phusion buffer hf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    Phusion HF Buffer Pack
    Description:
    Phusion HF Buffer Pack 6 0 ml
    Catalog Number:
    b0518s
    Price:
    24
    Size:
    6 0 ml
    Category:
    Buffers
    		Buy from Supplier

    Structured Review

    New England Biolabs phusion buffer hf
    Phusion HF Buffer Pack
    Phusion HF Buffer Pack 6 0 ml
    https://www.bioz.com/result/phusion buffer hf/product/New England Biolabs
    Average 99 stars, based on 489 article reviews
    Price from $9.99 to $1999.99
    phusion buffer hf - by Bioz Stars, 2020-07
    99/100 stars

    Related Products / Commonly Used Together

    dntps
    dntp
    pcr
    phusion high-fidelity dna polymerase
    phusion dna polymerase
    dmso
    phusion high-fidelity pcr master mix
    pcr reactions
    cdna
    pcr amplification
    pcr reaction
    dntp mix
    illumina pe primer
    mgcl2
    phusion polymerase

    Images

    1) Product Images from "High-throughput mutagenesis using a two-fragment PCR approach"

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-07010-4

    Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.
    Figure Legend Snippet: Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    2) Product Images from "High-fidelity correction of genomic uracil by human mismatch repair activities"

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-9-94

    UNG-directed repair of U•G mispairs in circular duplex substrates . (A) Schematic for construction and repair of M13-U•G substrates. A 56-mer complementary oligonucleotide carrying a single U was annealed to ss M13mp18 to create a U•G mismatch within the Hin dIII restriction site (left); extended with Phusion polymerase to produce a nicked-circular duplex M13-U•G substrates (center); and repaired to create a functional Hin dIII site (right). (B) Reactions demonstrating repair of M13-U•G substrates by purified components of the base excision repair pathway, analyzed by agarose gel electrophoresis. Shown are unrepaired, undigested M13-U•G substrates; and substrates treated with UNG, APE1 and pol β and then digested with Hin dIII and Bme 1580 I, as indicated. Arrows at left indicate undigested nicked circles, and unrepaired and repaired products; schematic at right diagrams products of Hin dIII and Bme 1580 I digestion.
    Figure Legend Snippet: UNG-directed repair of U•G mispairs in circular duplex substrates . (A) Schematic for construction and repair of M13-U•G substrates. A 56-mer complementary oligonucleotide carrying a single U was annealed to ss M13mp18 to create a U•G mismatch within the Hin dIII restriction site (left); extended with Phusion polymerase to produce a nicked-circular duplex M13-U•G substrates (center); and repaired to create a functional Hin dIII site (right). (B) Reactions demonstrating repair of M13-U•G substrates by purified components of the base excision repair pathway, analyzed by agarose gel electrophoresis. Shown are unrepaired, undigested M13-U•G substrates; and substrates treated with UNG, APE1 and pol β and then digested with Hin dIII and Bme 1580 I, as indicated. Arrows at left indicate undigested nicked circles, and unrepaired and repaired products; schematic at right diagrams products of Hin dIII and Bme 1580 I digestion.

    Techniques Used: Functional Assay, Purification, Agarose Gel Electrophoresis

    3) Product Images from "Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora"

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0085385

    Cloning of ITS PCR products of hybrid isolates and their possible parental species. A: using Taq polymerase (with PCR artifact), B: using Phusion polymerase (without PCR artifact) X = recombination event.
    Figure Legend Snippet: Cloning of ITS PCR products of hybrid isolates and their possible parental species. A: using Taq polymerase (with PCR artifact), B: using Phusion polymerase (without PCR artifact) X = recombination event.

    Techniques Used: Clone Assay, Polymerase Chain Reaction

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Structural toggle in the RNaseH domain of Prp8 helps balance splicing fidelity and catalytic efficiency
    Article Snippet: .. Reactions were performed in 20 μL volume, with 10 μL DNA sample precipitated from gel, 1× Phusion HF buffer (NEB), dNTPs (0.25 mM each), 0.25 μM Illumina P5 PCR primer, 0.25 μM Illumina P7 PCR primer, and Phusion polymerase. .. The PCR protocol was an initial denaturation step of 98 °C for 30 s, followed by 8–10 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s. Final extension was at 72 °C for 5 min.

    Article Title: Cost-effective sequence-based nonhuman primate MHC class I genotyping from RNA
    Article Snippet: .. PCR amplification: Phusion™ High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs F-531), nuclease-free water, FlashGel® DNA Cassette 1.2% (Lonza 57023), FlashGel® 5× loading dye (Lonza 50462), FlashGel® Quant Ladder 100bp-1.5kb (Lonza 50475). .. Gel purification of PCR products: 1× TAE, genetic analysis grade agarose, 6× loading dye, SYBR® Safe DNA gel stain 10,000× concentrate in DMSO (Invitrogen ), BenchTop 1kb DNA ladder (Promega G7541), MinElute® Gel Extraction Kit (Qiagen 28606).

    Article Title: Restriction Enzyme Based Enriched L1Hs Sequencing (REBELseq): A Scalable Technique for Detection of Ta Subfamily L1Hs in the Human Genome
    Article Snippet: .. The purified secondary PCR library was then used as a template for the addition of one of six single indexed Illumina flow cell adapters in a 50 µL reaction (Tertiary PCR, ), containing 11 µL purified secondary PCR library, 1X Phusion HF Polymerase Buffer (New England Biolabs #B0518S), 2.5 U Phusion Hot Start HF polymerase (New England Biolabs #M0535L), 0.2 mM dNTPs (Thermo #R0191), 0.5 pmol/µL Adapt2-Seq1 primer and 0.5 pmol/µL Adapt1-Barcode-Seq2 primer (See Supplemental Oligomers). .. Tertiary PCR was thermally cycled as 98° for 0:30 min, then 15 cycles of 98° for 0:05 min, 72° for 0:15 min, then 72° for 1:00 min, and finally a 4° hold.

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities
    Article Snippet: .. M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA). .. To ensure that no homoduplex molecules were present (which could in principle be produced by strand displacement, although this is not a reported activity of Phusion polymerase), products were digested with Hin dIII (1 U/μg substrate); single-stranded M13mp18 was removed by BND cellulose chromatography (Sigma, St Louis, MO); and linear molecules destroyed by treatment with Exonuclease V (USB, Cleveland, OH).

    Article Title: Single-stranded DNA and RNA origami
    Article Snippet: .. Phusion High-Fidelity PCR Master Mix with HF Buffer(100 reactions/50-liter volume) and Lambda Exonuclease (1000 units) was purchased from New England Biolabs, Inc. MinElute PCR Purification Kit was purchased from QIAGEN. .. Nicking endonuclease Nb.BbvCI (1000 units), restriction endonucleases Eco RI (5000 units), Xho I (5000 units) and Hind III (5000 units), T7 and T3 RNA polymerases (5000 units), PCR Cloning Kit (20 reactions), NEB 10-beta and NEB stable competent E. coli were purchased from New England Biolabs, Inc. pGEM-7zf (−) vector, Pure-yield plasmid miniprep system, and the Wizard SV Gel and PCR Clean-UP System were purchased from Promega.

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach
    Article Snippet: .. For truncations of the AtETR1 and LeETR1 plasmids by the two-fragment approach, a slightly different PCR protocol was used: 20 μL PCR mixture prepared with nuclease-free water (Cell Signaling Technology) contained 1 ng DNA template, 500 nM each primer, 200 μM each dNTP (deoxynucleoside triphosphate; NEB), 0.4 U μL−1 Phusion High-Fidelity DNA Polymerase (NEB), and either 1× Phusion buffer HF (NEB) or 3% (v/v) DMSO (NEB) with 1× Phusion buffer GC (NEB). .. Also, PCR thermocycling described above was modified in case of the ETR1 plasmids to have: (1) 11 step-down cycles with annealing starting from 65 °C down to 60 °C (i.e. decreasing by 0.5 °C in each subsequent cycle); (2) elongation time of at least 30 s per kbp of the target product (up to 200 s for the longest PCR products); and (3) final elongation time of 5 min.

    Amplification:

    Article Title: Cost-effective sequence-based nonhuman primate MHC class I genotyping from RNA
    Article Snippet: .. PCR amplification: Phusion™ High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs F-531), nuclease-free water, FlashGel® DNA Cassette 1.2% (Lonza 57023), FlashGel® 5× loading dye (Lonza 50462), FlashGel® Quant Ladder 100bp-1.5kb (Lonza 50475). .. Gel purification of PCR products: 1× TAE, genetic analysis grade agarose, 6× loading dye, SYBR® Safe DNA gel stain 10,000× concentrate in DMSO (Invitrogen ), BenchTop 1kb DNA ladder (Promega G7541), MinElute® Gel Extraction Kit (Qiagen 28606).

    Chromatin Immunoprecipitation:

    Article Title: RNA-seq in the tetraploid Xenopus laevis enables genome-wide insight in a classic developmental biology model organism
    Article Snippet: .. DNase-free water 5× Phusion Buffer HF (NEB) 10 mM dNTP 25 µM primer Solexa PE.1 (5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCT) 25 µM primer Solexa PE.2 (5'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTT CCGATCT) Phusion Polymerase (NEB) AMPure-XP (SPRI) Beads (Agencourt) EB buffer; 10 mM Tris-Cl, pH 8.5 70% ethanol Qubit Fluorometer and dsDNA HS Assay Kit (Invitrogen) Bioanalyzer 2100 HS DNA chip (Agilent) Bioanalyzer 2100 (Agilent) .. Set up PCR reactions in duplicate for each library.

    Polyacrylamide Gel Electrophoresis:

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities
    Article Snippet: .. M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA). .. To ensure that no homoduplex molecules were present (which could in principle be produced by strand displacement, although this is not a reported activity of Phusion polymerase), products were digested with Hin dIII (1 U/μg substrate); single-stranded M13mp18 was removed by BND cellulose chromatography (Sigma, St Louis, MO); and linear molecules destroyed by treatment with Exonuclease V (USB, Cleveland, OH).

    Purification:

    Article Title: Restriction Enzyme Based Enriched L1Hs Sequencing (REBELseq): A Scalable Technique for Detection of Ta Subfamily L1Hs in the Human Genome
    Article Snippet: .. The purified secondary PCR library was then used as a template for the addition of one of six single indexed Illumina flow cell adapters in a 50 µL reaction (Tertiary PCR, ), containing 11 µL purified secondary PCR library, 1X Phusion HF Polymerase Buffer (New England Biolabs #B0518S), 2.5 U Phusion Hot Start HF polymerase (New England Biolabs #M0535L), 0.2 mM dNTPs (Thermo #R0191), 0.5 pmol/µL Adapt2-Seq1 primer and 0.5 pmol/µL Adapt1-Barcode-Seq2 primer (See Supplemental Oligomers). .. Tertiary PCR was thermally cycled as 98° for 0:30 min, then 15 cycles of 98° for 0:05 min, 72° for 0:15 min, then 72° for 1:00 min, and finally a 4° hold.

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities
    Article Snippet: .. M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA). .. To ensure that no homoduplex molecules were present (which could in principle be produced by strand displacement, although this is not a reported activity of Phusion polymerase), products were digested with Hin dIII (1 U/μg substrate); single-stranded M13mp18 was removed by BND cellulose chromatography (Sigma, St Louis, MO); and linear molecules destroyed by treatment with Exonuclease V (USB, Cleveland, OH).

    Article Title: Single-stranded DNA and RNA origami
    Article Snippet: .. Phusion High-Fidelity PCR Master Mix with HF Buffer(100 reactions/50-liter volume) and Lambda Exonuclease (1000 units) was purchased from New England Biolabs, Inc. MinElute PCR Purification Kit was purchased from QIAGEN. .. Nicking endonuclease Nb.BbvCI (1000 units), restriction endonucleases Eco RI (5000 units), Xho I (5000 units) and Hind III (5000 units), T7 and T3 RNA polymerases (5000 units), PCR Cloning Kit (20 reactions), NEB 10-beta and NEB stable competent E. coli were purchased from New England Biolabs, Inc. pGEM-7zf (−) vector, Pure-yield plasmid miniprep system, and the Wizard SV Gel and PCR Clean-UP System were purchased from Promega.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • phusion buffer hf  (New England Biolabs)
    99
    New England Biolabs phusion buffer hf
    Agarose gel electrophoresis analysis of PCR fragments multiplied by <t>Phusion</t> High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.
    Phusion Buffer Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 457 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion buffer hf/product/New England Biolabs
    Average 99 stars, based on 457 article reviews
    Price from $9.99 to $1999.99
    phusion buffer hf - by Bioz Stars, 2020-07
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Journal: Scientific Reports

    Article Title: High-throughput mutagenesis using a two-fragment PCR approach

    doi: 10.1038/s41598-017-07010-4

    Figure Lengend Snippet: Agarose gel electrophoresis analysis of PCR fragments multiplied by Phusion High-Fidelity PCR Master Mix with HF Buffer and Phusion High-Fidelity PCR Master Mix with GC Buffer. Analysed PCRs are labelled as the mutated residue and the letter indicating whether the fragment is multiplied by mutation-specific forward (F) or reverse (R) primer. Expected PCR fragments are between 3000 and 4000 bp long. While using the PCR master mix with GC buffer gave expected fragments in all shown cases, using the Phusion High-Fidelity polymerase with HF buffer failed to multiply four fragments.

    Article Snippet: For truncations of the AtETR1 and LeETR1 plasmids by the two-fragment approach, a slightly different PCR protocol was used: 20 μL PCR mixture prepared with nuclease-free water (Cell Signaling Technology) contained 1 ng DNA template, 500 nM each primer, 200 μM each dNTP (deoxynucleoside triphosphate; NEB), 0.4 U μL−1 Phusion High-Fidelity DNA Polymerase (NEB), and either 1× Phusion buffer HF (NEB) or 3% (v/v) DMSO (NEB) with 1× Phusion buffer GC (NEB).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    UNG-directed repair of U•G mispairs in circular duplex substrates . (A) Schematic for construction and repair of M13-U•G substrates. A 56-mer complementary oligonucleotide carrying a single U was annealed to ss M13mp18 to create a U•G mismatch within the Hin dIII restriction site (left); extended with Phusion polymerase to produce a nicked-circular duplex M13-U•G substrates (center); and repaired to create a functional Hin dIII site (right). (B) Reactions demonstrating repair of M13-U•G substrates by purified components of the base excision repair pathway, analyzed by agarose gel electrophoresis. Shown are unrepaired, undigested M13-U•G substrates; and substrates treated with UNG, APE1 and pol β and then digested with Hin dIII and Bme 1580 I, as indicated. Arrows at left indicate undigested nicked circles, and unrepaired and repaired products; schematic at right diagrams products of Hin dIII and Bme 1580 I digestion.

    Journal: BMC Molecular Biology

    Article Title: High-fidelity correction of genomic uracil by human mismatch repair activities

    doi: 10.1186/1471-2199-9-94

    Figure Lengend Snippet: UNG-directed repair of U•G mispairs in circular duplex substrates . (A) Schematic for construction and repair of M13-U•G substrates. A 56-mer complementary oligonucleotide carrying a single U was annealed to ss M13mp18 to create a U•G mismatch within the Hin dIII restriction site (left); extended with Phusion polymerase to produce a nicked-circular duplex M13-U•G substrates (center); and repaired to create a functional Hin dIII site (right). (B) Reactions demonstrating repair of M13-U•G substrates by purified components of the base excision repair pathway, analyzed by agarose gel electrophoresis. Shown are unrepaired, undigested M13-U•G substrates; and substrates treated with UNG, APE1 and pol β and then digested with Hin dIII and Bme 1580 I, as indicated. Arrows at left indicate undigested nicked circles, and unrepaired and repaired products; schematic at right diagrams products of Hin dIII and Bme 1580 I digestion.

    Article Snippet: M13mp18 circular single-stranded (ss) (+) strand DNA (NEB) was annealed to PAGE purified oligonucleotide EDL330, 5'-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAG U TTGCATGCCTGCAGGTC, in a 1.4 ml reaction that contained 13.7 μg M13mp18 DNA, 80 pmol EDL330, 0.2 mM dNTPs, in Phusion polymerase HF buffer (NEB), to create a U•G mismatch at position 6283 (underlined); extended with Phusion polymerase (14 U) at 65°C for 45 min; and duplex extension products separated from other reaction components by two rounds of purification on PCR-pure spin columns (Qiagen, Valencia, CA).

    Techniques: Functional Assay, Purification, Agarose Gel Electrophoresis

    Cloning of ITS PCR products of hybrid isolates and their possible parental species. A: using Taq polymerase (with PCR artifact), B: using Phusion polymerase (without PCR artifact) X = recombination event.

    Journal: PLoS ONE

    Article Title: Host Adaptation and Speciation through Hybridization and Polyploidy in Phytophthora

    doi: 10.1371/journal.pone.0085385

    Figure Lengend Snippet: Cloning of ITS PCR products of hybrid isolates and their possible parental species. A: using Taq polymerase (with PCR artifact), B: using Phusion polymerase (without PCR artifact) X = recombination event.

    Article Snippet: The reaction was performed in a 40 µL mix containing 8 µL Phusion HF buffer (5x, NEB), 0.8 µL dNTPs (10 mM, Promega), 1 µL of each primer (10 mM), 0.4 µL Phusion polymerase (20 U/mL, NEB), 27.8 µL milli-Q water and 2 µL of template (0.2 ng/µL).

    Techniques: Clone Assay, Polymerase Chain Reaction