Structured Review

New England Biolabs atp
Atp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/atp/product/New England Biolabs
Average 99 stars, based on 0 article reviews
Price from $9.99 to $1999.99
atp - by Bioz Stars, 2019-09
99/100 stars

Related Products / Commonly Used Together

mgcl2
nadh-coupled

Images

Related Articles

Clone Assay:

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: Paragraph title: Fusion of HbI with a Lys Tag: Synthesis and Cloning ... The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: Paragraph title: Cloning and sequencing of telomeres. ... The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C.

Amplification:

Article Title: Molecular evidence that the genes for dioecism and monoecism in Spinaciaoleracea L. are located at different loci in a chromosomal region
Article Snippet: AFLP analysis was carried out according to the method of with the following modifications: thedigestion–ligation reaction was prepared in a total volume of 11 μlcontaining 1 μl of 10 × T4 Ligation buffer with ATP (New EnglandBioLabs, Ipswich, MA, USA), 1 μl of 0.5 M NaCl,0.5 μl of 1.0 mg ml−1 BSA,0.1 μ M Eco RI-Adapter, 1 μ M Mse I-Adapter, 1 unit Eco RI (New England BioLabs), 5 units Mse I (New England BioLabs), 67 cohesive end units T4 DNA Ligase (New EnglandBioLabs) and 0.5 μg DNA. .. AFLP analysis was carried out according to the method of with the following modifications: thedigestion–ligation reaction was prepared in a total volume of 11 μlcontaining 1 μl of 10 × T4 Ligation buffer with ATP (New EnglandBioLabs, Ipswich, MA, USA), 1 μl of 0.5 M NaCl,0.5 μl of 1.0 mg ml−1 BSA,0.1 μ M Eco RI-Adapter, 1 μ M Mse I-Adapter, 1 unit Eco RI (New England BioLabs), 5 units Mse I (New England BioLabs), 67 cohesive end units T4 DNA Ligase (New EnglandBioLabs) and 0.5 μg DNA.

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C. .. Ligated genomic DNA was purified by SureClean (Bioline Inc).

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: Following PCR amplification , each DNA molecule was purified by HPLC with a Gen-Pak Fax column (Waters). .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

DNA Synthesis:

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: Paragraph title: DNA synthesis ... Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Synthesized:

Article Title: Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs)
Article Snippet: 70mer oligonucleotides synthesized at the 25 nanomole (nM) scale and hydrated to 100 micromole (μM) in 1× TE Buffer, pH 8.0. .. T4 DNA Ligase Reaction Buffer with 10 mM ATP (New England Biolabs).

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: The 601D-linker and 601E-linker were synthesized by digesting with TspRI in NEB buffer #4 (New England Biolabs) PCR product containing the 601 NPS and TspRI site and PCR product containing the TspRI site and a 90 bp linker DNA. .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Autoradiography:

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated. .. One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated.

Blocking Assay:

Article Title: Decreasing miRNA sequencing bias using a single adapter and circularization approach
Article Snippet: A blocking reaction mix was prepared with 10 μl of the adapter–miRNAs ligation reaction, 2.5 μl of a 10-μM mix of blocking oligo and blocking splint, 400 units of T4 DNA ligase, and 1 unit of T4 polynucleotide kinase (NEB) in 1× T4 RNA ligase buffer in a 20-μl total volume. .. To circularize the miRNA–adapter products, 10 units of T4 RNA ligase 1 and 450 μM ATP (sodium salt at pH 7.0 from NEB) were added to the 20 μl reaction mixture from the adapter blocking step for a final reaction volume of 22 μl. .. Reverse transcription of the circular miRNA–adapter templates was performed with SuperScript IV (Invitrogen).

Article Title:
Article Snippet: For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ). .. The oligos were ligated with T4 DNA ligase (New England BioLabs) and the 154-nt bottom strand was purified as described above.

Electrophoresis:

Article Title: The ChrSA and HrrSA Two-Component Systems Are Required for Transcriptional Regulation of the hemA Promoter in Corynebacterium diphtheriae
Article Snippet: To determine if ChrSGST phosphorylates HrrAHis in vitro , 1 μg of ChrSGST was incubated at 30°C in phosphorylation buffer ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA). .. To determine if ChrSGST phosphorylates HrrAHis in vitro , 1 μg of ChrSGST was incubated at 30°C in phosphorylation buffer ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA).

Article Title: tRNAs Promote Nuclear Import of HIV-1 Intracellular Reverse Transcription Complexes Nuclear Import of HIV-1 Complex Relies on a Surprise Player: tRNA
Article Snippet: The reaction was stopped by phenol/chloroform extraction, and ethanol-precipitated RNA was then 3′-end radiolabelled (10-μl reaction, 37 °C, 30 min, 20 mM Tris-HCl [pH 7.8], 10 mM MgCl2 , 10 mM DTT, 1 mM ATP, 15% DMSO, 26-U T4 RNA ligase [New England Biolabs, Beverly, Massachusetts, United States], 10-μCi 5′-[32 P]pCp). .. The reaction was stopped by phenol/chloroform extraction, and ethanol-precipitated RNA was then 3′-end radiolabelled (10-μl reaction, 37 °C, 30 min, 20 mM Tris-HCl [pH 7.8], 10 mM MgCl2 , 10 mM DTT, 1 mM ATP, 15% DMSO, 26-U T4 RNA ligase [New England Biolabs, Beverly, Massachusetts, United States], 10-μCi 5′-[32 P]pCp).

Incubation:

Article Title: CDK9-dependent RNA polymerase II pausing controls transcription initiation
Article Snippet: The beads were washed six times with IP buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05 % NP-40, and 1% empigen BB) and once with 500 µL of PNKT buffer containing 1 x T4 polynucleotide kinase (PNK) buffer (NEB, Ipswich, MA USA) and 0.1% (vol/vol) Tween-20 (Sigma-Aldrich, St. Louis, MO USA). .. Beads were incubated in 100 µL of PNK reaction mix containing 1 x PNK buffer, 0.1% (vol/vol) Tween-20, 1 mM ATP, and T4 PNK, 3’ phosphatase minus (NEB, Ipswich, MA USA) at 37°C for 10 min. Beads were washed once with IP buffer. .. RNA was extracted with TRIzol reagent.

Article Title: The ChrA Response Regulator in Corynebacterium diphtheriae Controls Hemin-Regulated Gene Expression through Binding to the hmuO and hrtAB Promoter Regions
Article Snippet: DtxR was eluted and dialyzed as indicated for ChrA. .. To assess if ChrS undergoes autophosphorylation, 1 μg of ChrS or GST was incubated at 30°C in phosphorylation buffer (50 mM Tris [pH 7.4], 10% glycerol, 20 mM MgCl2 , 1 M NaCl, 2 mM dithiothreitol [DTT]) ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA). .. The reactions were terminated with the addition of EMSA loading dye (Pierce, Rockford, IL) at the times indicated and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 12% gel ( ).

Article Title: Design of Large-Insert Jumping Libraries for Structural Variant Detection using Illumina Sequencing
Article Snippet: Qiagen column purification, 30ul elution volume. .. 12 Use the following reaction setup to digest overnight (min 12 hour) at 37C: EcoP15I Digest (100ul reaction) Following the 12 hour incubation, add 2uL 25mM ATP (NEB) and 0.5 uL EcoP15I enzyme and incubate for an additional hour, then incubate at 65C for 20 minutes to heat inactivate enzymes. .. 13 Add 1.5uL 25mM (each) dNTP mix and 1ul Klenow (large) fragment to the reaction mixture to end repair the digested DNA.

Article Title: The ChrSA and HrrSA Two-Component Systems Are Required for Transcriptional Regulation of the hemA Promoter in Corynebacterium diphtheriae
Article Snippet: A sequencing ladder for both promoters was prepared by the Sanger method utilizing the USB-Sequenase version 2.0 DNA sequencing kit (USB Corporation, Cleveland, OH) as directed by the manufacturer. .. To determine if ChrSGST phosphorylates HrrAHis in vitro , 1 μg of ChrSGST was incubated at 30°C in phosphorylation buffer ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA). .. Subsequently, 1 μg of HrrAHis was added to the reaction mixture, and the proteins were incubated at 30°C for an additional 10 min. Phosphorylation reaction mixtures containing ChrAHis or BvgA were used as positive and negative controls, respectively.

Article Title: Yeast Nrd1, Nab3, and Sen1 transcriptome-wide binding maps suggest multiple roles in post-transcriptional RNA processing
Article Snippet: The bead suspension was incubated at room temperature for 4 h then washed once with 500 μL of buffer 3 without SDS, and three times with 500 μL of PNK buffer. .. The washed beads were resuspended in 38 μL of PNK buffer with 2 μL 100 μM 5′ adapter oligonucleotide (GUUCAGAGUUCUACAGUCCGACGAUC; IDT), 1.25 μL of RNaseOUT, 2.5 μL of 10 U/μL T4 RNA ligase (Fermentas), and 3 μL of 10 mM ATP (NEB).

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: Binding was quantified by comparing the amount of Nap1 or mutant signal relative to the amount of input MBP-Kap114 signal detected by the imaging system. .. One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated. .. The reaction was stopped by the addition of SDS-PAGE sample buffer.

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: The anchor oligonucleotide (CGTCGGCCGCGTCGTGACT) was phosphorylated at the 5′ end and had an inverted dT attached to the 3′ end by a 3′-3′ phosphodiester bond to allow ligation only to its phosphorylated 5′ end. .. The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C. .. Ligated genomic DNA was purified by SureClean (Bioline Inc).

Article Title:
Article Snippet: These oligos and the 66-nt upstream oligo were annealed with the 66 + 42 and the 42 + 46 complementary “splints” (see A and ) and ligated by addition of 2400 units of T4 DNA ligase (New England BioLabs) in appropriate buffer, and incubation at 37 °C overnight. .. For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ).

Stripping Membranes:

Article Title: Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs)
Article Snippet: T4 DNA Ligase Reaction Buffer with 10 mM ATP (New England Biolabs). .. T4 DNA Ligase Reaction Buffer with 10 mM ATP (New England Biolabs).

Activity Assay:

Article Title: ISWI chromatin remodellers sense nucleosome modifications to determine substrate preference
Article Snippet: In each remodelling reaction, 10 nM of library was used along with varying amounts of remodelling enzyme depending on the baseline activity of each protein preparation. .. Fifty microlitre remodelling assays were carried out in REA buffer (12 mM HEPES, pH 7.9, 4 mM Tris, pH 7.5, 60 mM KCl, 10 mM MgCl2 , 10% glycerol, and 0.02% (v/v) IGEPAL CA-630) with or without 2 mM ATP and in the presence of 2 U/µl PstI restriction enzyme (NEB).

Modification:

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: Oligonucleotides (see Supplementary Table S1 , Sigma) were labeled with a Cy3 NHS ester (GE healthcare) at an amino group attached at the 5′ end or to a modified internal thymine and then purified by RP-High pressure (or high performance) liquid chromatography (HPLC) on a 218TP C18 column (Grace/Vydac). .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Transformation Assay:

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: The transformed clones were isolated, and the presence of the insert [(Lys)6 -tagged rHbI with sticky ends] was confirmed using restriction enzyme digestion ( Nco I-HF and Xho I, New England BioLabs, Inc) and automated DNA sequencing (ABI-Prism 3130 automated DNA sequencer) with dye terminator chemistry (Applied Biosystems, Foster City, CA). .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Kinase Assay:

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: Paragraph title: In vitro kinase assay. ... One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated.

Hybridization:

Article Title: Development of a tissue-specific ribosome profiling approach in Drosophila enables genome-wide evaluation of translational adaptations
Article Snippet: RNA was precipitated from the reaction as described above, and the 3’ adaptor ligation was performed using NEBNext Small RNA Library Prep Set. .. The 5’-phosphate was then added to the mRNA fragments by supplying 2.5 μl 10 mM ATP, 1.5 μl 50 mM DTT and 0.5 μl T4 Polynucleotide Kinase (NEB, M0201S) to the 20 μl 3’ adaptor ligation reaction and incubating at 37°C for 30 min. 1 μl SR RT primer of the NEBNext Small RNA Library Prep Set was then added to the T4 polynucleotide kinase reaction and RT primer hybridization was performed. .. 5’ adaptor ligation, reverse transcription, PCR amplification and size selection of the PCR amplified library were performed using the NEBNext Small RNA Library Prep Set.

High Performance Liquid Chromatography:

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: Following PCR amplification , each DNA molecule was purified by HPLC with a Gen-Pak Fax column (Waters). .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Ligation:

Article Title: Development of a tissue-specific ribosome profiling approach in Drosophila enables genome-wide evaluation of translational adaptations
Article Snippet: RNA was precipitated from the reaction as described above, and the 3’ adaptor ligation was performed using NEBNext Small RNA Library Prep Set. .. The 5’-phosphate was then added to the mRNA fragments by supplying 2.5 μl 10 mM ATP, 1.5 μl 50 mM DTT and 0.5 μl T4 Polynucleotide Kinase (NEB, M0201S) to the 20 μl 3’ adaptor ligation reaction and incubating at 37°C for 30 min. 1 μl SR RT primer of the NEBNext Small RNA Library Prep Set was then added to the T4 polynucleotide kinase reaction and RT primer hybridization was performed. .. 5’ adaptor ligation, reverse transcription, PCR amplification and size selection of the PCR amplified library were performed using the NEBNext Small RNA Library Prep Set.

Article Title: Molecular evidence that the genes for dioecism and monoecism in Spinaciaoleracea L. are located at different loci in a chromosomal region
Article Snippet: F3 progeny plants from two F2 monoecious plants weregrown in a growth chamber (LH-350S, Nippon Medical & Chemical Instruments Co. Ltd,Osaka, Japan) at 20 °C under an 8-h photoperiod during the first 3 weeks, at25 °C under an 8-h photoperiod during the next three weeks and subsequentlyat 25 °C under a 24-h photoperiod. .. AFLP analysis was carried out according to the method of with the following modifications: thedigestion–ligation reaction was prepared in a total volume of 11 μlcontaining 1 μl of 10 × T4 Ligation buffer with ATP (New EnglandBioLabs, Ipswich, MA, USA), 1 μl of 0.5 M NaCl,0.5 μl of 1.0 mg ml−1 BSA,0.1 μ M Eco RI-Adapter, 1 μ M Mse I-Adapter, 1 unit Eco RI (New England BioLabs), 5 units Mse I (New England BioLabs), 67 cohesive end units T4 DNA Ligase (New EnglandBioLabs) and 0.5 μg DNA. .. The reaction was incubated for 2 h at37 °C.

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: Ligation of the insert into the digested pET28(a+) vector was performed using a vector:insert molar ratio of 1:3 (14 fmol pET28a(+) and 43 fmol of (Lys)6 -tagged rHbI DNA insert) in the reaction mixture. .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs). .. The (Lys)6 -tagged rHbI construct was again confirmed by restriction enzyme digestion ( Nco I-HF and Xho I) and automated DNA sequencing, as indicated above, to verify the correct orientation of the insert and for comparison to the reported HbI cDNA sequence, using the basic local alignment sequence tool, BLAST, available from the National Center for Biotechnology Information (NCBI).

Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
Article Snippet: Ligation of genome ends was used to enable sequencing of the 3′ terminus, adapted from a protocol previously developed for influenza virus sequencing [ ]. .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: The anchor oligonucleotide (CGTCGGCCGCGTCGTGACT) was phosphorylated at the 5′ end and had an inverted dT attached to the 3′ end by a 3′-3′ phosphodiester bond to allow ligation only to its phosphorylated 5′ end. .. The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C. .. Ligated genomic DNA was purified by SureClean (Bioline Inc).

Introduce:

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: The 473 bp-PCR product was purified using the QIAquick PCR Purification Kit and cloned into the pCR4® -TOPO cloning vector (Invitrogen) to introduce the sticky ends into the HbI cDNA fragment. .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Generated:

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: This digestion process removed the His-tag from the pET28(a+) cloning site and generated the sticky ends complementary to the insert ends first cloned into the pCR4® -TOPO vector. .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Article Title:
Article Snippet: The top and bottom strands of the DNA fragment were generated separately. .. For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ).

other:

Article Title: Overexpression of cyclin E/CDK2 complexes overcomes FGF-induced cell cycle arrest in the presence of hypophosphorylated Rb proteins
Article Snippet: All chemicals were from Sigma-Aldrich, ATP from New England BioLabs, γP32 ATP from PerkinElmer.

DNA Sequencing:

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: The transformed clones were isolated, and the presence of the insert [(Lys)6 -tagged rHbI with sticky ends] was confirmed using restriction enzyme digestion ( Nco I-HF and Xho I, New England BioLabs, Inc) and automated DNA sequencing (ABI-Prism 3130 automated DNA sequencer) with dye terminator chemistry (Applied Biosystems, Foster City, CA). .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Polymerase Chain Reaction:

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: The 473 bp-PCR product was purified using the QIAquick PCR Purification Kit and cloned into the pCR4® -TOPO cloning vector (Invitrogen) to introduce the sticky ends into the HbI cDNA fragment. .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: Individual telomeres were cloned by a ligation-mediated PCR method ( ). .. The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C.

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: The 601D-linker and 601E-linker were synthesized by digesting with TspRI in NEB buffer #4 (New England Biolabs) PCR product containing the 601 NPS and TspRI site and PCR product containing the TspRI site and a 90 bp linker DNA. .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Recombinant:

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: Binding was quantified by comparing the amount of Nap1 or mutant signal relative to the amount of input MBP-Kap114 signal detected by the imaging system. .. One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated. .. The reaction was stopped by the addition of SDS-PAGE sample buffer.

Fluorescence:

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: The 601E, 601D, 5SD, 5SE, MP2 and components for the 601D-linker and 601E-linker molecules for fluorescence studies were prepared by PCR from plasmid containing the 601 or Xenopus laevis 5S rDNA nucleosome positioning sequence (NPS) and a TspRI restriction site 10 bp downstream of the NPS. .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Mutagenesis:

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: Binding was quantified by comparing the amount of Nap1 or mutant signal relative to the amount of input MBP-Kap114 signal detected by the imaging system. .. One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated. .. The reaction was stopped by the addition of SDS-PAGE sample buffer.

Isolation:

Article Title: CDK9-dependent RNA polymerase II pausing controls transcription initiation
Article Snippet: Isolated chromatin was digested with micrococcal nuclease (MNase) (NEB, Ipswich, MA USA) at 37°C and 1,400 rpm for 90 s. To inactivate MNase, EGTA was added to a final concentration of 25 mM. .. Beads were incubated in 100 µL of PNK reaction mix containing 1 x PNK buffer, 0.1% (vol/vol) Tween-20, 1 mM ATP, and T4 PNK, 3’ phosphatase minus (NEB, Ipswich, MA USA) at 37°C for 10 min. Beads were washed once with IP buffer.

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: The transformed clones were isolated, and the presence of the insert [(Lys)6 -tagged rHbI with sticky ends] was confirmed using restriction enzyme digestion ( Nco I-HF and Xho I, New England BioLabs, Inc) and automated DNA sequencing (ABI-Prism 3130 automated DNA sequencer) with dye terminator chemistry (Applied Biosystems, Foster City, CA). .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Article Title:
Article Snippet: Full-length single-stranded 154-mers were isolated on 6% denaturing polyacrylamide gels containing 8 m urea, bands were identified by staining with ethidium bromide, and the DNA purified from the gel. .. For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ).

Labeling:

Article Title:
Article Snippet: For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ). .. The top strands were radioactively 5′ end-labeled with [γ-32 P]ATP (PerkinElmer Life Sciences) and T4 polynucleotide kinase (New England BioLabs), then annealed to the bottom strand by heating to 95 °C for 10 min, turning off the heating block, and allowing the solutions to cool down slowly.

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: Oligonucleotides (see Supplementary Table S1 , Sigma) were labeled with a Cy3 NHS ester (GE healthcare) at an amino group attached at the 5′ end or to a modified internal thymine and then purified by RP-High pressure (or high performance) liquid chromatography (HPLC) on a 218TP C18 column (Grace/Vydac). .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Purification:

Article Title: CDK9-dependent RNA polymerase II pausing controls transcription initiation
Article Snippet: Beads were incubated in 100 µL of PNK reaction mix containing 1 x PNK buffer, 0.1% (vol/vol) Tween-20, 1 mM ATP, and T4 PNK, 3’ phosphatase minus (NEB, Ipswich, MA USA) at 37°C for 10 min. Beads were washed once with IP buffer. .. Beads were incubated in 100 µL of PNK reaction mix containing 1 x PNK buffer, 0.1% (vol/vol) Tween-20, 1 mM ATP, and T4 PNK, 3’ phosphatase minus (NEB, Ipswich, MA USA) at 37°C for 10 min. Beads were washed once with IP buffer.

Article Title: Residues of the Rotavirus RNA-Dependent RNA Polymerase Template Entry Tunnel That Mediate RNA Recognition and Genome Replication
Article Snippet: Reaction mixtures (20 μl) contained 50 mM Tris-HCl (pH 7.1), 1.5% polyethylene glycol (PEG) 8000, 2.5 mM dithiothreitol, 20 mM magnesium acetate, 1.6 mM manganese chloride, 1.25 mM (each) ATP, CTP, and UTP, 5 mM GTP, 2 U RNase inhibitor (New England Biolabs), 10 μCi [α-32 P]UTP (3,000 Ci/mmol), 8 pmol of SA11 gene 8 RV +RNA, ∼2 pmol of VP1, and ∼20 pmol of VP2 ( ). .. Reaction mixtures (20 μl) contained 50 mM Tris-HCl (pH 7.1), 1.5% polyethylene glycol (PEG) 8000, 2.5 mM dithiothreitol, 20 mM magnesium acetate, 1.6 mM manganese chloride, 1.25 mM (each) ATP, CTP, and UTP, 5 mM GTP, 2 U RNase inhibitor (New England Biolabs), 10 μCi [α-32 P]UTP (3,000 Ci/mmol), 8 pmol of SA11 gene 8 RV +RNA, ∼2 pmol of VP1, and ∼20 pmol of VP2 ( ).

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: The 473 bp-PCR product was purified using the QIAquick PCR Purification Kit and cloned into the pCR4® -TOPO cloning vector (Invitrogen) to introduce the sticky ends into the HbI cDNA fragment. .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C. .. Telomere fragments were amplified by PCR, using a subtelomeric primer (GACCGGGCCCAGCAGGACCAAG) present internally to 11 out of the 12 K. lactis telomeres and a primer complementary to the anchor oligonucleotides (AGTCACGACGCGGCCGACG).

Article Title: Loop II of DNA Polymerase Beta is Important for Discrimination During Substrate Binding
Article Snippet: Ultrapure deoxynucleoside triphosphates (dNTPs), ATP, and [γ32 P]ATP were purchased from New England Biolabs, Sigma, and GE Healthcare, respectively. .. All oligonucleotides used for DNA substrates in this study were synthesized by the Keck Molecular Biology Center at Yale University School of Medicine.

Article Title:
Article Snippet: Full-length single-stranded 154-mers were isolated on 6% denaturing polyacrylamide gels containing 8 m urea, bands were identified by staining with ethidium bromide, and the DNA purified from the gel. .. For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ).

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: The 601D-linker and 601E-linker were synthesized by digesting with TspRI in NEB buffer #4 (New England Biolabs) PCR product containing the 601 NPS and TspRI site and PCR product containing the TspRI site and a 90 bp linker DNA. .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments. .. Xenopus laevis recombinant histones were expressed and purified as previously described ( ).

Sequencing:

Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
Article Snippet: Ligation of genome ends was used to enable sequencing of the 3′ terminus, adapted from a protocol previously developed for influenza virus sequencing [ ]. .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: Paragraph title: Cloning and sequencing of telomeres. ... The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C.

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: The 601E, 601D, 5SD, 5SE, MP2 and components for the 601D-linker and 601E-linker molecules for fluorescence studies were prepared by PCR from plasmid containing the 601 or Xenopus laevis 5S rDNA nucleosome positioning sequence (NPS) and a TspRI restriction site 10 bp downstream of the NPS. .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

Polyacrylamide Gel Electrophoresis:

Article Title: Loop II of DNA Polymerase Beta is Important for Discrimination During Substrate Binding
Article Snippet: Ultrapure deoxynucleoside triphosphates (dNTPs), ATP, and [γ32 P]ATP were purchased from New England Biolabs, Sigma, and GE Healthcare, respectively. .. All oligonucleotides used for DNA substrates in this study were synthesized by the Keck Molecular Biology Center at Yale University School of Medicine.

Staining:

Article Title: The ChrA Response Regulator in Corynebacterium diphtheriae Controls Hemin-Regulated Gene Expression through Binding to the hmuO and hrtAB Promoter Regions
Article Snippet: To assess if ChrS undergoes autophosphorylation, 1 μg of ChrS or GST was incubated at 30°C in phosphorylation buffer (50 mM Tris [pH 7.4], 10% glycerol, 20 mM MgCl2 , 1 M NaCl, 2 mM dithiothreitol [DTT]) ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA). .. To assess if ChrS undergoes autophosphorylation, 1 μg of ChrS or GST was incubated at 30°C in phosphorylation buffer (50 mM Tris [pH 7.4], 10% glycerol, 20 mM MgCl2 , 1 M NaCl, 2 mM dithiothreitol [DTT]) ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA).

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated. .. One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated.

Article Title:
Article Snippet: Full-length single-stranded 154-mers were isolated on 6% denaturing polyacrylamide gels containing 8 m urea, bands were identified by staining with ethidium bromide, and the DNA purified from the gel. .. For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ).

cDNA Library Assay:

Article Title: Yeast Nrd1, Nab3, and Sen1 transcriptome-wide binding maps suggest multiple roles in post-transcriptional RNA processing
Article Snippet: Paragraph title: cDNA library construction from cross-linked RNA ... The washed beads were resuspended in 38 μL of PNK buffer with 2 μL 100 μM 5′ adapter oligonucleotide (GUUCAGAGUUCUACAGUCCGACGAUC; IDT), 1.25 μL of RNaseOUT, 2.5 μL of 10 U/μL T4 RNA ligase (Fermentas), and 3 μL of 10 mM ATP (NEB).

Rapid Amplification of cDNA Ends:

Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Ligation was followed by hemi-nested PCR amplification using a Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), then an Expand High Fidelity PCR System (Roche, Basel, Switzerland).

SDS Page:

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated. .. One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated.

Plasmid Preparation:

Article Title: Molecular Cloning and Characterization of a (Lys)6-Tagged Sulfide-Reactive Hemoglobin I from Lucina pectinata
Article Snippet: Ligation of the insert into the digested pET28(a+) vector was performed using a vector:insert molar ratio of 1:3 (14 fmol pET28a(+) and 43 fmol of (Lys)6 -tagged rHbI DNA insert) in the reaction mixture. .. The ligation reaction was done in 10 μL containing 1X Ligase Reaction Buffer with 1 mM ATP and T4 DNA ligase (3 Weiss units, New England Biolabs).

Article Title: A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Article Snippet: The ligation reaction mixture (20 μl) contained 60 pmol anchor oligonucleotide, 0.5 μg genomic DNA, 50 mM Tris-HCl (pH 8), 10 mM MgCl2 , 1 mM dithiothreitol, 12.5% polyethylene glycol 8000, 1 mM hexamine cobalt chloride, 20 μM ATP (freshly added), 10 μg/ml bovine serum albumin, and 10 units RNA ligase (New England Biolabs) and was incubated for 90 min at 37°C. .. Telomere fragments were amplified by PCR, using a subtelomeric primer (GACCGGGCCCAGCAGGACCAAG) present internally to 11 out of the 12 K. lactis telomeres and a primer complementary to the anchor oligonucleotides (AGTCACGACGCGGCCGACG).

Article Title: ATP-dependent nucleosome unwrapping catalyzed by human RAD51
Article Snippet: The 601E, 601D, 5SD, 5SE, MP2 and components for the 601D-linker and 601E-linker molecules for fluorescence studies were prepared by PCR from plasmid containing the 601 or Xenopus laevis 5S rDNA nucleosome positioning sequence (NPS) and a TspRI restriction site 10 bp downstream of the NPS. .. Digested NPS and linker fragments were purified by Gen-Pak Fax column, ligated with T4 ligase in supplied buffer plus 2 mM ATP (New England Biolabs) and purified by Gen-Pak Fax column to remove unligated fragments.

In Vitro:

Article Title: Residues of the Rotavirus RNA-Dependent RNA Polymerase Template Entry Tunnel That Mediate RNA Recognition and Genome Replication
Article Snippet: Paragraph title: In vitro RNA replication assay. ... Reaction mixtures (20 μl) contained 50 mM Tris-HCl (pH 7.1), 1.5% polyethylene glycol (PEG) 8000, 2.5 mM dithiothreitol, 20 mM magnesium acetate, 1.6 mM manganese chloride, 1.25 mM (each) ATP, CTP, and UTP, 5 mM GTP, 2 U RNase inhibitor (New England Biolabs), 10 μCi [α-32 P]UTP (3,000 Ci/mmol), 8 pmol of SA11 gene 8 RV +RNA, ∼2 pmol of VP1, and ∼20 pmol of VP2 ( ).

Article Title: The ChrA Response Regulator in Corynebacterium diphtheriae Controls Hemin-Regulated Gene Expression through Binding to the hmuO and hrtAB Promoter Regions
Article Snippet: Paragraph title: In vitro phosphorylation assays. ... To assess if ChrS undergoes autophosphorylation, 1 μg of ChrS or GST was incubated at 30°C in phosphorylation buffer (50 mM Tris [pH 7.4], 10% glycerol, 20 mM MgCl2 , 1 M NaCl, 2 mM dithiothreitol [DTT]) ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA).

Article Title: The ChrSA and HrrSA Two-Component Systems Are Required for Transcriptional Regulation of the hemA Promoter in Corynebacterium diphtheriae
Article Snippet: A sequencing ladder for both promoters was prepared by the Sanger method utilizing the USB-Sequenase version 2.0 DNA sequencing kit (USB Corporation, Cleveland, OH) as directed by the manufacturer. .. To determine if ChrSGST phosphorylates HrrAHis in vitro , 1 μg of ChrSGST was incubated at 30°C in phosphorylation buffer ( ) in the presence or absence of 1 mM ATP (New England BioLabs, Ipswich, MA). .. Subsequently, 1 μg of HrrAHis was added to the reaction mixture, and the proteins were incubated at 30°C for an additional 10 min. Phosphorylation reaction mixtures containing ChrAHis or BvgA were used as positive and negative controls, respectively.

Article Title: Phosphorylation by Casein Kinase 2 Regulates Nap1 Localization and Function
Article Snippet: Paragraph title: In vitro kinase assay. ... One microgram of GST-Nap1 or Nap1 mutant was incubated with 0.2 mM ATP, 1 μCi of [γ-32 P]ATP, and 0.2 μl human recombinant CK2 (NEB, Beverley, MA) at 30°C for 30 min or as indicated.

Concentration Assay:

Article Title: CDK9-dependent RNA polymerase II pausing controls transcription initiation
Article Snippet: Isolated chromatin was digested with micrococcal nuclease (MNase) (NEB, Ipswich, MA USA) at 37°C and 1,400 rpm for 90 s. To inactivate MNase, EGTA was added to a final concentration of 25 mM. .. Beads were incubated in 100 µL of PNK reaction mix containing 1 x PNK buffer, 0.1% (vol/vol) Tween-20, 1 mM ATP, and T4 PNK, 3’ phosphatase minus (NEB, Ipswich, MA USA) at 37°C for 10 min. Beads were washed once with IP buffer.

End Labeling:

Article Title:
Article Snippet: For the bottom strand a 74-nt oligomer was 5′-phosphorylated with ATP and T4 polynucleotide kinase (New England BioLabs) as above, then annealed with the 74 + 80 splint and an 80-nt oligomer ( A and ). .. The labeled double-stranded DNAs were isolated on non-denaturing 6% polyacrylamide gels, the wet gels were exposed to x-ray film, and the DNA eluted from the gel slice by crushing and soaking in 10 m m Tris, pH 8.0, and 1 m m EDTA (TE) overnight.

Gel Extraction:

Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 ligase buffer
    T4 Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 ligase buffer/product/New England Biolabs
    Average 99 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    t4 ligase buffer - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 dna ligase buffer
    T4 Dna Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase buffer/product/New England Biolabs
    Average 99 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase buffer - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results