diluted if necessary) as the template. .. The second PCR step with barcoded primers (forward, AATGATACGGCGACCACCGAGATCTACAC-[index]-ACACTCTTTCCCTACACGACG; reverse, CAAGCAGAAGACGGCATACGAGAT-[index]-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), which bind to the first-step adapters and incorporate Illumina adapters, was carried out using 1 μl of the first product (dilution 1:1 to 1:50 depending on concentration) as the template with 0.1 μM primers, annealing temperature of 66°C, and 12 to 17 cycles.

    Article Title: Swift Large-scale Examination of Directed Genome Editing
    Article Snippet: 50 μl PCR reaction mixes for the amplification of the desired genomic loci were prepared on ice using 1x Q5 reaction buffer, 200 μM dNTPs, 200 μM primer forward and reverse and 0.6 U/μl Q5 polymerase (New England Biolabs). .. Washing: 1 washing step by brief up and down pipetting in Milli-Q water, the higher the concentration of SDS the more washing steps are required, i.e. for 1% or higher SDS containing buffers, 4 washing steps are advised.

    DNA Purification:

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: Library preparation and sequencing for amplicons The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. .. Column purification of PCR product: All PCR products were purified using DNA Purification Kit (TIANGEN, Beijing, China, Cat. DP214-03).

    Article Title: Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells
    Article Snippet: The detailed protocol of target deep DNA sequencing was as follows: A. Multiplex PCR amplification: The 128 amplicons were amplified by multiplex PCR on Veriti 96-well Thermal Cycler (Applied Biosystems, Waltham, MA, USA), which was performed using 30 ng genomic DNA, 15 μL Primer mix/pool (2 pools in total), 10 μL Q5 reaction buffer (NEB, Ipswich, MA, USA, Cat. B9027S), 10 μL Q5 high GC enhancer (NEB, Cat. B9028A), 1.5 μL dNTPs mix (NEB, Cat. N0447S), 0.5 μL Q5 high-fidelity DNA polymerase (NEB, Cat. M0491L), and ddH2 O to make the final reaction volume to 50 μL. .. Column purification of PCR product: All PCR products were purified using DNA Purification Kit (TIANGEN, Beijing, China, Cat. DP214-03).

    High Throughput Screening Assay:

    Article Title: Mercury methylating microbial communities of boreal forest soils
    Article Snippet: The protein-coding gene hgcA which plays an essential role in Hg methylation was amplified with previously published hgcA primers (hgcA_ 261 F and hgcA_912R ) (Table , 34) modified for parallelized high-throughput Illumina sequencing. .. Reactions were carried out in 20 μL volumes using 1x Q5 reaction buffer, 0.2 mM dNTP mix, 0.1 μM barcode primers, purified 1st PCR products and 1.0 U Q5 high fidelity DNA polymerase (NEB, UK) for an initial denaturation of 30 s at 98 °C followed by 18 cycles (10 s at 98 °C, 30 s 66 °C and 30 s at 72 °C), and a final extension at 72 °C for 2 min.

    Lysis:

    Article Title: Swift Large-scale Examination of Directed Genome Editing
    Article Snippet: For M . musculus ear clip and embryonic stem cell samples 1% SDS lysis buffer was used (0.1 M Tris-HCl pH 8.0, 5 mM EDTA pH 8.0, 0.2 M NaCl, 1% SDS in Milli-Q water). .. 50 μl PCR reaction mixes for the amplification of the desired genomic loci were prepared on ice using 1x Q5 reaction buffer, 200 μM dNTPs, 200 μM primer forward and reverse and 0.6 U/μl Q5 polymerase (New England Biolabs).

    Cross-linking Immunoprecipitation:

    Article Title: Swift Large-scale Examination of Directed Genome Editing
    Article Snippet: For M . musculus ear clip and embryonic stem cell samples 1% SDS lysis buffer was used (0.1 M Tris-HCl pH 8.0, 5 mM EDTA pH 8.0, 0.2 M NaCl, 1% SDS in Milli-Q water). .. 50 μl PCR reaction mixes for the amplification of the desired genomic loci were prepared on ice using 1x Q5 reaction buffer, 200 μM dNTPs, 200 μM primer forward and reverse and 0.6 U/μl Q5 polymerase (New England Biolabs).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs q5 polymerase
    Q5 Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 183 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 polymerase/product/New England Biolabs
    Average 90 stars, based on 183 article reviews
    Price from $9.99 to $1999.99
    q5 polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results