reaction buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 Reaction Buffer Pack
    Description:
    Q5 Reaction Buffer Pack 6 0 ml
    Catalog Number:
    b9027s
    Price:
    28
    Category:
    Buffers
    Size:
    6 0 ml
    Buy from Supplier


    Structured Review

    New England Biolabs reaction buffer
    Q5 Reaction Buffer Pack
    Q5 Reaction Buffer Pack 6 0 ml
    https://www.bioz.com/result/reaction buffer/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    reaction buffer - by Bioz Stars, 2021-03
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Antigen receptor repertoires of one of the smallest known vertebrates
    Article Snippet: In this way, a total of approximately one-third of the original total RNA material per fish was subjected to analysis. .. The first round of PCR amplification was carried out in multiplex manner: 1× Q5 buffer, 0.5 mM deoxynucleoside triphosphate (dNTP), 0.2 μM UPM_S primer (5′-CTAATACGACTCACTATAGGGC), 0.04 μM UPM_L primer (5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT), and 0.2 μM of each gene-specific primer (GSP), 2 μl of cDNA, water to 49.5 μl, 0.5 μl of Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs); 98°C for 90 s followed by 23 cycles of 98°C for 10 s, 65°C for 20 s, and 72°C for 45 s, followed by 8-min final extension at 72°C. ..

    Article Title: The First Report of Biallelic Missense Mutations in the SFRP4 Gene Causing Pyle Disease in Two Siblings
    Article Snippet: Primers for amplification and sequencing were designed for the region of 460 bp using Primer-BLAST software ( ). .. The PCR was performed in a total volume of 25 μl using the containing 5 μl of Q5® Reaction Buffer (New England Biolabs, NEB), 5 μl of Q5® High GC Enhancer (NEB), 1.25 μl of forward (5’ CCTCCTACAAGCCTCAGACG 3’) and reverse primer (5’ ACATGCCCTGGAACATCACG 3’) each (10 μmol/l), 0.5 μl of dNTP mix (10 μmol/l each), 0.25 μl of Q5® High-Fidelity DNA Polymerase (NEB), 2 μl of genomic DNA (50 ng/μl) and 9.75 μl of deionized water. .. PCR conditions were as follows: initial denaturation at 98°C for 30 s followed by 35 cycles (denaturation at 98°C for 10 s, annealing at 58°C for 20 s, elongation at 72°C for 20 s) and final elongation at 72°C for 5 min. Sequencing of PCR products was carried out using dye-terminator chemistry (kit v.3, ABI 3130XL) and run on automated sequencer ABI Prism 3700 DNA Analyzer (Applied Biosystems).

    Article Title: Effects of Naturally Occurring Mutations in Bovine Leukemia Virus 5′-LTR and Tax Gene on Viral Transcriptional Activity
    Article Snippet: PCR Amplification of LTR and tax Sequences To construct luciferase-based reporter plasmids containing observed mutations in LTR regulatory elements, an overlap extension PCR was used to amplify each particular LTR variant. .. The first round of PCR allowed for the amplification of two sequences encompassing the LTR: a 5’-end fragment of 979 bp and 3’-end fragment of 571 bp were generated using Q5 High-Fidelity DNA Polymerase and Q5 Reaction Buffer (New England BioLabs, MA, USA) at the following thermal conditions: 30 s at 98 °C, 40 cycles (10 s at 98 °C, 45 s at 65 °C (5’-end fragment) or 52 °C (3’-end fragment), 1 min at 72 °C), and 7 min at 72 °C. .. The resulting amplicons were subjected to a second PCR using P8169 and P520 oligonucleotides described in and Q5 High-Fidelity DNA Polymerase (New England BioLabs, MA, USA), as described above.

    Article Title: Sequencing DNA for the oxidatively modified base 8-oxo-7,8-dihydroguanine
    Article Snippet: PCR thermal cycler Sanger sequencing facility .. Fpg (8,000 units/mL; New England Biolabs) Endo IV (10,000 units/mL; New England Biolabs) T4 DNA ligase (400,000 units/mL; New England Biolabs) Reaction buffer (25 mM HEPES pH 7.5, 10 mM MgCl2 , 5 mM KCl, and 1 mM EDTA) ATP (2 mM stock in ddH2 O; New England Biolabs) dNaMTP (500 μM stock in ddH2 O) d5SICSTP (500 μM stock in ddH2 O) dMMO2SSBIO TP (500 μM stock in ddH2 O) One Taq ® DNA Polymerase (5,000 units/mL; New England Biolabs) Klenow fragment deficient in exonucease activity (5,000 units/mL; New England Biolabs) dNTP solution mix (10 mM of each dNTP; New England Biolabs) PCR primers (forward and reverse in 8 μM solutions) ddH2 O (autoclaved) DMSO DTT (300 mM stock in ddH2 O) TAE buffer (1× = 40 mM Tris, 20 mM acetic acid, and 1 mM EDTA) Agarose Zymoclean™ Gel DNA Recovery kit Ethidium bromide (10 mg/mL) Streptavidin-coated magnetic beads .. This procedure can be implemented on linear DNA duplexes or plasmid DNA.

    Article Title: Diarrheagenic pathogens in adults attending a hospital in Singapore
    Article Snippet: The same samples were also screened for Aeromonas spp., Campylobacter spp., Salmonella spp. and Listeria monocytogenes using in-house singleplex PCR assays with published primers (Table ). .. In each singleplex PCR, 5 μl of the sample DNA were added to a master-mix consisting of 1X Q5 reaction buffer (New England Biolabs, Massachusetts), 200 μM of dNTPs (1st BASE, Singapore), 0.5 μM of the respective forward and reverse primer (Integrated DNA Technologies, Singapore), 1U of Q5 Hot Start High Fidelity DNA polymerase (New England Biolabs, Massachusetts) and nuclease free water to attain a final volume of 50 μl. .. For the screening of Aeromonas spp, Campylobacter spp. and Salmonella spp., amplification was conducted in a thermal cycler (ABI Systems GeneAmp PCR system 9700) with the following temperature ramping: 98 °C for 30 s, followed by 35 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 30 s, and finally 72 °C for 10 min. For the screening of L. monocytogenes, the following temperature ramping was performed: 98 °C for 30 s, followed by 35 cycles of 98 °C for 10 s, 61 °C for 30 s, 72 °C for 30 s, and finally 72 °C for 10 min. All PCR amplified product sizes were analysed using QIAxcel DNA screening kit (Qiagen, Hilden).

    Article Title: Effects of Probiotic Bacillus as an Alternative of Antibiotics on Digestive Enzymes Activity and Intestinal Integrity of Piglets
    Article Snippet: The PCR program initially started with 94°C for 2 min; 94°C for 20 s, 52°C for 40 s and 72°C for 1 min, 72°C for 2 min, repeat for 30 cycles; 72°C 2 min; stored in 4°C. .. The PCR reaction system which was used to add specific tags sequence was 20 μL, containing 1 × reaction buffer (NEB Q5TM), 0.3 mM dNTP, 0.25 M of each primer, 1 U Q5TM DNA polymerase (NEB) and l μL of diluted template. .. The PCR condition were 98°C for 30 s; 94°C for 10 s, 65°C for 30 s and 72°C for 30 s, repeat for 30 cycles; 72°C for 5 min. PCR product was excised from a 1.5% agarose gel, purified by QIAquick Gel Extraction Kit (QIAGEN, cat# 28706) and quantified by UV-Vis spectrophotometer (NanoDrop ND1000, United States).

    Article Title: A broadly applicable COI primer pair and an efficient single‐tube amplicon library preparation protocol for metabarcoding. A broadly applicable COI primer pair and an efficient single‐tube amplicon library preparation protocol for metabarcoding
    Article Snippet: .. PCR conditions were standardized for all primer combinations and performed in a reaction mix containing 1.5 μl DNA extract, 0.5 μl bovine serum albumin (BSA; 10 mg/ml), 1 μl of each primer (10 μM), 1 μl dNTP (2 mM), 2 μl reaction buffer with MgCl2 (NEB, Ipswich, US) with an additional 0.48 μl MgCl2 (25 mM; NEB) to obtain a final concentration of 3 mM, 0.05 μl of oneTAQ (5 U/μl; NEB), and PCR grade water to adjust the volume to 10 μl. ..

    Amplification:

    Article Title: Antigen receptor repertoires of one of the smallest known vertebrates
    Article Snippet: In this way, a total of approximately one-third of the original total RNA material per fish was subjected to analysis. .. The first round of PCR amplification was carried out in multiplex manner: 1× Q5 buffer, 0.5 mM deoxynucleoside triphosphate (dNTP), 0.2 μM UPM_S primer (5′-CTAATACGACTCACTATAGGGC), 0.04 μM UPM_L primer (5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT), and 0.2 μM of each gene-specific primer (GSP), 2 μl of cDNA, water to 49.5 μl, 0.5 μl of Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs); 98°C for 90 s followed by 23 cycles of 98°C for 10 s, 65°C for 20 s, and 72°C for 45 s, followed by 8-min final extension at 72°C. ..

    Article Title: Effects of Naturally Occurring Mutations in Bovine Leukemia Virus 5′-LTR and Tax Gene on Viral Transcriptional Activity
    Article Snippet: PCR Amplification of LTR and tax Sequences To construct luciferase-based reporter plasmids containing observed mutations in LTR regulatory elements, an overlap extension PCR was used to amplify each particular LTR variant. .. The first round of PCR allowed for the amplification of two sequences encompassing the LTR: a 5’-end fragment of 979 bp and 3’-end fragment of 571 bp were generated using Q5 High-Fidelity DNA Polymerase and Q5 Reaction Buffer (New England BioLabs, MA, USA) at the following thermal conditions: 30 s at 98 °C, 40 cycles (10 s at 98 °C, 45 s at 65 °C (5’-end fragment) or 52 °C (3’-end fragment), 1 min at 72 °C), and 7 min at 72 °C. .. The resulting amplicons were subjected to a second PCR using P8169 and P520 oligonucleotides described in and Q5 High-Fidelity DNA Polymerase (New England BioLabs, MA, USA), as described above.

    Multiplex Assay:

    Article Title: Antigen receptor repertoires of one of the smallest known vertebrates
    Article Snippet: In this way, a total of approximately one-third of the original total RNA material per fish was subjected to analysis. .. The first round of PCR amplification was carried out in multiplex manner: 1× Q5 buffer, 0.5 mM deoxynucleoside triphosphate (dNTP), 0.2 μM UPM_S primer (5′-CTAATACGACTCACTATAGGGC), 0.04 μM UPM_L primer (5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT), and 0.2 μM of each gene-specific primer (GSP), 2 μl of cDNA, water to 49.5 μl, 0.5 μl of Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs); 98°C for 90 s followed by 23 cycles of 98°C for 10 s, 65°C for 20 s, and 72°C for 45 s, followed by 8-min final extension at 72°C. ..

    Generated:

    Article Title: Effects of Naturally Occurring Mutations in Bovine Leukemia Virus 5′-LTR and Tax Gene on Viral Transcriptional Activity
    Article Snippet: PCR Amplification of LTR and tax Sequences To construct luciferase-based reporter plasmids containing observed mutations in LTR regulatory elements, an overlap extension PCR was used to amplify each particular LTR variant. .. The first round of PCR allowed for the amplification of two sequences encompassing the LTR: a 5’-end fragment of 979 bp and 3’-end fragment of 571 bp were generated using Q5 High-Fidelity DNA Polymerase and Q5 Reaction Buffer (New England BioLabs, MA, USA) at the following thermal conditions: 30 s at 98 °C, 40 cycles (10 s at 98 °C, 45 s at 65 °C (5’-end fragment) or 52 °C (3’-end fragment), 1 min at 72 °C), and 7 min at 72 °C. .. The resulting amplicons were subjected to a second PCR using P8169 and P520 oligonucleotides described in and Q5 High-Fidelity DNA Polymerase (New England BioLabs, MA, USA), as described above.

    Activity Assay:

    Article Title: Sequencing DNA for the oxidatively modified base 8-oxo-7,8-dihydroguanine
    Article Snippet: PCR thermal cycler Sanger sequencing facility .. Fpg (8,000 units/mL; New England Biolabs) Endo IV (10,000 units/mL; New England Biolabs) T4 DNA ligase (400,000 units/mL; New England Biolabs) Reaction buffer (25 mM HEPES pH 7.5, 10 mM MgCl2 , 5 mM KCl, and 1 mM EDTA) ATP (2 mM stock in ddH2 O; New England Biolabs) dNaMTP (500 μM stock in ddH2 O) d5SICSTP (500 μM stock in ddH2 O) dMMO2SSBIO TP (500 μM stock in ddH2 O) One Taq ® DNA Polymerase (5,000 units/mL; New England Biolabs) Klenow fragment deficient in exonucease activity (5,000 units/mL; New England Biolabs) dNTP solution mix (10 mM of each dNTP; New England Biolabs) PCR primers (forward and reverse in 8 μM solutions) ddH2 O (autoclaved) DMSO DTT (300 mM stock in ddH2 O) TAE buffer (1× = 40 mM Tris, 20 mM acetic acid, and 1 mM EDTA) Agarose Zymoclean™ Gel DNA Recovery kit Ethidium bromide (10 mg/mL) Streptavidin-coated magnetic beads .. This procedure can be implemented on linear DNA duplexes or plasmid DNA.

    Magnetic Beads:

    Article Title: Sequencing DNA for the oxidatively modified base 8-oxo-7,8-dihydroguanine
    Article Snippet: PCR thermal cycler Sanger sequencing facility .. Fpg (8,000 units/mL; New England Biolabs) Endo IV (10,000 units/mL; New England Biolabs) T4 DNA ligase (400,000 units/mL; New England Biolabs) Reaction buffer (25 mM HEPES pH 7.5, 10 mM MgCl2 , 5 mM KCl, and 1 mM EDTA) ATP (2 mM stock in ddH2 O; New England Biolabs) dNaMTP (500 μM stock in ddH2 O) d5SICSTP (500 μM stock in ddH2 O) dMMO2SSBIO TP (500 μM stock in ddH2 O) One Taq ® DNA Polymerase (5,000 units/mL; New England Biolabs) Klenow fragment deficient in exonucease activity (5,000 units/mL; New England Biolabs) dNTP solution mix (10 mM of each dNTP; New England Biolabs) PCR primers (forward and reverse in 8 μM solutions) ddH2 O (autoclaved) DMSO DTT (300 mM stock in ddH2 O) TAE buffer (1× = 40 mM Tris, 20 mM acetic acid, and 1 mM EDTA) Agarose Zymoclean™ Gel DNA Recovery kit Ethidium bromide (10 mg/mL) Streptavidin-coated magnetic beads .. This procedure can be implemented on linear DNA duplexes or plasmid DNA.

    Sequencing:

    Article Title: Effects of Probiotic Bacillus as an Alternative of Antibiotics on Digestive Enzymes Activity and Intestinal Integrity of Piglets
    Article Snippet: The PCR program initially started with 94°C for 2 min; 94°C for 20 s, 52°C for 40 s and 72°C for 1 min, 72°C for 2 min, repeat for 30 cycles; 72°C 2 min; stored in 4°C. .. The PCR reaction system which was used to add specific tags sequence was 20 μL, containing 1 × reaction buffer (NEB Q5TM), 0.3 mM dNTP, 0.25 M of each primer, 1 U Q5TM DNA polymerase (NEB) and l μL of diluted template. .. The PCR condition were 98°C for 30 s; 94°C for 10 s, 65°C for 30 s and 72°C for 30 s, repeat for 30 cycles; 72°C for 5 min. PCR product was excised from a 1.5% agarose gel, purified by QIAquick Gel Extraction Kit (QIAGEN, cat# 28706) and quantified by UV-Vis spectrophotometer (NanoDrop ND1000, United States).

    Concentration Assay:

    Article Title: A broadly applicable COI primer pair and an efficient single‐tube amplicon library preparation protocol for metabarcoding. A broadly applicable COI primer pair and an efficient single‐tube amplicon library preparation protocol for metabarcoding
    Article Snippet: .. PCR conditions were standardized for all primer combinations and performed in a reaction mix containing 1.5 μl DNA extract, 0.5 μl bovine serum albumin (BSA; 10 mg/ml), 1 μl of each primer (10 μM), 1 μl dNTP (2 mM), 2 μl reaction buffer with MgCl2 (NEB, Ipswich, US) with an additional 0.48 μl MgCl2 (25 mM; NEB) to obtain a final concentration of 3 mM, 0.05 μl of oneTAQ (5 U/μl; NEB), and PCR grade water to adjust the volume to 10 μl. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs reaction buffer
    Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reaction buffer/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    reaction buffer - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier

    Image Search Results