ligase reaction buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Taq DNA Ligase Reaction Buffer
    Description:
    Taq DNA Ligase Reaction Buffer 6 0 ml
    Catalog Number:
    b0208s
    Price:
    24
    Size:
    6 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs ligase reaction buffer
    Taq DNA Ligase Reaction Buffer
    Taq DNA Ligase Reaction Buffer 6 0 ml
    https://www.bioz.com/result/ligase reaction buffer/product/New England Biolabs
    Average 95 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    ligase reaction buffer - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
    Article Snippet: PCR amplification was performed in a total volume of 10 μL that contained 1× GC buffer I (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, China), 1 U HotStarTaq polymerase (Qiagen, Germany), 1 μL each primers (Sangon, China) and 1 μL genomic DNA. .. The LDR reactions for each PCR product were performed in a final volume of 10 μL, containing 1 μL 10× ligase reaction buffer (New England Biolabs, USA), 2 μL purified PCR product, 0.4 μL 5’ ligase primer (1 μM) mixture (Sangon, China), 0.4 μL 3’ ligase primer (2 μM) mixture (Sangon, China), 0.25 μL Taq DNA ligase (New England Biolabs, USA) and 6 μL double distilled H2 O.

    Article Title: Biological interactions of CYP2C19 genotypes with CYP3A4*18, CYP3A5*3, and MDR1-3435 in living donor liver transplantation recipients
    Article Snippet: The specific amplified fragments were used in an LDR assay to identify the mutations associated with CYP3A4*18B and CYP3A5*3 . .. The LDR assay was performed as follows: 10 μL of the reaction mix contained 1 μL of 1× ligase reaction buffer (New England Biolabs, USA), 1 μL of probes (12.5 pmol/μL each), 0.05 μL (2 U) of thermostable Taq DNA ligase (New England Biolabs), and 1 μL of PCR product.

    Article Title: A method for high-throughput gene expression signature analysis
    Article Snippet: Paragraph title: Ligation-mediated amplification ... A volume of 5 μl of 1× Taq Ligase Buffer containing 2.5 U Taq DNA ligase (New England Biolabs) was added, the plate covered, spun as before, and incubated at 45°C for one hour followed by 65°C for 10 minutes.

    Article Title: Fluorescence spectroscopic detection and measurement of single telomere molecules
    Article Snippet: Paragraph title: Telomeric sequence generation via rolling circle amplification ... Reagents for ligation and RCA reactions, including 9°N™ DNA Ligase, 10 × 9°N™ DNA Ligase Reaction Buffer, Phage ø29 DNA Polymerase, Exonuclease I (E. coli ), Exonuclease III (E. coli ) and 10 × Isothermal Reaction Buffer were purchased from New England BioLabs, Inc. (Ipswich, MA, USA).

    Article Title: Simultaneous Identification of Ten Bacterial Pathogens Using the Multiplex Ligation Reaction Based on the Probe Melting Curve Analysis
    Article Snippet: During the detection process, an MCA was performed for each sample after the PCR amplification to detect the target DNA sequence, thus resulting in unique Tm values displayed by the hybrids formed between the Tm tags and their corresponding fluorescent probes in the respective fluorophore channels. .. A 5-μl volume of the previously isolated genomic DNA was denatured at 98 °C for 5 min and allowed to reach 75 °C, and finally, a 3.5-μL reaction mixture containing 1 μL of DNA ligase buffer, 1 unit of Taq DNA ligase (New England Biolabs, Beijing, China), and 1.5 μL of diethylpyrocarbonate (DEPC) water was added to the reaction tube.

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay
    Article Snippet: Multiplex oligonucleotide ligation The multiplex ligation step was separated from PCR amplification in order to avoid the high background signal levels when combining both steps in one reaction . .. The optimized ligation reaction mix combined 5 nM of each MOLigo probe (Table ) with 2.5 μl of 10X Hifi Taq DNA ligase reaction buffer, 0.5 μl of Hifi Taq DNA ligase (New England BioLabs, Massachusetts, USA), and 2.5 μl of template DNA (corresponds to ∼2.5 ng of isolated DNA).

    Positive Control:

    Article Title: Guidelines for Optimisation of a Multiplex Oligonucleotide Ligation-PCR for Characterisation of Microbial Pathogens in a Microsphere Suspension Array
    Article Snippet: Multiplex Oligonucleotide Ligation The multiplex ligation reaction mix combined 1 to 5 nM of each of the 40 probes with 1X Taq DNA ligase reaction buffer (New England BioLabs), 2 to 6 units of Taq DNA ligase (New England BioLabs), and 2 or 4 μ L of template DNA and was brought to a final volume of 10 μ L with nuclease free distilled water (Life Technologies). .. Each experiment included a positive control for the reaction and a no-template-control (NTC) to measure background signal for which the template DNA was replaced by, respectively, positive control template DNA and nuclease free distilled water.

    Construct:

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: Finally, the two dsDNAs were annealed and ligated overnight at 16°C in the presence of T4 DNA ligase in ligase reaction buffer (50 mM Tris, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol, pH 7.5, NEB). .. The 180 bp construct was further purified by running a 3% agarose gel in TBE (Tris/borate/EDTA) buffer for 2 h (6 V/cm).

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR. .. The probes were produced by sonicating the HIV-1pNL4-3 construct to generate 500 bp fragments.

    Article Title: Slow extension of the invading DNA strand in a D-loop formed by RecA-mediated homologous recombination may enhance recognition of DNA homology
    Article Snippet: To prepare the long construct, 180-bp labeled dsDNA, a 90-nt ssDNA containing an internal rhodamine label on base 58 (or base 11) from the 5′ end and a 5′ end–phosphorylated oligonucleotide (82 bases) containing an internal fluorescein label (position 57 or 9 from the 3′ end) were first annealed together. .. The two dsDNAs (labeled and unlabeled) were annealed and ligated overnight at 16 °C with T4 DNA ligase in ligase reaction buffer (50 mm Tris, 10 mm MgCl2 , 1 mm ATP, and 10 mm DTT, pH 7.5; New England Biolabs).

    Real-time Polymerase Chain Reaction:

    Article Title: Simultaneous Identification of Ten Bacterial Pathogens Using the Multiplex Ligation Reaction Based on the Probe Melting Curve Analysis
    Article Snippet: A universal PCR primer pair was designed to amplify the ligated product via LATE-PCR by using a standard real-time PCR instrument. .. A 5-μl volume of the previously isolated genomic DNA was denatured at 98 °C for 5 min and allowed to reach 75 °C, and finally, a 3.5-μL reaction mixture containing 1 μL of DNA ligase buffer, 1 unit of Taq DNA ligase (New England Biolabs, Beijing, China), and 1.5 μL of diethylpyrocarbonate (DEPC) water was added to the reaction tube.

    Microarray:

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra). .. To define the SNP sequence type of each position on a DNA microarray, fluorescent signal intensities were evaluated using SNPStar software (version 0.0.0.8; Olympus, Tokyo, Japan).

    Incubation:

    Article Title: Genome-wide colocalization of RNA–DNA interactions and fusion RNA pairs
    Article Snippet: .. For in situ RNA–DNA proximity ligation, nuclei were resuspended in 2 mL of proximity ligation mixture [4 units/ μ L T4 DNA ligase (NEB), 1 × DNA ligase reaction buffer, 0.1% Triton X-100, 1 mg/mL BSA (NEB), 0.5 unit/ μ L RNasinPlus] and incubated at 16 °C overnight. ..

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: .. The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra). .. For the labeling reaction, the mixture (12-μl total volume) contained 6 μl of ligation product, 3 nM each D1s primer, 0.5 μM (each)Alexa 647-ED-2 and Alexa 555-ED-1 primer, 1.5× KAPA2G Fast buffer, 4.5 mM Mg2+ , 0.2 mM (each) deoxynucleoside triphosphate (dNTP), and 0.4 U of KAPA2G Fast HotStart DNA polymerase (Kapa Biosystems).

    Article Title: A framework for exhaustively mapping functional missense variants
    Article Snippet: .. A 30 μl reaction containing 1× Taq DNA ligase buffer, 0.2 mM dNTPs, 2 U Sulfolobus DNA polymerase IV (NEB), and 40 U Taq DNA ligase (NEB) was added to the DNA and was incubated at 37°C for 2 h. .. Degradation of wild‐type template 1 μl fill‐in reaction was added to a 20 μl reaction containing 1× UDG buffer and 5 U Uracil‐DNA glycosylase (NEB) and incubated at 37°C for 2 h. Amplification of mutagenized DNA.

    Article Title: A method for high-throughput gene expression signature analysis
    Article Snippet: .. A volume of 5 μl of 1× Taq Ligase Buffer containing 2.5 U Taq DNA ligase (New England Biolabs) was added, the plate covered, spun as before, and incubated at 45°C for one hour followed by 65°C for 10 minutes. .. A volume of 15 μl of a HotStarTaq DNA Polymerase mix (Qiagen, hilden, Germany) containing 16 μmol/l of each dNTP (Invitrogen) and 100 nmol/l of T3 primer and biotinylated T7 primer was added.

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: .. Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR. .. Samples were pooled and HIV was enriched using hybridization to biotinylated HIV probes.

    Hybridization:

    Article Title: A method for high-throughput gene expression signature analysis
    Article Snippet: A volume of 5 μl of 1× Taq Ligase Buffer containing 2.5 U Taq DNA ligase (New England Biolabs) was added, the plate covered, spun as before, and incubated at 45°C for one hour followed by 65°C for 10 minutes. .. Total time from the addition of lysis buffer to hybridization-ready product for 96 samples processed in parallel in a single microtiter plate is approximately 14 hours.

    Article Title: Fluorescence spectroscopic detection and measurement of single telomere molecules
    Article Snippet: Reagents for ligation and RCA reactions, including 9°N™ DNA Ligase, 10 × 9°N™ DNA Ligase Reaction Buffer, Phage ø29 DNA Polymerase, Exonuclease I (E. coli ), Exonuclease III (E. coli ) and 10 × Isothermal Reaction Buffer were purchased from New England BioLabs, Inc. (Ipswich, MA, USA). .. Padlock probe hybridization and ligation was achieved in a 25-μl reaction mixture contained 150 nM of padlock probe, 400 nM of complementary non-telomeric oligo, 0.4 Units/μl 9°N™ DNA Ligase, and 1× 9N DNA Ligase Reaction Buffer (10 mM Tris–HCl, 600 μM ATP, 2.5 mM MgCl2 , 2.5 mM dithiothreitol, 0.1% Triton X-100, pH 7.5 at 25°C).

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR. .. Samples were pooled and HIV was enriched using hybridization to biotinylated HIV probes.

    Ligation:

    Article Title: Genome-wide colocalization of RNA–DNA interactions and fusion RNA pairs
    Article Snippet: .. For in situ RNA–DNA proximity ligation, nuclei were resuspended in 2 mL of proximity ligation mixture [4 units/ μ L T4 DNA ligase (NEB), 1 × DNA ligase reaction buffer, 0.1% Triton X-100, 1 mg/mL BSA (NEB), 0.5 unit/ μ L RNasinPlus] and incubated at 16 °C overnight. ..

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: In the ligation reaction, the perfect-match 3′ query-cD1s probes were first phosphorylated at 37°C for 30 min and then incubated at 95°C for 3 min in a phosphorylation mixture containing 1× protruding-end kinase buffer, 30 mM ATP, 40 U of polynucleotide kinase, and 1 μM each 3′ query probe (Kination kit, Toyobo, Osaka, Japan) using a TGradient thermal cycler (Biometra). .. The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra).

    Article Title: Ratiometric Fluorescence Coding for Multiplex Nucleic Acid Amplification Testing
    Article Snippet: .. Reagents for ligation, RCA, and HRCA reactions, including 9°N™ DNA ligase, 10× 9°N DNA ligase reaction buffer, T4 gene-32 protein, phi29 DNA polymerase, Exonuclease I ( E. coli ), Exonuclease III ( E. coli ), 10× phi29 DNA polymerase reaction buffer, Bst DNA polymerase, and 10× Bst polymerase reaction buffer were purchased from New England BioLabs, Inc. (Ipswich, MA). .. Deoxyribonucleotide triphosphate (dNTP) was purchased from Invitrogen Corp. (Carlsbad, CA).

    Article Title: Biological interactions of CYP2C19 genotypes with CYP3A4*18, CYP3A5*3, and MDR1-3435 in living donor liver transplantation recipients
    Article Snippet: The LDR assay was performed as follows: 10 μL of the reaction mix contained 1 μL of 1× ligase reaction buffer (New England Biolabs, USA), 1 μL of probes (12.5 pmol/μL each), 0.05 μL (2 U) of thermostable Taq DNA ligase (New England Biolabs), and 1 μL of PCR product. .. The ligation reaction was performed with a GeneAmp PCR System 9600 (Perkin Elmer, USA) as follows: 15 min at 95°C, followed by 35 cycles of 30 s at 94°C and 2 min at 60°C.

    Article Title: A multiplex oligonucleotide ligation-PCR as a complementary tool for subtyping of Salmonella Typhimurium
    Article Snippet: .. The multiplex oligonucleotide ligation reaction occurred in a 10 μl volume with 1× Taq DNA ligase reaction buffer (New England BioLabs), 2 nM of each probe (Tables , and , Eurogentec), 2 U of Taq DNA ligase (New England BioLabs), 2 μl of DNA template and nuclease-free distilled water (Thermo Fisher Scientific). .. The thermal cycling programme (Swift MaxPro, Esco) included 10 min of denaturation at 95 °C followed by 30 cycles of 25 s at 94 °C and 30 s at 58 °C.

    Article Title: A method for high-throughput gene expression signature analysis
    Article Snippet: Paragraph title: Ligation-mediated amplification ... A volume of 5 μl of 1× Taq Ligase Buffer containing 2.5 U Taq DNA ligase (New England Biolabs) was added, the plate covered, spun as before, and incubated at 45°C for one hour followed by 65°C for 10 minutes.

    Article Title: Fluorescence spectroscopic detection and measurement of single telomere molecules
    Article Snippet: .. Reagents for ligation and RCA reactions, including 9°N™ DNA Ligase, 10 × 9°N™ DNA Ligase Reaction Buffer, Phage ø29 DNA Polymerase, Exonuclease I (E. coli ), Exonuclease III (E. coli ) and 10 × Isothermal Reaction Buffer were purchased from New England BioLabs, Inc. (Ipswich, MA, USA). .. Padlock probe hybridization and ligation was achieved in a 25-μl reaction mixture contained 150 nM of padlock probe, 400 nM of complementary non-telomeric oligo, 0.4 Units/μl 9°N™ DNA Ligase, and 1× 9N DNA Ligase Reaction Buffer (10 mM Tris–HCl, 600 μM ATP, 2.5 mM MgCl2 , 2.5 mM dithiothreitol, 0.1% Triton X-100, pH 7.5 at 25°C).

    Article Title: Simultaneous Identification of Ten Bacterial Pathogens Using the Multiplex Ligation Reaction Based on the Probe Melting Curve Analysis
    Article Snippet: Step 1: Hybridization and Ligation The hybridization-ligation reaction was performed with a T3 Thermocycler (Biometra, Germany) and 1.5 μL of ligation probe mix (1–4 fmol of each specific ligation oligonucleotide, including an IC, Supplementary Table ). .. A 5-μl volume of the previously isolated genomic DNA was denatured at 98 °C for 5 min and allowed to reach 75 °C, and finally, a 3.5-μL reaction mixture containing 1 μL of DNA ligase buffer, 1 unit of Taq DNA ligase (New England Biolabs, Beijing, China), and 1.5 μL of diethylpyrocarbonate (DEPC) water was added to the reaction tube.

    Article Title: Guidelines for Optimisation of a Multiplex Oligonucleotide Ligation-PCR for Characterisation of Microbial Pathogens in a Microsphere Suspension Array
    Article Snippet: .. Multiplex Oligonucleotide Ligation The multiplex ligation reaction mix combined 1 to 5 nM of each of the 40 probes with 1X Taq DNA ligase reaction buffer (New England BioLabs), 2 to 6 units of Taq DNA ligase (New England BioLabs), and 2 or 4 μ L of template DNA and was brought to a final volume of 10 μ L with nuclease free distilled water (Life Technologies). .. The thermal cycling programme (Swift MaxPro, Esco) included 5 or 10 min of denaturation at 95°C followed by 30 cycles of 25 s at 94°C and 30 s at 58°C ( : Multiplex oligonucleotide ligation).

    Polymerase Chain Reaction:

    Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
    Article Snippet: .. The LDR reactions for each PCR product were performed in a final volume of 10 μL, containing 1 μL 10× ligase reaction buffer (New England Biolabs, USA), 2 μL purified PCR product, 0.4 μL 5’ ligase primer (1 μM) mixture (Sangon, China), 0.4 μL 3’ ligase primer (2 μM) mixture (Sangon, China), 0.25 μL Taq DNA ligase (New England Biolabs, USA) and 6 μL double distilled H2 O. ..

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: .. The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra). .. For the labeling reaction, the mixture (12-μl total volume) contained 6 μl of ligation product, 3 nM each D1s primer, 0.5 μM (each)Alexa 647-ED-2 and Alexa 555-ED-1 primer, 1.5× KAPA2G Fast buffer, 4.5 mM Mg2+ , 0.2 mM (each) deoxynucleoside triphosphate (dNTP), and 0.4 U of KAPA2G Fast HotStart DNA polymerase (Kapa Biosystems).

    Article Title: Ratiometric Fluorescence Coding for Multiplex Nucleic Acid Amplification Testing
    Article Snippet: Reagents for ligation, RCA, and HRCA reactions, including 9°N™ DNA ligase, 10× 9°N DNA ligase reaction buffer, T4 gene-32 protein, phi29 DNA polymerase, Exonuclease I ( E. coli ), Exonuclease III ( E. coli ), 10× phi29 DNA polymerase reaction buffer, Bst DNA polymerase, and 10× Bst polymerase reaction buffer were purchased from New England BioLabs, Inc. (Ipswich, MA). .. Formamide, sodium chloride (NaCl), EDTA (pH 8.0), bovine serum albumin (BSA), betaine, and H2 O (PCR grade) were purchased from Sigma-Aldrich Corp. (St. Louis, MO).

    Article Title: Biological interactions of CYP2C19 genotypes with CYP3A4*18, CYP3A5*3, and MDR1-3435 in living donor liver transplantation recipients
    Article Snippet: .. The LDR assay was performed as follows: 10 μL of the reaction mix contained 1 μL of 1× ligase reaction buffer (New England Biolabs, USA), 1 μL of probes (12.5 pmol/μL each), 0.05 μL (2 U) of thermostable Taq DNA ligase (New England Biolabs), and 1 μL of PCR product. .. The ligation reaction was performed with a GeneAmp PCR System 9600 (Perkin Elmer, USA) as follows: 15 min at 95°C, followed by 35 cycles of 30 s at 94°C and 2 min at 60°C.

    Article Title: A multiplex oligonucleotide ligation-PCR as a complementary tool for subtyping of Salmonella Typhimurium
    Article Snippet: The multiplex oligonucleotide ligation reaction occurred in a 10 μl volume with 1× Taq DNA ligase reaction buffer (New England BioLabs), 2 nM of each probe (Tables , and , Eurogentec), 2 U of Taq DNA ligase (New England BioLabs), 2 μl of DNA template and nuclease-free distilled water (Thermo Fisher Scientific). .. The singleplex PCR was performed in a final volume of 10 μl composed of 1× HotStarTaq PCR buffer (Qiagen), 125 nM T7 primer (TAATACGACTCACTATAGGG, Eurogentec), 500 nM 5′-biotin-T3 primer (ATTAACCCTCACTAAAGGGA, Eurogentec), 200 μM of each dNTP (Thermo Fisher Scientific), 0.25 U HotStarTaq DNA polymerase (Qiagen) and 3 μl of ligase product.

    Article Title: A method for high-throughput gene expression signature analysis
    Article Snippet: A volume of 5 μl of 1× Taq Ligase Buffer containing 2.5 U Taq DNA ligase (New England Biolabs) was added, the plate covered, spun as before, and incubated at 45°C for one hour followed by 65°C for 10 minutes. .. The plate was covered, spun as before, and polymerase chain reaction performed in a Thermo Electron (Milford, MA, USA) MBS 384 Satellite Thermal Cycler (initial denaturation of 92°C for 9 minutes, 92°C for 30 s, 60°C for 30 s, 72°C for 30 s for 39 cycles; final extension at 72°C for 5 minutes).

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: .. Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR. .. Samples were pooled and HIV was enriched using hybridization to biotinylated HIV probes.

    Article Title: Simultaneous Identification of Ten Bacterial Pathogens Using the Multiplex Ligation Reaction Based on the Probe Melting Curve Analysis
    Article Snippet: During the detection process, an MCA was performed for each sample after the PCR amplification to detect the target DNA sequence, thus resulting in unique Tm values displayed by the hybrids formed between the Tm tags and their corresponding fluorescent probes in the respective fluorophore channels. .. A 5-μl volume of the previously isolated genomic DNA was denatured at 98 °C for 5 min and allowed to reach 75 °C, and finally, a 3.5-μL reaction mixture containing 1 μL of DNA ligase buffer, 1 unit of Taq DNA ligase (New England Biolabs, Beijing, China), and 1.5 μL of diethylpyrocarbonate (DEPC) water was added to the reaction tube.

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay
    Article Snippet: Multiplex oligonucleotide ligation The multiplex ligation step was separated from PCR amplification in order to avoid the high background signal levels when combining both steps in one reaction . .. The optimized ligation reaction mix combined 5 nM of each MOLigo probe (Table ) with 2.5 μl of 10X Hifi Taq DNA ligase reaction buffer, 0.5 μl of Hifi Taq DNA ligase (New England BioLabs, Massachusetts, USA), and 2.5 μl of template DNA (corresponds to ∼2.5 ng of isolated DNA).

    DNA Extraction:

    Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
    Article Snippet: Paragraph title: DNA Extraction and Genotyping ... The LDR reactions for each PCR product were performed in a final volume of 10 μL, containing 1 μL 10× ligase reaction buffer (New England Biolabs, USA), 2 μL purified PCR product, 0.4 μL 5’ ligase primer (1 μM) mixture (Sangon, China), 0.4 μL 3’ ligase primer (2 μM) mixture (Sangon, China), 0.25 μL Taq DNA ligase (New England Biolabs, USA) and 6 μL double distilled H2 O.

    Ion Exchange Chromatography:

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: MATERIALS AND METHODS Escherichia coli Pol IV was purified from the TMCΔT strain (BL21-AIΔdinB, ΔumuDC, ΔrecA) by ion exchange chromatography and hydrophobic interaction chromatography as previously described ( , ). .. Finally, the two dsDNAs were annealed and ligated overnight at 16°C in the presence of T4 DNA ligase in ligase reaction buffer (50 mM Tris, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol, pH 7.5, NEB).

    Isolation:

    Article Title: Simultaneous Identification of Ten Bacterial Pathogens Using the Multiplex Ligation Reaction Based on the Probe Melting Curve Analysis
    Article Snippet: .. A 5-μl volume of the previously isolated genomic DNA was denatured at 98 °C for 5 min and allowed to reach 75 °C, and finally, a 3.5-μL reaction mixture containing 1 μL of DNA ligase buffer, 1 unit of Taq DNA ligase (New England Biolabs, Beijing, China), and 1.5 μL of diethylpyrocarbonate (DEPC) water was added to the reaction tube. .. Step 2: PCR Amplification and MCA The reactions for amplification and MCA were performed on a Bio-Rad CFX 96 real-time PCR system (Bio-Rad Inc., Hercules, CA).

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay
    Article Snippet: .. The optimized ligation reaction mix combined 5 nM of each MOLigo probe (Table ) with 2.5 μl of 10X Hifi Taq DNA ligase reaction buffer, 0.5 μl of Hifi Taq DNA ligase (New England BioLabs, Massachusetts, USA), and 2.5 μl of template DNA (corresponds to ∼2.5 ng of isolated DNA). .. The reaction was brought to a final volume of 25 μl with PCR H2 O (Top-Bio, Czech Republic).

    Labeling:

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra). .. For the labeling reaction, the mixture (12-μl total volume) contained 6 μl of ligation product, 3 nM each D1s primer, 0.5 μM (each)Alexa 647-ED-2 and Alexa 555-ED-1 primer, 1.5× KAPA2G Fast buffer, 4.5 mM Mg2+ , 0.2 mM (each) deoxynucleoside triphosphate (dNTP), and 0.4 U of KAPA2G Fast HotStart DNA polymerase (Kapa Biosystems).

    Article Title: Ratiometric Fluorescence Coding for Multiplex Nucleic Acid Amplification Testing
    Article Snippet: All DNA oligonucleotides including synthetic targets, padlock probes, and primers were purchased from Integrated DNA Technologies, Inc. (Coralville, IA) and both fluorescently labeled peptide nucleic acid (PNA) probes were purchased from PNA Bio (Newbury Park, CA). .. Reagents for ligation, RCA, and HRCA reactions, including 9°N™ DNA ligase, 10× 9°N DNA ligase reaction buffer, T4 gene-32 protein, phi29 DNA polymerase, Exonuclease I ( E. coli ), Exonuclease III ( E. coli ), 10× phi29 DNA polymerase reaction buffer, Bst DNA polymerase, and 10× Bst polymerase reaction buffer were purchased from New England BioLabs, Inc. (Ipswich, MA).

    Article Title: Slow extension of the invading DNA strand in a D-loop formed by RecA-mediated homologous recombination may enhance recognition of DNA homology
    Article Snippet: .. The two dsDNAs (labeled and unlabeled) were annealed and ligated overnight at 16 °C with T4 DNA ligase in ligase reaction buffer (50 mm Tris, 10 mm MgCl2 , 1 mm ATP, and 10 mm DTT, pH 7.5; New England Biolabs). .. The 180-bp construct was purified by running a 3% agarose gel in Tris borate/EDTA buffer for 2 h (6 V/cm).

    Purification:

    Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
    Article Snippet: .. The LDR reactions for each PCR product were performed in a final volume of 10 μL, containing 1 μL 10× ligase reaction buffer (New England Biolabs, USA), 2 μL purified PCR product, 0.4 μL 5’ ligase primer (1 μM) mixture (Sangon, China), 0.4 μL 3’ ligase primer (2 μM) mixture (Sangon, China), 0.25 μL Taq DNA ligase (New England Biolabs, USA) and 6 μL double distilled H2 O. ..

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: MATERIALS AND METHODS Escherichia coli Pol IV was purified from the TMCΔT strain (BL21-AIΔdinB, ΔumuDC, ΔrecA) by ion exchange chromatography and hydrophobic interaction chromatography as previously described ( , ). .. Finally, the two dsDNAs were annealed and ligated overnight at 16°C in the presence of T4 DNA ligase in ligase reaction buffer (50 mM Tris, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol, pH 7.5, NEB).

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: Chromatin immunoprecipitation library preparation, enrichment and sequencing Following purification, the ChIP DNA was end repaired (daTailed). .. Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR.

    Article Title: Slow extension of the invading DNA strand in a D-loop formed by RecA-mediated homologous recombination may enhance recognition of DNA homology
    Article Snippet: The two dsDNAs (labeled and unlabeled) were annealed and ligated overnight at 16 °C with T4 DNA ligase in ligase reaction buffer (50 mm Tris, 10 mm MgCl2 , 1 mm ATP, and 10 mm DTT, pH 7.5; New England Biolabs). .. The 180-bp construct was purified by running a 3% agarose gel in Tris borate/EDTA buffer for 2 h (6 V/cm).

    Sequencing:

    Article Title: Genome-wide colocalization of RNA–DNA interactions and fusion RNA pairs
    Article Snippet: The same linker sequence as described in the previous MARGI paper was used ( ). .. For in situ RNA–DNA proximity ligation, nuclei were resuspended in 2 mL of proximity ligation mixture [4 units/ μ L T4 DNA ligase (NEB), 1 × DNA ligase reaction buffer, 0.1% Triton X-100, 1 mg/mL BSA (NEB), 0.5 unit/ μ L RNasinPlus] and incubated at 16 °C overnight.

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra). .. To define the SNP sequence type of each position on a DNA microarray, fluorescent signal intensities were evaluated using SNPStar software (version 0.0.0.8; Olympus, Tokyo, Japan).

    Article Title: Fluorescence spectroscopic detection and measurement of single telomere molecules
    Article Snippet: Paragraph title: Telomeric sequence generation via rolling circle amplification ... Reagents for ligation and RCA reactions, including 9°N™ DNA Ligase, 10 × 9°N™ DNA Ligase Reaction Buffer, Phage ø29 DNA Polymerase, Exonuclease I (E. coli ), Exonuclease III (E. coli ) and 10 × Isothermal Reaction Buffer were purchased from New England BioLabs, Inc. (Ipswich, MA, USA).

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: Paragraph title: Chromatin immunoprecipitation library preparation, enrichment and sequencing ... Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR.

    Article Title: Simultaneous Identification of Ten Bacterial Pathogens Using the Multiplex Ligation Reaction Based on the Probe Melting Curve Analysis
    Article Snippet: During the detection process, an MCA was performed for each sample after the PCR amplification to detect the target DNA sequence, thus resulting in unique Tm values displayed by the hybrids formed between the Tm tags and their corresponding fluorescent probes in the respective fluorophore channels. .. A 5-μl volume of the previously isolated genomic DNA was denatured at 98 °C for 5 min and allowed to reach 75 °C, and finally, a 3.5-μL reaction mixture containing 1 μL of DNA ligase buffer, 1 unit of Taq DNA ligase (New England Biolabs, Beijing, China), and 1.5 μL of diethylpyrocarbonate (DEPC) water was added to the reaction tube.

    De-Phosphorylation Assay:

    Article Title: Genome-wide colocalization of RNA–DNA interactions and fusion RNA pairs
    Article Snippet: To prepare the RNA and DNA ends for linker ligation, nuclei were incubated in 200 μ L RNA 3′-end dephosphorylation reaction mix [0.5 unit/ μ L T4 PNK (NEB), 0.4 unit/ μ L RNasinPlus, 1 × PNK phosphatase buffer, pH 6.5] at 37 °C for 30 min with mixing. .. For in situ RNA–DNA proximity ligation, nuclei were resuspended in 2 mL of proximity ligation mixture [4 units/ μ L T4 DNA ligase (NEB), 1 × DNA ligase reaction buffer, 0.1% Triton X-100, 1 mg/mL BSA (NEB), 0.5 unit/ μ L RNasinPlus] and incubated at 16 °C overnight.

    IA:

    Article Title: Ratiometric Fluorescence Coding for Multiplex Nucleic Acid Amplification Testing
    Article Snippet: All DNA oligonucleotides including synthetic targets, padlock probes, and primers were purchased from Integrated DNA Technologies, Inc. (Coralville, IA) and both fluorescently labeled peptide nucleic acid (PNA) probes were purchased from PNA Bio (Newbury Park, CA). .. Reagents for ligation, RCA, and HRCA reactions, including 9°N™ DNA ligase, 10× 9°N DNA ligase reaction buffer, T4 gene-32 protein, phi29 DNA polymerase, Exonuclease I ( E. coli ), Exonuclease III ( E. coli ), 10× phi29 DNA polymerase reaction buffer, Bst DNA polymerase, and 10× Bst polymerase reaction buffer were purchased from New England BioLabs, Inc. (Ipswich, MA).

    Article Title: Fluorescence spectroscopic detection and measurement of single telomere molecules
    Article Snippet: All DNA oligonucleotides were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). .. Reagents for ligation and RCA reactions, including 9°N™ DNA Ligase, 10 × 9°N™ DNA Ligase Reaction Buffer, Phage ø29 DNA Polymerase, Exonuclease I (E. coli ), Exonuclease III (E. coli ) and 10 × Isothermal Reaction Buffer were purchased from New England BioLabs, Inc. (Ipswich, MA, USA).

    Chromatin Immunoprecipitation:

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: Paragraph title: Chromatin immunoprecipitation library preparation, enrichment and sequencing ... Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR.

    Software:

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra). .. To define the SNP sequence type of each position on a DNA microarray, fluorescent signal intensities were evaluated using SNPStar software (version 0.0.0.8; Olympus, Tokyo, Japan).

    Multiplex Assay:

    Article Title: Genetic Diversity and Dynamic Distribution of Mycobacterium tuberculosis Isolates Causing Pulmonary and Extrapulmonary Tuberculosis in Thailand
    Article Snippet: .. The encoding mixture, containing 1 μl of multiplex PCR product, 50 nM each 5′ query cED and 3′ query cD1s probe mixture, 1× Taq DNA ligase reaction buffer, and 10 U of T4 DNA ligase (New England BioLabs, Beverly, MA, USA), was incubated at 95°C for 5 min and at 59°C for 15 min and then held at 10°C using a TGradient thermal cycler (Biometra). .. For the labeling reaction, the mixture (12-μl total volume) contained 6 μl of ligation product, 3 nM each D1s primer, 0.5 μM (each)Alexa 647-ED-2 and Alexa 555-ED-1 primer, 1.5× KAPA2G Fast buffer, 4.5 mM Mg2+ , 0.2 mM (each) deoxynucleoside triphosphate (dNTP), and 0.4 U of KAPA2G Fast HotStart DNA polymerase (Kapa Biosystems).

    Article Title: A multiplex oligonucleotide ligation-PCR as a complementary tool for subtyping of Salmonella Typhimurium
    Article Snippet: .. The multiplex oligonucleotide ligation reaction occurred in a 10 μl volume with 1× Taq DNA ligase reaction buffer (New England BioLabs), 2 nM of each probe (Tables , and , Eurogentec), 2 U of Taq DNA ligase (New England BioLabs), 2 μl of DNA template and nuclease-free distilled water (Thermo Fisher Scientific). .. The thermal cycling programme (Swift MaxPro, Esco) included 10 min of denaturation at 95 °C followed by 30 cycles of 25 s at 94 °C and 30 s at 58 °C.

    Article Title: Guidelines for Optimisation of a Multiplex Oligonucleotide Ligation-PCR for Characterisation of Microbial Pathogens in a Microsphere Suspension Array
    Article Snippet: .. Multiplex Oligonucleotide Ligation The multiplex ligation reaction mix combined 1 to 5 nM of each of the 40 probes with 1X Taq DNA ligase reaction buffer (New England BioLabs), 2 to 6 units of Taq DNA ligase (New England BioLabs), and 2 or 4 μ L of template DNA and was brought to a final volume of 10 μ L with nuclease free distilled water (Life Technologies). .. The thermal cycling programme (Swift MaxPro, Esco) included 5 or 10 min of denaturation at 95°C followed by 30 cycles of 25 s at 94°C and 30 s at 58°C ( : Multiplex oligonucleotide ligation).

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay
    Article Snippet: Paragraph title: Multiplex oligonucleotide ligation ... The optimized ligation reaction mix combined 5 nM of each MOLigo probe (Table ) with 2.5 μl of 10X Hifi Taq DNA ligase reaction buffer, 0.5 μl of Hifi Taq DNA ligase (New England BioLabs, Massachusetts, USA), and 2.5 μl of template DNA (corresponds to ∼2.5 ng of isolated DNA).

    Agarose Gel Electrophoresis:

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: Finally, the two dsDNAs were annealed and ligated overnight at 16°C in the presence of T4 DNA ligase in ligase reaction buffer (50 mM Tris, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol, pH 7.5, NEB). .. The 180 bp construct was further purified by running a 3% agarose gel in TBE (Tris/borate/EDTA) buffer for 2 h (6 V/cm).

    Article Title: Biological interactions of CYP2C19 genotypes with CYP3A4*18, CYP3A5*3, and MDR1-3435 in living donor liver transplantation recipients
    Article Snippet: The LDR assay was performed as follows: 10 μL of the reaction mix contained 1 μL of 1× ligase reaction buffer (New England Biolabs, USA), 1 μL of probes (12.5 pmol/μL each), 0.05 μL (2 U) of thermostable Taq DNA ligase (New England Biolabs), and 1 μL of PCR product. .. The products were separated by agarose gel electrophoresis and analyzed with an ABI PRISM 377 DNA sequencer [ ].

    Article Title: Slow extension of the invading DNA strand in a D-loop formed by RecA-mediated homologous recombination may enhance recognition of DNA homology
    Article Snippet: The two dsDNAs (labeled and unlabeled) were annealed and ligated overnight at 16 °C with T4 DNA ligase in ligase reaction buffer (50 mm Tris, 10 mm MgCl2 , 1 mm ATP, and 10 mm DTT, pH 7.5; New England Biolabs). .. The 180-bp construct was purified by running a 3% agarose gel in Tris borate/EDTA buffer for 2 h (6 V/cm).

    In Situ:

    Article Title: Genome-wide colocalization of RNA–DNA interactions and fusion RNA pairs
    Article Snippet: .. For in situ RNA–DNA proximity ligation, nuclei were resuspended in 2 mL of proximity ligation mixture [4 units/ μ L T4 DNA ligase (NEB), 1 × DNA ligase reaction buffer, 0.1% Triton X-100, 1 mg/mL BSA (NEB), 0.5 unit/ μ L RNasinPlus] and incubated at 16 °C overnight. ..

    Hydrophobic Interaction Chromatography:

    Article Title: The positioning of Chi sites allows the RecBCD pathway to suppress some genomic rearrangements
    Article Snippet: MATERIALS AND METHODS Escherichia coli Pol IV was purified from the TMCΔT strain (BL21-AIΔdinB, ΔumuDC, ΔrecA) by ion exchange chromatography and hydrophobic interaction chromatography as previously described ( , ). .. Finally, the two dsDNAs were annealed and ligated overnight at 16°C in the presence of T4 DNA ligase in ligase reaction buffer (50 mM Tris, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol, pH 7.5, NEB).

    Spectrophotometry:

    Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
    Article Snippet: DNA purity was assessed by spectrophotometry, and DNA samples were stored at -20°C. .. The LDR reactions for each PCR product were performed in a final volume of 10 μL, containing 1 μL 10× ligase reaction buffer (New England Biolabs, USA), 2 μL purified PCR product, 0.4 μL 5’ ligase primer (1 μM) mixture (Sangon, China), 0.4 μL 3’ ligase primer (2 μM) mixture (Sangon, China), 0.25 μL Taq DNA ligase (New England Biolabs, USA) and 6 μL double distilled H2 O.

    Produced:

    Article Title: Toll-like receptor 3 activation selectively reverses HIV latency in microglial cells
    Article Snippet: Reactions contained 1× ligase buffer (NEB), 1 mM dNTPs (NEB), 6 units of T4 DNA polymerase (NEB), 2 units or Klenow (NEB), 20 units of T4 Polynucleotide kinase (NEB) and 1.25 units of Taq DNA polymerase (NEB) and incubated at 20° for 30 min followed by 65 °C for an additional 30 min. MiFWD (Sense; TCGTCGGCAGCGTCT), (Antisense; GACGCTGCCGACGA) and MiRVS (Sense; GTCTCGTGGGCTCGGT), (Antisense; CCGAGCCCACGAGAC) adapters were ligated (T4 quick ligase, ThermoFisher) on to the end repaired DNA and Ioncode barcodes were added to each sample using 35 cycle PCR. .. The probes were produced by sonicating the HIV-1pNL4-3 construct to generate 500 bp fragments.

    Lysis:

    Article Title: A method for high-throughput gene expression signature analysis
    Article Snippet: Ligation-mediated amplification Transcripts were captured in oligo-dT coated 384 well plates (GenePlateHT; RNAture) from total RNA (500 ng) in Lysis Buffer (RNAture) or whole cell lysates (20 μl). .. A volume of 5 μl of 1× Taq Ligase Buffer containing 2.5 U Taq DNA ligase (New England Biolabs) was added, the plate covered, spun as before, and incubated at 45°C for one hour followed by 65°C for 10 minutes.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs dna ligase buffer
    The genomic map of fPS-7. The predicted genes are arranged in the direction of transcription shown by different colored arrows. Genes involved in nucleotide metabolism, <t>DNA</t> replication, recombination or repair are shown in green. Genes involved in morphogenesis and virion structures are depicted in brown. Genes involved in DNA packaging and lysis, are shown in blue and red, respectively. Genes coding for hypothetical proteins or conserved phage proteins of unknown function are shown in light grey. Homing endonucleases are shown in yellow. Direct terminal repeats (DTRs) are shown in black. On top of the genome, the host RNA polymerase (RNAP)-dependent promoters are shown with red double-arrows labelled with −35 and −10, and the phage RNAP-dependent promoters with black arrows labelled from P1 to P12. Terminators are shown along the genome as purple triangles and labelled from T1 to <t>T4.</t> The genetic map was created using the Geneious software.
    Dna Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna ligase buffer/product/New England Biolabs
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    dna ligase buffer - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    The genomic map of fPS-7. The predicted genes are arranged in the direction of transcription shown by different colored arrows. Genes involved in nucleotide metabolism, DNA replication, recombination or repair are shown in green. Genes involved in morphogenesis and virion structures are depicted in brown. Genes involved in DNA packaging and lysis, are shown in blue and red, respectively. Genes coding for hypothetical proteins or conserved phage proteins of unknown function are shown in light grey. Homing endonucleases are shown in yellow. Direct terminal repeats (DTRs) are shown in black. On top of the genome, the host RNA polymerase (RNAP)-dependent promoters are shown with red double-arrows labelled with −35 and −10, and the phage RNAP-dependent promoters with black arrows labelled from P1 to P12. Terminators are shown along the genome as purple triangles and labelled from T1 to T4. The genetic map was created using the Geneious software.

    Journal: Viruses

    Article Title: Genomic Characterization of Sixteen Yersinia enterocolitica-Infecting Podoviruses of Pig Origin

    doi: 10.3390/v10040174

    Figure Lengend Snippet: The genomic map of fPS-7. The predicted genes are arranged in the direction of transcription shown by different colored arrows. Genes involved in nucleotide metabolism, DNA replication, recombination or repair are shown in green. Genes involved in morphogenesis and virion structures are depicted in brown. Genes involved in DNA packaging and lysis, are shown in blue and red, respectively. Genes coding for hypothetical proteins or conserved phage proteins of unknown function are shown in light grey. Homing endonucleases are shown in yellow. Direct terminal repeats (DTRs) are shown in black. On top of the genome, the host RNA polymerase (RNAP)-dependent promoters are shown with red double-arrows labelled with −35 and −10, and the phage RNAP-dependent promoters with black arrows labelled from P1 to P12. Terminators are shown along the genome as purple triangles and labelled from T1 to T4. The genetic map was created using the Geneious software.

    Article Snippet: The kinase was then inactivated at 75 °C for 15 min. Ligation of the phosphorylated DNA to a 500 bp fragment of the fliC gene of Y. enterocolitica O:3 was performed in a 30 µL reaction mixture containing ~400 ng of the phosphorylated DNA, ~40 ng of fliC gene fragment, 2 µL of 50% ( w / v ) PEG 4000 (Thermo Scientific), 3 µL of 10 × T4 µL DNA Ligase buffer and 1 µL T4 DNA ligase (New England BioLabs).

    Techniques: Lysis, Software