1x isothermal amplification buffer ii  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
    Name:
    Isothermal Amplification Buffer II Pack
    Description:
    Isothermal Amplification Buffer II Pack 6 0 ml
    Catalog Number:
    b0374s
    Price:
    27
    Size:
    6 0 ml
    Category:
    Buffers
    		Buy from Supplier

    Structured Review

    New England Biolabs 1x isothermal amplification buffer ii
    Isothermal Amplification Buffer II Pack
    Isothermal Amplification Buffer II Pack 6 0 ml
    https://www.bioz.com/result/1x isothermal amplification buffer ii/product/New England Biolabs
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    1x isothermal amplification buffer ii - by Bioz Stars, 2020-02
    93/100 stars

    Related Products / Commonly Used Together

    mgso4
    bst 3.0
    dntp
    hnb
    dntps
    bst polymerase 3.0
    fip/bip primers
    kcl
    dntp mix
    bst 2.0 dna polymerase
    bst 3.0 dna polymerase
    loopf/loopb primers
    so4
    pcr cleanup spin columns
    f3/b3 primers

    Images

    Related Articles

    Amplification:

    Article Title: A Versatile Strategy to Reduce UGA-Selenocysteine Recoding Efficiency of the Ribosome Using CRISPR-Cas9-Viral-Like-Particles Targeting Selenocysteine-tRNA[Ser]Sec Gene
    Article Snippet: One hundred fifty nanograms of genomic DNA was then used for polymerase chain reaction (PCR) amplification with primers: Fw: 5′-CAGGGCTGTCACCCACCGCTGCGTCCTC-3′ Rev: 5′-GTCAACCATCTCACACCTTTCCAAAGG-3′. .. For the T7 endonuclease1 mismatch assay, PCR products were diluted twice and complemented with Buffer 2 (New England Biolabs).

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: The ARS305 -adjacent region probe was made using PCR amplification of genomic DNA with primers 5′-GTAGGAACAAAGGTTTGGCAGG-3′ and 5′-CTTCGAGATAAGGCATGGGG-3′. .. MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above.

    Article Title: Telomeric RNAs are essential to maintain telomeres
    Article Snippet: Off-target mutation analysis DNA regions bearing predicted off-target mutations were amplified by PCR (see primers in ) and TIDE analysis . .. T7-endonuclease assay was performed as follows: a DNA heteroduplex formation was perfomed in a 20 μl reaction containing 300 ng of DNA and 2 μl of buffer 2 (NEB).

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA). .. Dpn I tags were PCR amplified with primers 5′- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT CAGCAGTC-3′ and 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC -3′ (underlined sequences correspond to the Illumina library construction primers) as follows: 1 cycle of 68°C for 5 minutes; 11 cycles of 95°C for 30 seconds, 65°C for 1 minute, 72°C for 20 seconds; one cycle of 72°C for 5 minutes.

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Array hybridizations performed before and after LM-PCR showed that the LM-PCR did not introduce significant amplification bias ( ). .. The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB).

    Article Title: Sequence-tagged microsatellite profiling (STMP): a rapid technique for developing SSR markers
    Article Snippet: Paragraph title: Preparation of amplified Pst I– Mse I restriction fragments ... Halberd) was digested for 3 h at 37°C with 5 U each of Mse I and Pst I in 50 µl of 1× New England Biolabs (NEB) buffer II and 100 ng/µl BSA.

    Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
    Article Snippet: T7 adaptor oligos 1 and 2 (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′ and 5′-P-CCCTATAGTGAGTCGTATTAGTACTCTAGCCTTAAGATC-3′) were annealed by mixing a 12.5 μl of each 200 μM oligo stock with 5 μl of 10× buffer 2 (NEB) and 20 μl of H2 O. .. After gel extraction with a QIAquick Gel Extraction kit (QIAGEN), the libraries were PCR amplified in four separate reactions with the following components: 25 μl 2× HiFi HotStart ReadyMix (KAPA), 20 μl H2 O, 5 μl PCR primer (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′, same as T7 oligo 1 above, 10 μM stock), and 5 μl purified ligation mix.

    Article Title: Phylogeographic analysis of the East Asian goldenrod (Solidago virgaurea complex, Asteraceae) reveals hidden ecological diversification with recurrent formation of ecotypes
    Article Snippet: Briefly, 10 ng of genomic DNA was digested with Eco RI and Bgl II (New England Biolabs, Ipswich, MA, USA) and adapters were ligated at 37 °C overnight in a 10-µL volume containing 1 µL of ×10 New England Biolabs (NEB) buffer 2, 0.1 µL of ×100 bovine serum albumin (BSA) (NEB), 0.4 µL of 5 µ m Eco RI adapter and Bgl II adapter, 0.1 µL of 100 m m ATP and 0.5 µL of T4 DNA Ligase (Enzymatics, Beverly, MA, USA). .. For several DNA samples used in the phylogenetic analysis, the PCR amplification included 1 µL of each 10 µ m index and TruSeq universal primer and 5 µL of ×2 KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, MA, USA).

    Article Title: Real-Time, Digital LAMP with Commercial Microfluidic Chips Reveals the Interplay of Efficiency, Speed, and Background Amplification as a Function of Reaction Temperature and Time
    Article Snippet: .. LAMP experiments using Bst 3.0 ( ; b,d,e,f,h–j; ) contained the following final concentrations, optimized previously: 1× Isothermal Amplification Buffer II (New England BioLabs (NEB), Ipswich, MA, USA; ref B0374S, containing 20 mM Tris-HCl 10 mM (NH4 )2 SO4 , 150 mM KCl, 2 mM MgSO4 , 0.1% Tween 20 pH 8.8 at 25 °C), 4 mM additional MgSO4 (beyond 2 mM from buffer), 1.4 mM Deoxynucleotide Solution Mix. .. Primers: 1.6 μM FIP/BIP, 0.2 μM FOP/BOP, and 0.4 μM LoopF/LoopB, 1 mg/mL BSA (New England BioLabs, ref B90005), 320 U/mL Bst 3.0, Ambion RNase cocktail (ThermoFisher, Waltham, MA, USA; ref AM2286, 5 U/mL RNase A, 400 U/mL TNase T1), 2 μM SYTO 9 (ThermoFisher, ref S34854), and approximately 660 copies/μL template in Ambion nuclease-free water (ThermoFisher, ref AM9932).

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs). .. Complete digestion was confirmed by the separation pattern of restriction fragments in a non-denaturing 15% polyacrylamide gel, which had been stained with ethidium bromide.

    Article Title: Real-Time, Digital LAMP with Commercial Microfluidic Chips Reveals the Interplay of Efficiency, Speed, and Background Amplification as a Function of Reaction Temperature and Time
    Article Snippet: .. LAMP experiments using Bst 3.0 ( ; b,d,e,f,h–j; ) contained the following final concentrations, optimized previously: 1× Isothermal Amplification Buffer II (New England BioLabs (NEB), Ipswich, MA, USA; ref B0374S, containing 20 mM Tris-HCl 10 mM (NH4 )2 SO4 , 150 mM KCl, 2 mM MgSO4 , 0.1% Tween 20 pH 8.8 at 25 °C), 4 mM additional MgSO4 (beyond 2 mM from buffer), 1.4 mM Deoxynucleotide Solution Mix. .. Primers: 1.6 μM FIP/BIP, 0.2 μM FOP/BOP, and 0.4 μM LoopF/LoopB, 1 mg/mL BSA (New England BioLabs, ref B90005), 320 U/mL Bst 3.0, Ambion RNase cocktail (ThermoFisher, Waltham, MA, USA; ref AM2286, 5 U/mL RNase A, 400 U/mL TNase T1), 2 μM SYTO 9 (ThermoFisher, ref S34854), and approximately 660 copies/μL template in Ambion nuclease-free water (ThermoFisher, ref AM9932).

    Article Title: Isothermal assay targeting class 1 integrase gene for environmental surveillance of antibiotic resistance markers
    Article Snippet: .. LAMP reactions consisted of 1X isothermal amplification buffer II (New England Biolabs), 1.4 mM each dNTP (Invitrogen), 0.8 M Betaine solution (Sigma Aldrich), 6 mM MgSO4 (New England Biolabs), 4 U Bst Polymerase 3.0 (New England Biolabs), 200 μM SYTO82 Orange Fluorescent Nucleic Acid Stain (ThermoFisher Scientific), template solution that constitutes 10% of the reaction volume, and PCR grade water. ..

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: .. This mixture was incubated with 8 units of Bst 2.0 DNA polymerase (New England Biolabs) in 1× isothermal amplification buffer II, 6 mM MgSO4 , 2.5 mM dNTPs, at 70 °C for 1 h. The amplification product was purified via PCR cleanup spin columns (New England Biolabs) and quantified through gel electrophoresis. ..

    Article Title: Optical Temperature Control Unit and Convolutional Neural Network for Colorimetric Detection of Loop-Mediated Isothermal Amplification on a Lab-On-A-Disc Platform
    Article Snippet: .. LAMP Reaction The LAMP reaction mixture was set based on following reagents: 10X Isothermal Amplification Buffer II (B0374S, New England Biolabs, USA, 1X Buffer components: 20 mM Tris-HCl, 10 mM (NH4 )2 SO4 , 150 mM KCl, 2 mM MgSO4 , and 0.1% Tween® 20. pH 8.8 at 25 °C), 6 mM MgSO4 (8 mM total), dNTP Mix for 1.4 mM each (11 969 064 001, Roche, Basel, Switzerland), 1.6 μM of FIP/BIP primers, 0.2 µM of F3/B3 primers, 0.8 μM of LoopF/LoopB primers, 8U of Bst 3.0 DNA Polymerase (M0374S, New England Biolabs, Ipswich, USA), and 120 µM of HNB (H007-10, Dojindo, Kamimashiki, Japan) in a total volume of 25 µL following the manual instructions. ..

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Library was constructed from 125 ng of bacterial DNA that was recovered from the gel without amplification, loaded on R9.4 flow-cells (Oxford Nanopore Technologies), and sequenced for 48 h. For sequencing of human DNA, 1.1–1.8 ng target DNA recovered from the gel was amplified using the multiple displacement amplification (MDA) REPLI-g midi kit (Qiagen) for long-range amplification. .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads.

    Construct:

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: The digital images of the DNA markers were used to construct a calibration curve, from which the concentration of purified amplicon was calculated. .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs).

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Library was constructed from 125 ng of bacterial DNA that was recovered from the gel without amplification, loaded on R9.4 flow-cells (Oxford Nanopore Technologies), and sequenced for 48 h. For sequencing of human DNA, 1.1–1.8 ng target DNA recovered from the gel was amplified using the multiple displacement amplification (MDA) REPLI-g midi kit (Qiagen) for long-range amplification. .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads.

    Incubation:

    Article Title: A Versatile Strategy to Reduce UGA-Selenocysteine Recoding Efficiency of the Ribosome Using CRISPR-Cas9-Viral-Like-Particles Targeting Selenocysteine-tRNA[Ser]Sec Gene
    Article Snippet: For the T7 endonuclease1 mismatch assay, PCR products were diluted twice and complemented with Buffer 2 (New England Biolabs). .. Heteroduplexes were incubated for 15 min at 37 °C with T7 endonuclease 1 (New England Biolabs).

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above. .. Branch migration assays were performed as previously described , with the exception that the 65 °C incubation of samples was for 9 h.

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: .. The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB). .. The reaction was purified using a Zymo-5 kit (Genetix) according to the manufacturer’s instructions, but the final elution was done in 30 μL of TE buffer (pH 8.5).

    Article Title: Sequence-tagged microsatellite profiling (STMP): a rapid technique for developing SSR markers
    Article Snippet: Halberd) was digested for 3 h at 37°C with 5 U each of Mse I and Pst I in 50 µl of 1× New England Biolabs (NEB) buffer II and 100 ng/µl BSA. .. A solution containing 1× NEB buffer II, 100 ng/µl BSA, 6 mM ATP and 1 U T4 ligase was then added to give a total volume of 60 µl and incubation was continued for a further 1 h at 37°C, then at room temperature for 2 h. The DNA fragments were purified with a QiaQuick PCR purification kit (Qiagen), eluted in 50 µl of 1× NEB exonuclease III buffer containing 100 U exonuclease III and incubated overnight at 37°C.

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs). .. Complete digestion was confirmed by the separation pattern of restriction fragments in a non-denaturing 15% polyacrylamide gel, which had been stained with ethidium bromide.

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: .. This mixture was incubated with 8 units of Bst 2.0 DNA polymerase (New England Biolabs) in 1× isothermal amplification buffer II, 6 mM MgSO4 , 2.5 mM dNTPs, at 70 °C for 1 h. The amplification product was purified via PCR cleanup spin columns (New England Biolabs) and quantified through gel electrophoresis. ..

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads. .. This process yielded 20–40 kb amplicons for nanopore sequencing.

    Gel Extraction:

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA). .. The desired ~125 bp product was recovered using a QIAquick Gel extraction kit (Qiagen) and quantified using a Nanodrop spectrophotometer (Thermo Scientific, Rockford, IL).

    Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
    Article Snippet: T7 adaptor oligos 1 and 2 (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′ and 5′-P-CCCTATAGTGAGTCGTATTAGTACTCTAGCCTTAAGATC-3′) were annealed by mixing a 12.5 μl of each 200 μM oligo stock with 5 μl of 10× buffer 2 (NEB) and 20 μl of H2 O. .. After gel extraction with a QIAquick Gel Extraction kit (QIAGEN), the libraries were PCR amplified in four separate reactions with the following components: 25 μl 2× HiFi HotStart ReadyMix (KAPA), 20 μl H2 O, 5 μl PCR primer (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′, same as T7 oligo 1 above, 10 μM stock), and 5 μl purified ligation mix.

    Transfection:

    Article Title: Telomeric RNAs are essential to maintain telomeres
    Article Snippet: DNA from cells that were not transfected with CRISPR-Cas9 was used as reference. .. T7-endonuclease assay was performed as follows: a DNA heteroduplex formation was perfomed in a 20 μl reaction containing 300 ng of DNA and 2 μl of buffer 2 (NEB).

    Ligation:

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB). .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
    Article Snippet: Ligation was also performed with this kit, but with custom adapters. .. T7 adaptor oligos 1 and 2 (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′ and 5′-P-CCCTATAGTGAGTCGTATTAGTACTCTAGCCTTAAGATC-3′) were annealed by mixing a 12.5 μl of each 200 μM oligo stock with 5 μl of 10× buffer 2 (NEB) and 20 μl of H2 O.

    Introduce:

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Array hybridizations performed before and after LM-PCR showed that the LM-PCR did not introduce significant amplification bias ( ). .. The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB).

    Mutagenesis:

    Article Title: Telomeric RNAs are essential to maintain telomeres
    Article Snippet: Paragraph title: Off-target mutation analysis ... T7-endonuclease assay was performed as follows: a DNA heteroduplex formation was perfomed in a 20 μl reaction containing 300 ng of DNA and 2 μl of buffer 2 (NEB).

    Generated:

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: After end repairing using Klenow polymerase, a second adaptor (generated by annealing 5′-ccgagatctaCACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-AGATCGGAAGAGCGTCGTGTA-3′) was ligated to the other end of the sequence tags. .. After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA).

    DNA Sequencing:

    Article Title: Phylogeographic analysis of the East Asian goldenrod (Solidago virgaurea complex, Asteraceae) reveals hidden ecological diversification with recurrent formation of ecotypes
    Article Snippet: Paragraph title: Double-digest restriction-associated DNA sequencing. ... Briefly, 10 ng of genomic DNA was digested with Eco RI and Bgl II (New England Biolabs, Ipswich, MA, USA) and adapters were ligated at 37 °C overnight in a 10-µL volume containing 1 µL of ×10 New England Biolabs (NEB) buffer 2, 0.1 µL of ×100 bovine serum albumin (BSA) (NEB), 0.4 µL of 5 µ m Eco RI adapter and Bgl II adapter, 0.1 µL of 100 m m ATP and 0.5 µL of T4 DNA Ligase (Enzymatics, Beverly, MA, USA).

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: For construction of bacterial DNA sequencing library, a low input expansion pack kit in combination with SQK-MAP007, R9 version kit (Oxford Nanopore Technologies) was used according to manufacturer's instructions. .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads.

    Polymerase Chain Reaction:

    Article Title: A Versatile Strategy to Reduce UGA-Selenocysteine Recoding Efficiency of the Ribosome Using CRISPR-Cas9-Viral-Like-Particles Targeting Selenocysteine-tRNA[Ser]Sec Gene
    Article Snippet: .. For the T7 endonuclease1 mismatch assay, PCR products were diluted twice and complemented with Buffer 2 (New England Biolabs). .. Diluted PCR amplicons were then denatured at 95 °C and cooled down to 20 °C with a 0.1 °C/s ramp.

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: The ARS305 -adjacent region probe was made using PCR amplification of genomic DNA with primers 5′-GTAGGAACAAAGGTTTGGCAGG-3′ and 5′-CTTCGAGATAAGGCATGGGG-3′. .. MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above.

    Article Title: Telomeric RNAs are essential to maintain telomeres
    Article Snippet: Off-target mutation analysis DNA regions bearing predicted off-target mutations were amplified by PCR (see primers in ) and TIDE analysis . .. T7-endonuclease assay was performed as follows: a DNA heteroduplex formation was perfomed in a 20 μl reaction containing 300 ng of DNA and 2 μl of buffer 2 (NEB).

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: For each sample 8 μg DNA was digested with 40 U of Dpn I in 100 μl at 37°C overnight and purified through a QIAquick PCR purification column (Qiagen). .. After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA).

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Methylated DNA Immunoprecipitation (MeDIP) was based on a previously published protocol, but we also included a ligatin-mediated PCR (LM-PCR) step ( ) to amplify the material. .. The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB).

    Article Title: Sequence-tagged microsatellite profiling (STMP): a rapid technique for developing SSR markers
    Article Snippet: Halberd) was digested for 3 h at 37°C with 5 U each of Mse I and Pst I in 50 µl of 1× New England Biolabs (NEB) buffer II and 100 ng/µl BSA. .. A solution containing 1× NEB buffer II, 100 ng/µl BSA, 6 mM ATP and 1 U T4 ligase was then added to give a total volume of 60 µl and incubation was continued for a further 1 h at 37°C, then at room temperature for 2 h. The DNA fragments were purified with a QiaQuick PCR purification kit (Qiagen), eluted in 50 µl of 1× NEB exonuclease III buffer containing 100 U exonuclease III and incubated overnight at 37°C.

    Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
    Article Snippet: T7 adaptor oligos 1 and 2 (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′ and 5′-P-CCCTATAGTGAGTCGTATTAGTACTCTAGCCTTAAGATC-3′) were annealed by mixing a 12.5 μl of each 200 μM oligo stock with 5 μl of 10× buffer 2 (NEB) and 20 μl of H2 O. .. After gel extraction with a QIAquick Gel Extraction kit (QIAGEN), the libraries were PCR amplified in four separate reactions with the following components: 25 μl 2× HiFi HotStart ReadyMix (KAPA), 20 μl H2 O, 5 μl PCR primer (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′, same as T7 oligo 1 above, 10 μM stock), and 5 μl purified ligation mix.

    Article Title: Phylogeographic analysis of the East Asian goldenrod (Solidago virgaurea complex, Asteraceae) reveals hidden ecological diversification with recurrent formation of ecotypes
    Article Snippet: Briefly, 10 ng of genomic DNA was digested with Eco RI and Bgl II (New England Biolabs, Ipswich, MA, USA) and adapters were ligated at 37 °C overnight in a 10-µL volume containing 1 µL of ×10 New England Biolabs (NEB) buffer 2, 0.1 µL of ×100 bovine serum albumin (BSA) (NEB), 0.4 µL of 5 µ m Eco RI adapter and Bgl II adapter, 0.1 µL of 100 m m ATP and 0.5 µL of T4 DNA Ligase (Enzymatics, Beverly, MA, USA). .. Next, 3 µL of purified DNA was used in the PCR amplifications in a 10-µL volume containing 1 µL of each 10 µM index and TruSeq universal primer, 0.3 µL of KOD-Plus-Neo enzyme and 1 µL of ×10 PCR buffer (Toyobo, Osaka, Japan), 0.6 µL of 25 m m MgSO4 and 1 µL of 10 m m dNTP.

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: Before the digestion, the amplicon was purified by using an UltraClean™ PCR clean-up kit (MO BIO Laboratories, Solana Beach, CA) according to the manufacturer’s instructions. .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs).

    Article Title: Isothermal assay targeting class 1 integrase gene for environmental surveillance of antibiotic resistance markers
    Article Snippet: .. LAMP reactions consisted of 1X isothermal amplification buffer II (New England Biolabs), 1.4 mM each dNTP (Invitrogen), 0.8 M Betaine solution (Sigma Aldrich), 6 mM MgSO4 (New England Biolabs), 4 U Bst Polymerase 3.0 (New England Biolabs), 200 μM SYTO82 Orange Fluorescent Nucleic Acid Stain (ThermoFisher Scientific), template solution that constitutes 10% of the reaction volume, and PCR grade water. ..

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: .. This mixture was incubated with 8 units of Bst 2.0 DNA polymerase (New England Biolabs) in 1× isothermal amplification buffer II, 6 mM MgSO4 , 2.5 mM dNTPs, at 70 °C for 1 h. The amplification product was purified via PCR cleanup spin columns (New England Biolabs) and quantified through gel electrophoresis. ..

    Methylated DNA Immunoprecipitation:

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Methylated DNA Immunoprecipitation (MeDIP) was based on a previously published protocol, but we also included a ligatin-mediated PCR (LM-PCR) step ( ) to amplify the material. .. The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB).

    DNA Extraction:

    Article Title: A Versatile Strategy to Reduce UGA-Selenocysteine Recoding Efficiency of the Ribosome Using CRISPR-Cas9-Viral-Like-Particles Targeting Selenocysteine-tRNA[Ser]Sec Gene
    Article Snippet: Paragraph title: 2.4. Genomic DNA Extraction and Analysis ... For the T7 endonuclease1 mismatch assay, PCR products were diluted twice and complemented with Buffer 2 (New England Biolabs).

    Nucleic Acid Electrophoresis:

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: .. This mixture was incubated with 8 units of Bst 2.0 DNA polymerase (New England Biolabs) in 1× isothermal amplification buffer II, 6 mM MgSO4 , 2.5 mM dNTPs, at 70 °C for 1 h. The amplification product was purified via PCR cleanup spin columns (New England Biolabs) and quantified through gel electrophoresis. ..

    Methylation:

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Paragraph title: Immunoprecipitation of methylated DNA ... The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB).

    Multiple Displacement Amplification:

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Library was constructed from 125 ng of bacterial DNA that was recovered from the gel without amplification, loaded on R9.4 flow-cells (Oxford Nanopore Technologies), and sequenced for 48 h. For sequencing of human DNA, 1.1–1.8 ng target DNA recovered from the gel was amplified using the multiple displacement amplification (MDA) REPLI-g midi kit (Qiagen) for long-range amplification. .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads.

    Isolation:

    Article Title: Sequence-tagged microsatellite profiling (STMP): a rapid technique for developing SSR markers
    Article Snippet: One microgram of genomic DNA isolated from hexaploid wheat ( Triticum aestivum L. cv. .. Halberd) was digested for 3 h at 37°C with 5 U each of Mse I and Pst I in 50 µl of 1× New England Biolabs (NEB) buffer II and 100 ng/µl BSA.

    AST Assay:

    Article Title: Real-Time, Digital LAMP with Commercial Microfluidic Chips Reveals the Interplay of Efficiency, Speed, and Background Amplification as a Function of Reaction Temperature and Time
    Article Snippet: LAMP Reagents Our amplification target was the Escherichia coli 23S ribosomal gene, which we used previously as a target to perform rapid AST on clinical samples. .. LAMP experiments using Bst 3.0 ( ; b,d,e,f,h–j; ) contained the following final concentrations, optimized previously: 1× Isothermal Amplification Buffer II (New England BioLabs (NEB), Ipswich, MA, USA; ref B0374S, containing 20 mM Tris-HCl 10 mM (NH4 )2 SO4 , 150 mM KCl, 2 mM MgSO4 , 0.1% Tween 20 pH 8.8 at 25 °C), 4 mM additional MgSO4 (beyond 2 mM from buffer), 1.4 mM Deoxynucleotide Solution Mix.

    Article Title: Real-Time, Digital LAMP with Commercial Microfluidic Chips Reveals the Interplay of Efficiency, Speed, and Background Amplification as a Function of Reaction Temperature and Time
    Article Snippet: Our amplification target was the Escherichia coli 23S ribosomal gene, which we used previously as a target to perform rapid AST on clinical samples. .. LAMP experiments using Bst 3.0 ( ; b,d,e,f,h–j; ) contained the following final concentrations, optimized previously: 1× Isothermal Amplification Buffer II (New England BioLabs (NEB), Ipswich, MA, USA; ref B0374S, containing 20 mM Tris-HCl 10 mM (NH4 )2 SO4 , 150 mM KCl, 2 mM MgSO4 , 0.1% Tween 20 pH 8.8 at 25 °C), 4 mM additional MgSO4 (beyond 2 mM from buffer), 1.4 mM Deoxynucleotide Solution Mix.

    Flow Cytometry:

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Library was constructed from 125 ng of bacterial DNA that was recovered from the gel without amplification, loaded on R9.4 flow-cells (Oxford Nanopore Technologies), and sequenced for 48 h. For sequencing of human DNA, 1.1–1.8 ng target DNA recovered from the gel was amplified using the multiple displacement amplification (MDA) REPLI-g midi kit (Qiagen) for long-range amplification. .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads.

    Labeling:

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: .. MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above. .. The synthetic HJ was based on J-11, built from oligos 1, 2, 3, and 4 , with two modifications: an error in the reported sequence of oligo 1 ( ) was corrected to generate oligo 1* (GGCGACGTGATCACCAGATGATTGCTAGGCATGCTTTCCGCAAGAGAAGC), and a C was added to the 3′ end of oligo 4 to generate oligo 4* (ACCGTTAGCAGTTCGCCTTGAGCCTAGCAATCATCTGGTGATCACGTCGCC) so that the HJ arm formed by oligos 1* and 4* was blunt ended and thus not subject to cleavage by MBN.

    Purification:

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: The biotin-labeled tags were purified using 30 μl of strepavidin-Dynabeads (Invitrogen) per sample. .. After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA).

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB). .. The reaction was purified using a Zymo-5 kit (Genetix) according to the manufacturer’s instructions, but the final elution was done in 30 μL of TE buffer (pH 8.5).

    Article Title: Sequence-tagged microsatellite profiling (STMP): a rapid technique for developing SSR markers
    Article Snippet: Halberd) was digested for 3 h at 37°C with 5 U each of Mse I and Pst I in 50 µl of 1× New England Biolabs (NEB) buffer II and 100 ng/µl BSA. .. A solution containing 1× NEB buffer II, 100 ng/µl BSA, 6 mM ATP and 1 U T4 ligase was then added to give a total volume of 60 µl and incubation was continued for a further 1 h at 37°C, then at room temperature for 2 h. The DNA fragments were purified with a QiaQuick PCR purification kit (Qiagen), eluted in 50 µl of 1× NEB exonuclease III buffer containing 100 U exonuclease III and incubated overnight at 37°C.

    Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
    Article Snippet: T7 adaptor oligos 1 and 2 (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′ and 5′-P-CCCTATAGTGAGTCGTATTAGTACTCTAGCCTTAAGATC-3′) were annealed by mixing a 12.5 μl of each 200 μM oligo stock with 5 μl of 10× buffer 2 (NEB) and 20 μl of H2 O. .. After gel extraction with a QIAquick Gel Extraction kit (QIAGEN), the libraries were PCR amplified in four separate reactions with the following components: 25 μl 2× HiFi HotStart ReadyMix (KAPA), 20 μl H2 O, 5 μl PCR primer (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′, same as T7 oligo 1 above, 10 μM stock), and 5 μl purified ligation mix.

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: The digital images of the DNA markers were used to construct a calibration curve, from which the concentration of purified amplicon was calculated. .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs).

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: .. This mixture was incubated with 8 units of Bst 2.0 DNA polymerase (New England Biolabs) in 1× isothermal amplification buffer II, 6 mM MgSO4 , 2.5 mM dNTPs, at 70 °C for 1 h. The amplification product was purified via PCR cleanup spin columns (New England Biolabs) and quantified through gel electrophoresis. ..

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads. .. This process yielded 20–40 kb amplicons for nanopore sequencing.

    Sequencing:

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above. .. The synthetic HJ was based on J-11, built from oligos 1, 2, 3, and 4 , with two modifications: an error in the reported sequence of oligo 1 ( ) was corrected to generate oligo 1* (GGCGACGTGATCACCAGATGATTGCTAGGCATGCTTTCCGCAAGAGAAGC), and a C was added to the 3′ end of oligo 4 to generate oligo 4* (ACCGTTAGCAGTTCGCCTTGAGCCTAGCAATCATCTGGTGATCACGTCGCC) so that the HJ arm formed by oligos 1* and 4* was blunt ended and thus not subject to cleavage by MBN.

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: Paragraph title: Construction of DpnI sequence-tag libraries for ultra high-throughput sequencing ... After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA).

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: Comparison with LAMP On the same divergent regions of the HPV genome, identified in the section of ‘sequence design’, we used the automated online LAMP primer design server (PrimerExplorer.jp) with the default settings to identify possible LAMP amplification primers. .. This mixture was incubated with 8 units of Bst 2.0 DNA polymerase (New England Biolabs) in 1× isothermal amplification buffer II, 6 mM MgSO4 , 2.5 mM dNTPs, at 70 °C for 1 h. The amplification product was purified via PCR cleanup spin columns (New England Biolabs) and quantified through gel electrophoresis.

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Library was constructed from 125 ng of bacterial DNA that was recovered from the gel without amplification, loaded on R9.4 flow-cells (Oxford Nanopore Technologies), and sequenced for 48 h. For sequencing of human DNA, 1.1–1.8 ng target DNA recovered from the gel was amplified using the multiple displacement amplification (MDA) REPLI-g midi kit (Qiagen) for long-range amplification. .. Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads.

    Immunoprecipitation:

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Paragraph title: Immunoprecipitation of methylated DNA ... The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB).

    CRISPR:

    Article Title: Telomeric RNAs are essential to maintain telomeres
    Article Snippet: DNA from cells that were not transfected with CRISPR-Cas9 was used as reference. .. T7-endonuclease assay was performed as follows: a DNA heteroduplex formation was perfomed in a 20 μl reaction containing 300 ng of DNA and 2 μl of buffer 2 (NEB).

    One-tailed Test:

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: Gels were quantified using ImageQuant analyses of PhosphorImager scans. p values for spike:arc ratios were calculated using one-tailed t tests. .. MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above.

    Software:

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: The amplicon was double digested with Dde I and Hin fI (New England Biolabs, Beverly, MA), which have been selected by using an online software called Webcutter. .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs).

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: We compared the number of LAMP primer sets, as returned by the software, to the number of enVision recognition nanostructures that could be designed in the same region. .. This mixture was incubated with 8 units of Bst 2.0 DNA polymerase (New England Biolabs) in 1× isothermal amplification buffer II, 6 mM MgSO4 , 2.5 mM dNTPs, at 70 °C for 1 h. The amplification product was purified via PCR cleanup spin columns (New England Biolabs) and quantified through gel electrophoresis.

    Selection:

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads. .. Next, we either performed a size selection step or continued directly to construction of a sequencing library.

    Agarose Gel Electrophoresis:

    Article Title: A Versatile Strategy to Reduce UGA-Selenocysteine Recoding Efficiency of the Ribosome Using CRISPR-Cas9-Viral-Like-Particles Targeting Selenocysteine-tRNA[Ser]Sec Gene
    Article Snippet: For the T7 endonuclease1 mismatch assay, PCR products were diluted twice and complemented with Buffer 2 (New England Biolabs). .. Samples were run on a 2.5% agarose gel stained with ethidium bromide.

    Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
    Article Snippet: T7 adaptor oligos 1 and 2 (5′-GATCTTAAGGCTAGAGTACTAATACGACTCACTATAGGG∗ T-3′ and 5′-P-CCCTATAGTGAGTCGTATTAGTACTCTAGCCTTAAGATC-3′) were annealed by mixing a 12.5 μl of each 200 μM oligo stock with 5 μl of 10× buffer 2 (NEB) and 20 μl of H2 O. .. The libraries were then size selected on a 2% agarose gel to remove unligated adapters and select for fragments ∼200–300 bp in length (inserts ∼120–220 bp).

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: The concentration of purified amplicon was determined by scanning an ethidium bromide-stained agarose gel, in which the amplicon was electrophoresed in one lane and a known amount (2 µg) of linear DNA markers (φX174 DNA digested with Hae III, Promega, Madison, WI) in an adjacent lane, with a Fluorimager 595 (excitation filter = 514 nm, emission filter = 610 nm, Molecular Dynamics, Sunnyvale, CA). .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs).

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads. .. Size selection was performed by running unbranched DNA in a low melting agarose gel, extracting DNA from the upper band corresponding to 20–40 kb by agarase gel digestion (0.5 U/μl, Thermo Scientific) followed with AMPure XP beads purification.

    Spectrophotometry:

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA). .. The desired ~125 bp product was recovered using a QIAquick Gel extraction kit (Qiagen) and quantified using a Nanodrop spectrophotometer (Thermo Scientific, Rockford, IL).

    Concentration Assay:

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: The digital images of the DNA markers were used to construct a calibration curve, from which the concentration of purified amplicon was calculated. .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs).

    Migration:

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above. .. Branch migration assays were performed as previously described , with the exception that the 65 °C incubation of samples was for 9 h.

    Two-Dimensional Gel Electrophoresis:

    Article Title: Resolution by Unassisted Top3 Points to Template Switch Recombination Intermediates during DNA Replication *
    Article Snippet: Paragraph title: Analysis of X-shaped Recombination Intermediates by Two-dimensional Gel Electrophoresis ... MBN sensitivity of X-shaped molecules was performed by digesting 1 μg of samples with BglII in New England Biolabs Buffer 2 followed by addition of 45 units of MBN (New England Biolab) at 30 °C for 1 h. To confirm the specificity of MBN under these conditions, 0.5 fmol of a 5′-32 P-end labeled oligonucleotide (oligo 1*) by itself, or annealed into a synthetic HJ, was mixed with 1 μg of BglII-digested genomic DNA and treated with MBN as above.

    High Throughput Screening Assay:

    Article Title: Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development
    Article Snippet: Paragraph title: Construction of DpnI sequence-tag libraries for ultra high-throughput sequencing ... After washing, the beads were re-suspended in 25 μl 1× Buffer 2 (New England Biolabs, Ipswich, MA).

    Staining:

    Article Title: A Versatile Strategy to Reduce UGA-Selenocysteine Recoding Efficiency of the Ribosome Using CRISPR-Cas9-Viral-Like-Particles Targeting Selenocysteine-tRNA[Ser]Sec Gene
    Article Snippet: For the T7 endonuclease1 mismatch assay, PCR products were diluted twice and complemented with Buffer 2 (New England Biolabs). .. Samples were run on a 2.5% agarose gel stained with ethidium bromide.

    Article Title: Mass spectrometry of single-stranded restriction fragments captured by an undigested complementary sequence
    Article Snippet: The quality of the amplicon was examined by using 1.5% agarose gel electrophoresis and ethidium bromide staining ( ). .. Typically, 1 µg of amplicon was incubated at 37°C for 90 min with 2 U of each endonuclease in 30 µl of 1× Buffer 2 (10 mM Tris–HCl, pH 7.9, 10 mM MgCl2 , 50 mM NaCl, 1 mM dithiothreitol, New England Biolabs).

    Article Title: Isothermal assay targeting class 1 integrase gene for environmental surveillance of antibiotic resistance markers
    Article Snippet: .. LAMP reactions consisted of 1X isothermal amplification buffer II (New England Biolabs), 1.4 mM each dNTP (Invitrogen), 0.8 M Betaine solution (Sigma Aldrich), 6 mM MgSO4 (New England Biolabs), 4 U Bst Polymerase 3.0 (New England Biolabs), 200 μM SYTO82 Orange Fluorescent Nucleic Acid Stain (ThermoFisher Scientific), template solution that constitutes 10% of the reaction volume, and PCR grade water. ..

    Nanopore Sequencing:

    Article Title: Selective nanopore sequencing of human BRCA1 by Cas9-assisted targeting of chromosome segments (CATCH)
    Article Snippet: Paragraph title: Nanopore sequencing ... Next, 1 μg of DNA was subjected to T7 endonuclease I fragmentation for linearization of branched amplicons as follows: DNA was incubated at 37°C for 15 min with 2 μl buffer 2 (New England Biolabs), 1 μl T7 endonuclease I (New England Biolabs) in a total volume of 20 μl, followed by an additional purification with AMPure XP beads.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 1x isothermal amplification buffer ii  (New England Biolabs)
    93
    New England Biolabs 1x isothermal amplification buffer ii
    1x Isothermal Amplification Buffer Ii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x isothermal amplification buffer ii/product/New England Biolabs
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    1x isothermal amplification buffer ii - by Bioz Stars, 2020-02
    93/100 stars
    		  Buy from Supplier

    Image Search Results