t4 kinase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs t4 kinase
    T4 Kinase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 kinase/product/New England Biolabs
    Average 99 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    t4 kinase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: Lysate was dounced and clarified by centrifugation at maximum speed at 4°C. .. The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Amplification:

    Article Title: ChIP-seq: using high-throughput sequencing to discover protein-DNA interactions
    Article Snippet: In order to control for any such bias, we recommend performing the same procedure on the LMPCR amplified input material that was used in the original ChIP-chip experiment. .. Add 5 ul of 10X PNK buffer (NEB, B0201S) to cleaned ChIP-chip library and heat to 70 °C for 10 min and chill on ice immediately (this may increase the efficiency of the subsequent phosphorylation step but can be omitted).

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB). .. The reaction was incubated for 30 min at 37°C and then heat inactivated for 20 min at 65°C.), a mixture of 12,472 array-synthesized oligos was obtained from CustomArray, Inc. Each oligo is ∼126-bp long with a common sequence containing a Nt.BsmAI site and connecting the two probes (LSP1\LSP2) in the middle, flanked by two universal primer sequences (containing Nt.AlwI and Nb.BsrDI sites) for oligo amplification.

    De-Phosphorylation Assay:

    Article Title: Increased efficiency of evolved group I intron spliceozymes by decreased side product formation
    Article Snippet: Substrates were dephosphorylated at 37°C for 1 h. Ten microliters of dephosphorylation reactions contained 2 ng substrate oligonucleotide, 1× Antarctic Phosphatase Reaction Buffer and 5 units Antarctic Phosphatase (New England Biolabs). .. Substrates were then 5′ radiolabeled at 37°C for 1 h. Twenty microliters labeling reactions consisted of 20 pmol RNA substrate, 20 μCi [γ-32 P]-ATP, 1× T4 Polynucleotide Kinase Reaction Buffer and 10 units T4 Polynucleotide Kinase (New England Biolabs).

    Positive Control:

    Article Title: PPARβ activation inhibits melanoma cell proliferation involving repression of the Wilms’ tumour suppressor WT1
    Article Snippet: The PPAR responsive element from the acyl-CoA oxidase gene (5′-CCCGAACGTGACCTTTGTCCTGGTCC-3′) served as positive control. .. Annealed oligonucleotides were 32 P-end labelled in a T4 polynucleotide kinase reaction (New England Biolabs, Ozyme, Saint Quentin Yvelines, France).

    Construct:

    Article Title: A microfluidic oligonucleotide synthesizer
    Article Snippet: .. Ligation assembly of DNA constructs Each oligonucleotide strand (8 µl, 5 µM) was mixed with 1 µl of T4 polynucleotide kinase reaction buffer (New England Biolabs) and 1 µl of 10 mM ATP, then cooled to 4°C. ..

    Incubation:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB). .. The reaction was incubated for 30 min at 37°C and then heat inactivated for 20 min at 65°C.), a mixture of 12,472 array-synthesized oligos was obtained from CustomArray, Inc. Each oligo is ∼126-bp long with a common sequence containing a Nt.BsmAI site and connecting the two probes (LSP1\LSP2) in the middle, flanked by two universal primer sequences (containing Nt.AlwI and Nb.BsrDI sites) for oligo amplification.

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: .. Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted. .. Glycoblue (Life Technologies) was used a co-precipitant during ethanol precipitation.

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: The supernatant was incubated with protein A/G agarose beads (Thermo Fisher, 20421) preconjugated with rabbit polyclonal anti-GFP (Covance, affinity-purified in our laboratory) or anti-Piwi ( ) for 2 h at 4°C. .. The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: To prepare the ends of the fragments for adapter ligation and library preparation, the samples were first heated at 70°C for 10 minutes and then mixed with 10x T4 PNK Reaction Buffer, 20 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs). .. This was incubated at 37°C for 1 hour, followed by a heat inactivation of the enzyme at 65°C for 20 minutes and a final phenol:chloroform cleanup step and overnight ethanol precipitation.

    Article Title: Mechanism of HIV-1 RNA Dimerization in the Central Region of the Genome and Significance for Viral Evolution *
    Article Snippet: The gel-cleaned RNA template was treated with shrimp alkaline phosphatase (Fermentas) at 37 °C for 60 min and then incubated at 65 °C for 25 min to inactivate the enzyme. .. After cooling on ice, the reaction mixture was treated with [γ-32 P]ATP (6000 Ci/mmol), 10× PNK T4 Polynucleotide Kinase Reaction buffer and T4 polynucleotide kinase (New England Biolabs).

    Article Title: Increased efficiency of evolved group I intron spliceozymes by decreased side product formation
    Article Snippet: Each short substrate was incubated with an excess of spliceozyme to generate the cleavage products. .. Substrates were then 5′ radiolabeled at 37°C for 1 h. Twenty microliters labeling reactions consisted of 20 pmol RNA substrate, 20 μCi [γ-32 P]-ATP, 1× T4 Polynucleotide Kinase Reaction Buffer and 10 units T4 Polynucleotide Kinase (New England Biolabs).

    Expressing:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: Ovaries (∼100 per immunoprecipitation) from flies expressing UASp-λN-eGFP-Piwi, UASp-λN-eGFP-Aub, or UASp-Zuc-HA-λN with UASp-GFP-Piwi, and the UASp-mKate2-4xBoxB-K10 polyA reporter line driven by maternal α-tubulin67C-Gal4 were dissected and lysed on ice in 250 µL of lysis buffer [30 mM Hepes-KOH at pH7.4, 100 mM KOAc, 2 mM Mg(OAc)2 , 5 mM DTT, 0.5% (v/v) NP40, proteinase inhibitor (Roche, 11836170001), RNasin Plus (Promega, N2611)]. .. The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Modification:

    Article Title: Txe, an endoribonuclease of the enterococcal Axe-Txe toxin-antitoxin system, cleaves mRNA and inhibits protein synthesis
    Article Snippet: Primer lpp 21 (5′-CTGAACGTCAGAAGACAGCTGATCG-3′) ( ) was 5′-end-labelled with [γ -32 P]ATP according to a modification of the protocol reported by . .. In a 10 μl reaction volume, 10 pmol of the lpp 21 primer was mixed with 1 μl 10× T4 polynucleotide kinase (PNK) reaction buffer (NEB), 1 μl 10 U T4 PNK (NEB) ml−1 and 3 μl [γ -32 P]ATP [6 mCi mmol−1 (222 MBq mmol−1 ), 10 mCi ml−1 (370 MBq ml−1 ) or adjusted appropriately for decay].

    Hybridization:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: Probes were designed by meeting three criteria: (1) Each probe contains a ∼20 bp locus-specific sequence, while keeping a certain-size gap (e.g., SNP + 4Ns or Microsatellite + 4Ns; here 4Ns are set for checking hybridization specificity during reads mapping) between LSP1 and LSP2; (2) the GC content and melting temperatures of probes are in the range of 40%–60% and 55°C–65°C, respectively; and (3) probes have unique locations in the reference genome/transcriptome, i.e., no sequence similarity to nontarget regions by allowing up to two mismatches. .. The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB).

    Flow Cytometry:

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: The RNA flow-through was precipitated overnight, with ethanol and sodium acetate in −80°C. .. To prepare the ends of the fragments for adapter ligation and library preparation, the samples were first heated at 70°C for 10 minutes and then mixed with 10x T4 PNK Reaction Buffer, 20 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs).

    Chromatography:

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: To desalt the reaction, all samples were passaged through Micro Bio-Spin 6 chromatography columns, following the manufacturer's instructions (732–6221; Bio-Rad), and next desulfonated by adding an equal volume of 1 M Tris (pH 9.0) to the reaction mixture and incubating for 1 hour at 37°C. .. To repair the 2′,3′-cyclic phosphate and 5'-hydroxyl termini produced during the BS/desulfonation reaction, T4 Polynucleotide Kinase (PNK) was used by mixing the RNA with 10x T4 PNK reaction buffer, 10 mM ATP, 10 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs).

    Ligation:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: The 5′-end phosphorylation reaction was performed for LSP2 probe pools to allow for subsequent ligation. .. The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB).

    Article Title: Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method
    Article Snippet: .. Linear Acrylamide (Life Technologies, cat. no. AM9520) Sodium periodate (Sigma-Aldrich, cat. no. 311448) T4 Polynucleotide Kinase (T4 PNK; New England Biolabs Inc, cat. no. M0201) 10× T4 Polynucleotide Kinase Reaction Buffer (supplied with T4 PNK) Adenosine 5′-Triphosphate (ATP) (New England Biolabs Inc, cat. no. P0756) TruSeq Small RNA Library Preparation Kits (Illumina, cat. no. RS-200-0012), containing RNA 3′ Adapter, Ligation Buffer, Stop Solution, RNA 5′ Adapter, 10 mM ATP, T4 RNA Ligase, 25 mM dNTP mix, RNA RT Primer, PCR Mix, RNA PCR Primer, RNA PCR Primer Index, and High Resolution Ladder. .. T4 RNA Ligase 2, truncated (New England Biolabs Inc, cat. no. M0242L) SuperScript III Reverse Transcriptase (Life Technologies, cat. no. 18080-044) containing 5× First Strand Buffer and 100 mM DTT.

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: .. To prepare the ends of the fragments for adapter ligation and library preparation, the samples were first heated at 70°C for 10 minutes and then mixed with 10x T4 PNK Reaction Buffer, 20 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs). .. This was incubated at 37°C for 1 hour, followed by a heat inactivation of the enzyme at 65°C for 20 minutes and a final phenol:chloroform cleanup step and overnight ethanol precipitation.

    Article Title: A microfluidic oligonucleotide synthesizer
    Article Snippet: .. Ligation assembly of DNA constructs Each oligonucleotide strand (8 µl, 5 µM) was mixed with 1 µl of T4 polynucleotide kinase reaction buffer (New England Biolabs) and 1 µl of 10 mM ATP, then cooled to 4°C. ..

    Introduce:

    Article Title: ChIP-seq: using high-throughput sequencing to discover protein-DNA interactions
    Article Snippet: While it is possible that additional amplifications during the Solexa library preparation could introduce bias into the results, we have obtained ChIP-seq results from ChIP-chip libraries that are fully consistent with the original ChIP-chip experiment. .. Add 5 ul of 10X PNK buffer (NEB, B0201S) to cleaned ChIP-chip library and heat to 70 °C for 10 min and chill on ice immediately (this may increase the efficiency of the subsequent phosphorylation step but can be omitted).

    Generated:

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: A radiolabeled probe was generated from a known CLOCK-BMAL1 binding site from the Cry1 locus containing an E-box sequence (CACGTG) or control DNA containing a scrambled E-box (CGATCG) using a standard procedure. .. Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted.

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: To prepare the ends of the fragments for adapter ligation and library preparation, the samples were first heated at 70°C for 10 minutes and then mixed with 10x T4 PNK Reaction Buffer, 20 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs). .. The libraries were generated using the TruSeq Small RNA Preparation Kit (Illumina), for which 3′ adenylated and 5′ phosphorylated adapters, suitable for Illumina RNA-seq, were ligated to an average of 400 ng small purified RNA fractions.

    Article Title: PPARβ activation inhibits melanoma cell proliferation involving repression of the Wilms’ tumour suppressor WT1
    Article Snippet: Annealed oligonucleotides were 32 P-end labelled in a T4 polynucleotide kinase reaction (New England Biolabs, Ozyme, Saint Quentin Yvelines, France). .. PPARβ and RxRα proteins were generated from full-length cDNAs in pSG5 vector (Stratagene) using the coupled TNT in-vitro-transcription-translation system (Promega, Charbonnières-les Bains, France).

    Article Title: Increased efficiency of evolved group I intron spliceozymes by decreased side product formation
    Article Snippet: Substrate RNA oligonucleotides (below) that contained the suspected splice sites as shown by the RNAse H assays, were generated by run-off transcription and purified by 10% PAGE. .. Substrates were then 5′ radiolabeled at 37°C for 1 h. Twenty microliters labeling reactions consisted of 20 pmol RNA substrate, 20 μCi [γ-32 P]-ATP, 1× T4 Polynucleotide Kinase Reaction Buffer and 10 units T4 Polynucleotide Kinase (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: The unique molecular identifier (UMI) was not included in our probe design, but when PCR duplicates are of significant concern, the use of UMI can offer an accurate estimation of allele frequency.), column-synthesized probes were obtained from Sangon Biotech. .. The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB).

    Article Title: Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method
    Article Snippet: .. Linear Acrylamide (Life Technologies, cat. no. AM9520) Sodium periodate (Sigma-Aldrich, cat. no. 311448) T4 Polynucleotide Kinase (T4 PNK; New England Biolabs Inc, cat. no. M0201) 10× T4 Polynucleotide Kinase Reaction Buffer (supplied with T4 PNK) Adenosine 5′-Triphosphate (ATP) (New England Biolabs Inc, cat. no. P0756) TruSeq Small RNA Library Preparation Kits (Illumina, cat. no. RS-200-0012), containing RNA 3′ Adapter, Ligation Buffer, Stop Solution, RNA 5′ Adapter, 10 mM ATP, T4 RNA Ligase, 25 mM dNTP mix, RNA RT Primer, PCR Mix, RNA PCR Primer, RNA PCR Primer Index, and High Resolution Ladder. .. T4 RNA Ligase 2, truncated (New England Biolabs Inc, cat. no. M0242L) SuperScript III Reverse Transcriptase (Life Technologies, cat. no. 18080-044) containing 5× First Strand Buffer and 100 mM DTT.

    Affinity Purification:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: The supernatant was incubated with protein A/G agarose beads (Thermo Fisher, 20421) preconjugated with rabbit polyclonal anti-GFP (Covance, affinity-purified in our laboratory) or anti-Piwi ( ) for 2 h at 4°C. .. The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Binding Assay:

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: A radiolabeled probe was generated from a known CLOCK-BMAL1 binding site from the Cry1 locus containing an E-box sequence (CACGTG) or control DNA containing a scrambled E-box (CGATCG) using a standard procedure. .. Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted.

    Article Title: PPARβ activation inhibits melanoma cell proliferation involving repression of the Wilms’ tumour suppressor WT1
    Article Snippet: Annealed oligonucleotides were 32 P-end labelled in a T4 polynucleotide kinase reaction (New England Biolabs, Ozyme, Saint Quentin Yvelines, France). .. DNA binding reactions were performed on ice for 30 min with approximately 20 ng of proteins in 15 µl of a 1× reaction buffer containing 10 mM Tris–HCl, pH 7.5, 50 mM KCl, 50 mM NaCl, 1 mM MgCl2 , 1 mM EDTA, 5 mM DTT, 5% glycerol and 0.025 mg/ml denatured herring sperm DNA.

    ChIP-chip:

    Article Title: ChIP-seq: using high-throughput sequencing to discover protein-DNA interactions
    Article Snippet: .. Add 5 ul of 10X PNK buffer (NEB, B0201S) to cleaned ChIP-chip library and heat to 70 °C for 10 min and chill on ice immediately (this may increase the efficiency of the subsequent phosphorylation step but can be omitted). .. Add 5 μl (50U) PNK (NEB, M0201S) and 5 μl 10 mM ATP and incubate at 37 °C for 1-2 hours.

    ChIP-sequencing:

    Article Title: ChIP-seq: using high-throughput sequencing to discover protein-DNA interactions
    Article Snippet: Paragraph title: 2.2.13. Optional rescue of traditional ChIP-chip libraries for ChIP-seq ... Add 5 ul of 10X PNK buffer (NEB, B0201S) to cleaned ChIP-chip library and heat to 70 °C for 10 min and chill on ice immediately (this may increase the efficiency of the subsequent phosphorylation step but can be omitted).

    RNA Sequencing Assay:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: Paragraph title: Immunoprecipitation small RNA-seq ... The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: Paragraph title: Standard and small RNA-seq ... To prepare the ends of the fragments for adapter ligation and library preparation, the samples were first heated at 70°C for 10 minutes and then mixed with 10x T4 PNK Reaction Buffer, 20 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs).

    Magnetic Beads:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB). .. The LSP1 and LSP2 probes were obtained from these array-synthesized oligos through the steps of PCR amplification, enzyme digestion, and isolation by magnetic beads described as follows.

    Isolation:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB). .. The LSP1 and LSP2 probes were obtained from these array-synthesized oligos through the steps of PCR amplification, enzyme digestion, and isolation by magnetic beads described as follows.

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: The immunoprecipitation and RNA isolation were carried out as described previously ( ). .. The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Electrophoretic Mobility Shift Assay:

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: Paragraph title: Electrophoretic Mobility Shift Assay (EMSA) ... Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted.

    Article Title: PPARβ activation inhibits melanoma cell proliferation involving repression of the Wilms’ tumour suppressor WT1
    Article Snippet: Paragraph title: Electrophoretic mobility shift assays ... Annealed oligonucleotides were 32 P-end labelled in a T4 polynucleotide kinase reaction (New England Biolabs, Ozyme, Saint Quentin Yvelines, France).

    Purification:

    Article Title: Mismatched Primer Extension Assays
    Article Snippet: .. Deoxynucleoside triphosphate (Roche Diagnostics, catalog number: 11969064001) Gamma [γ-32 P] ATP (PerkinElmer, catalog number: Blu502A001MC) G-25 Macro spin columns (best suited for volumes of 75-150 μl) (Harvard Apparatus, catalog number: 74-3901) 40% Acrylamide-Bisacrylamide (19:1) solution (VWR International, catalog number: JT4969-0) T4 polynucleotide kinase (PNK) (New England Biolabs, catalog number: M0201L) 10X T4 polynucleotide kinase buffer (New England Biolabs, catalog number: B0201S) Urea (VWR International, catalog number: 97061-926) Ammonium Persulfate (VWR International, catalog number: 97064-594) HIV Reverse Transcriptase, purified as described in DNA oligonucleotides from Integrated DNA Technologies Template: 5'-GGGCGAATTTAG[ G/C ]TTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTG G-3’. ..

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted. .. Nuclear PER complex, purified as previously described , was incubated with 15 nM EMSA probe and a range of 50 nM to 0 nM unlabeled EMSA probe in a final volume of 10 μl for 1 hr at 30°C.

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: To prepare the ends of the fragments for adapter ligation and library preparation, the samples were first heated at 70°C for 10 minutes and then mixed with 10x T4 PNK Reaction Buffer, 20 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs). .. The libraries were generated using the TruSeq Small RNA Preparation Kit (Illumina), for which 3′ adenylated and 5′ phosphorylated adapters, suitable for Illumina RNA-seq, were ligated to an average of 400 ng small purified RNA fractions.

    Article Title: A biochemically active MCM-like helicase in Bacillus cereus
    Article Snippet: The labeling reaction consists of incubating 10 pmol of oligonucleotide (DF50; Supplementary Table 2 ) with 2.5 μl 10× T4 polynucleotide kinase reaction buffer (New England Biolabs (NEB)), 1 μl T4 polynucleotide kinase (NEB), and 5 μl [γ32 P]ATP in a total volume of 25 μl at 37°C for 75 min. .. The reaction was stopped by adding 1 μl of 0.5 M EDTA–NaOH/pH 8, and then purified by centrifuging the oligonucleotide through G50 desalting beads twice at 0.7RCF for 1 min each time.

    Article Title: Increased efficiency of evolved group I intron spliceozymes by decreased side product formation
    Article Snippet: Substrate RNA oligonucleotides (below) that contained the suspected splice sites as shown by the RNAse H assays, were generated by run-off transcription and purified by 10% PAGE. .. Substrates were then 5′ radiolabeled at 37°C for 1 h. Twenty microliters labeling reactions consisted of 20 pmol RNA substrate, 20 μCi [γ-32 P]-ATP, 1× T4 Polynucleotide Kinase Reaction Buffer and 10 units T4 Polynucleotide Kinase (New England Biolabs).

    Sequencing:

    Article Title: ChIP-seq: using high-throughput sequencing to discover protein-DNA interactions
    Article Snippet: Otherwise, the first 25 bases would be the original ChIP-chip linker sequence. .. Add 5 ul of 10X PNK buffer (NEB, B0201S) to cleaned ChIP-chip library and heat to 70 °C for 10 min and chill on ice immediately (this may increase the efficiency of the subsequent phosphorylation step but can be omitted).

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: Probes were designed by meeting three criteria: (1) Each probe contains a ∼20 bp locus-specific sequence, while keeping a certain-size gap (e.g., SNP + 4Ns or Microsatellite + 4Ns; here 4Ns are set for checking hybridization specificity during reads mapping) between LSP1 and LSP2; (2) the GC content and melting temperatures of probes are in the range of 40%–60% and 55°C–65°C, respectively; and (3) probes have unique locations in the reference genome/transcriptome, i.e., no sequence similarity to nontarget regions by allowing up to two mismatches. .. The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB).

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: A radiolabeled probe was generated from a known CLOCK-BMAL1 binding site from the Cry1 locus containing an E-box sequence (CACGTG) or control DNA containing a scrambled E-box (CGATCG) using a standard procedure. .. Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted.

    Article Title: PPARβ activation inhibits melanoma cell proliferation involving repression of the Wilms’ tumour suppressor WT1
    Article Snippet: Electrophoretic mobility shift assays The putative PPAR responsive element from the WT1 promoter contained the following sequence: 5′-TAGCCTCTAGAATTCTGGACATGGGA-3′. .. Annealed oligonucleotides were 32 P-end labelled in a T4 polynucleotide kinase reaction (New England Biolabs, Ozyme, Saint Quentin Yvelines, France).

    Labeling:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C. .. Size selection, library preparation, and analysis were performed as described above, except that fragments were gel-extracted based on labeled immunoprecipitation material.

    Article Title: Mechanism of HIV-1 RNA Dimerization in the Central Region of the Genome and Significance for Viral Evolution *
    Article Snippet: DNA primers were labeled at the 5′ end using T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6000 Ci/mmol). .. After cooling on ice, the reaction mixture was treated with [γ-32 P]ATP (6000 Ci/mmol), 10× PNK T4 Polynucleotide Kinase Reaction buffer and T4 polynucleotide kinase (New England Biolabs).

    Article Title: A biochemically active MCM-like helicase in Bacillus cereus
    Article Snippet: .. The labeling reaction consists of incubating 10 pmol of oligonucleotide (DF50; Supplementary Table 2 ) with 2.5 μl 10× T4 polynucleotide kinase reaction buffer (New England Biolabs (NEB)), 1 μl T4 polynucleotide kinase (NEB), and 5 μl [γ32 P]ATP in a total volume of 25 μl at 37°C for 75 min. .. The reaction was stopped by adding 1 μl of 0.5 M EDTA–NaOH/pH 8, and then purified by centrifuging the oligonucleotide through G50 desalting beads twice at 0.7RCF for 1 min each time.

    Article Title: Increased efficiency of evolved group I intron spliceozymes by decreased side product formation
    Article Snippet: .. Substrates were then 5′ radiolabeled at 37°C for 1 h. Twenty microliters labeling reactions consisted of 20 pmol RNA substrate, 20 μCi [γ-32 P]-ATP, 1× T4 Polynucleotide Kinase Reaction Buffer and 10 units T4 Polynucleotide Kinase (New England Biolabs). ..

    Polyacrylamide Gel Electrophoresis:

    Article Title: Increased efficiency of evolved group I intron spliceozymes by decreased side product formation
    Article Snippet: Substrate RNA oligonucleotides (below) that contained the suspected splice sites as shown by the RNAse H assays, were generated by run-off transcription and purified by 10% PAGE. .. Substrates were then 5′ radiolabeled at 37°C for 1 h. Twenty microliters labeling reactions consisted of 20 pmol RNA substrate, 20 μCi [γ-32 P]-ATP, 1× T4 Polynucleotide Kinase Reaction Buffer and 10 units T4 Polynucleotide Kinase (New England Biolabs).

    Lysis:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: Ovaries (∼100 per immunoprecipitation) from flies expressing UASp-λN-eGFP-Piwi, UASp-λN-eGFP-Aub, or UASp-Zuc-HA-λN with UASp-GFP-Piwi, and the UASp-mKate2-4xBoxB-K10 polyA reporter line driven by maternal α-tubulin67C-Gal4 were dissected and lysed on ice in 250 µL of lysis buffer [30 mM Hepes-KOH at pH7.4, 100 mM KOAc, 2 mM Mg(OAc)2 , 5 mM DTT, 0.5% (v/v) NP40, proteinase inhibitor (Roche, 11836170001), RNasin Plus (Promega, N2611)]. .. The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Concentration Assay:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: For each multiplex level, LSP1 and LSP2 probes were separately mixed in equal molar ratio to a final concentration of 50 nM per probe. .. The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB).

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted. .. To form the dsDNA EMSA probe, ssDNA was resuspended in annealing buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM MgCl2 , 0.1 mM EDTA) to a final concentration of 500 nM, then heated to 95°C for 5 min, and slowly cooled to room temperature.

    Article Title: Txe, an endoribonuclease of the enterococcal Axe-Txe toxin-antitoxin system, cleaves mRNA and inhibits protein synthesis
    Article Snippet: In a 10 μl reaction volume, 10 pmol of the lpp 21 primer was mixed with 1 μl 10× T4 polynucleotide kinase (PNK) reaction buffer (NEB), 1 μl 10 U T4 PNK (NEB) ml−1 and 3 μl [γ -32 P]ATP [6 mCi mmol−1 (222 MBq mmol−1 ), 10 mCi ml−1 (370 MBq ml−1 ) or adjusted appropriately for decay]. .. The final concentration of the end-labelled primer was adjusted to 100 fmol μl−1 with RNase-free dH2 O.

    Chromatin Immunoprecipitation:

    Article Title: PPARβ activation inhibits melanoma cell proliferation involving repression of the Wilms’ tumour suppressor WT1
    Article Snippet: Annealed oligonucleotides were 32 P-end labelled in a T4 polynucleotide kinase reaction (New England Biolabs, Ozyme, Saint Quentin Yvelines, France). .. For supershift assays, the same antibodies as for the ChIP experiments were used.

    Plasmid Preparation:

    Article Title: PPARβ activation inhibits melanoma cell proliferation involving repression of the Wilms’ tumour suppressor WT1
    Article Snippet: Annealed oligonucleotides were 32 P-end labelled in a T4 polynucleotide kinase reaction (New England Biolabs, Ozyme, Saint Quentin Yvelines, France). .. PPARβ and RxRα proteins were generated from full-length cDNAs in pSG5 vector (Stratagene) using the coupled TNT in-vitro-transcription-translation system (Promega, Charbonnières-les Bains, France).

    Multiplex Assay:

    Article Title: HD-Marker: a highly multiplexed and flexible approach for targeted genotyping of more than 10,000 genes in a single-tube assay
    Article Snippet: For each multiplex level, LSP1 and LSP2 probes were separately mixed in equal molar ratio to a final concentration of 50 nM per probe. .. The reaction was set up in a 50-µL volume containing 1.25 µM of each LSP2, 10 units T4 Polynucleotide Kinase (NEB) and 1× T4 Polynucleotide Kinase Reaction Buffer (NEB).

    Selection:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C. .. Size selection, library preparation, and analysis were performed as described above, except that fragments were gel-extracted based on labeled immunoprecipitation material.

    In Vitro:

    Article Title: Increased efficiency of evolved group I intron spliceozymes by decreased side product formation
    Article Snippet: Paragraph title: Identification of in vitro splicing side products with single-nucleotide resolution ( C) ... Substrates were then 5′ radiolabeled at 37°C for 1 h. Twenty microliters labeling reactions consisted of 20 pmol RNA substrate, 20 μCi [γ-32 P]-ATP, 1× T4 Polynucleotide Kinase Reaction Buffer and 10 units T4 Polynucleotide Kinase (New England Biolabs).

    Ethanol Precipitation:

    Article Title: Macromolecular assemblies of the mammalian circadian clock
    Article Snippet: Briefly, in 100 μl of T4 Polynucleotide Kinase Reaction Buffer, 250 nM ssDNA EMSA Oligonucleotide was incubated with 5 μl of T4 polynucleotide kinase (NEB) and 18 μl of 3.3 μM 3000 Ci/mmol ATP, [γ-32 P] (Perkin-Elmer) for 1 h at 37°C Free ATP was removed using Illustra MicroSpin G-25 columns (GE). ssDNA was phenol-chloroform extracted. .. Glycoblue (Life Technologies) was used a co-precipitant during ethanol precipitation.

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: To prepare the ends of the fragments for adapter ligation and library preparation, the samples were first heated at 70°C for 10 minutes and then mixed with 10x T4 PNK Reaction Buffer, 20 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs). .. This was incubated at 37°C for 1 hour, followed by a heat inactivation of the enzyme at 65°C for 20 minutes and a final phenol:chloroform cleanup step and overnight ethanol precipitation.

    Produced:

    Article Title: Cytosine-5 RNA methylation links protein synthesis to cell metabolism
    Article Snippet: .. To repair the 2′,3′-cyclic phosphate and 5'-hydroxyl termini produced during the BS/desulfonation reaction, T4 Polynucleotide Kinase (PNK) was used by mixing the RNA with 10x T4 PNK reaction buffer, 10 mM ATP, 10 U of T4 PNK enzyme, and RNase-free H2 O to a final volume of 50 μl (M0201S; New England Biolabs). .. This was incubated at 37°C for 30 minutes, followed by a heat inactivation of the enzyme at 65°C for 20 minutes and an overnight precipitation of the RNA, as before.

    Immunoprecipitation:

    Article Title: Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery
    Article Snippet: Paragraph title: Immunoprecipitation small RNA-seq ... The CIP-treated RNA was then PNK-treated with 1 µL of 10× T4 polynucleotide kinase buffer (New England Biolabs, B0201S), 2 µL of [γ-P32 ]ATP (PerkinElmer, BLU502A250UC), and 1 µL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C.

    Molecular Weight:

    Article Title: Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method
    Article Snippet: Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Xylene Cyanol FF (Sigma-Aldrich, cat. no. X4126) Low Molecular Weight Marker, 10−100 nt (Affymetrix, cat. no. 76410) SYBR® Gold Nucleic Acid Gel Stain (Life Technologies, cat. no. S-11494) CAUTION! .. Linear Acrylamide (Life Technologies, cat. no. AM9520) Sodium periodate (Sigma-Aldrich, cat. no. 311448) T4 Polynucleotide Kinase (T4 PNK; New England Biolabs Inc, cat. no. M0201) 10× T4 Polynucleotide Kinase Reaction Buffer (supplied with T4 PNK) Adenosine 5′-Triphosphate (ATP) (New England Biolabs Inc, cat. no. P0756) TruSeq Small RNA Library Preparation Kits (Illumina, cat. no. RS-200-0012), containing RNA 3′ Adapter, Ligation Buffer, Stop Solution, RNA 5′ Adapter, 10 mM ATP, T4 RNA Ligase, 25 mM dNTP mix, RNA RT Primer, PCR Mix, RNA PCR Primer, RNA PCR Primer Index, and High Resolution Ladder.

    Marker:

    Article Title: Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method
    Article Snippet: Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Xylene Cyanol FF (Sigma-Aldrich, cat. no. X4126) Low Molecular Weight Marker, 10−100 nt (Affymetrix, cat. no. 76410) SYBR® Gold Nucleic Acid Gel Stain (Life Technologies, cat. no. S-11494) CAUTION! .. Linear Acrylamide (Life Technologies, cat. no. AM9520) Sodium periodate (Sigma-Aldrich, cat. no. 311448) T4 Polynucleotide Kinase (T4 PNK; New England Biolabs Inc, cat. no. M0201) 10× T4 Polynucleotide Kinase Reaction Buffer (supplied with T4 PNK) Adenosine 5′-Triphosphate (ATP) (New England Biolabs Inc, cat. no. P0756) TruSeq Small RNA Library Preparation Kits (Illumina, cat. no. RS-200-0012), containing RNA 3′ Adapter, Ligation Buffer, Stop Solution, RNA 5′ Adapter, 10 mM ATP, T4 RNA Ligase, 25 mM dNTP mix, RNA RT Primer, PCR Mix, RNA PCR Primer, RNA PCR Primer Index, and High Resolution Ladder.

    Staining:

    Article Title: Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method
    Article Snippet: Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Xylene Cyanol FF (Sigma-Aldrich, cat. no. X4126) Low Molecular Weight Marker, 10−100 nt (Affymetrix, cat. no. 76410) SYBR® Gold Nucleic Acid Gel Stain (Life Technologies, cat. no. S-11494) CAUTION! .. Linear Acrylamide (Life Technologies, cat. no. AM9520) Sodium periodate (Sigma-Aldrich, cat. no. 311448) T4 Polynucleotide Kinase (T4 PNK; New England Biolabs Inc, cat. no. M0201) 10× T4 Polynucleotide Kinase Reaction Buffer (supplied with T4 PNK) Adenosine 5′-Triphosphate (ATP) (New England Biolabs Inc, cat. no. P0756) TruSeq Small RNA Library Preparation Kits (Illumina, cat. no. RS-200-0012), containing RNA 3′ Adapter, Ligation Buffer, Stop Solution, RNA 5′ Adapter, 10 mM ATP, T4 RNA Ligase, 25 mM dNTP mix, RNA RT Primer, PCR Mix, RNA PCR Primer, RNA PCR Primer Index, and High Resolution Ladder.

    Hood:

    Article Title: Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method
    Article Snippet: Use a hood, protective clothing, eye protection, and gloves. .. Linear Acrylamide (Life Technologies, cat. no. AM9520) Sodium periodate (Sigma-Aldrich, cat. no. 311448) T4 Polynucleotide Kinase (T4 PNK; New England Biolabs Inc, cat. no. M0201) 10× T4 Polynucleotide Kinase Reaction Buffer (supplied with T4 PNK) Adenosine 5′-Triphosphate (ATP) (New England Biolabs Inc, cat. no. P0756) TruSeq Small RNA Library Preparation Kits (Illumina, cat. no. RS-200-0012), containing RNA 3′ Adapter, Ligation Buffer, Stop Solution, RNA 5′ Adapter, 10 mM ATP, T4 RNA Ligase, 25 mM dNTP mix, RNA RT Primer, PCR Mix, RNA PCR Primer, RNA PCR Primer Index, and High Resolution Ladder.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs t4 polynucleotide kinase reaction buffer
    T4 Polynucleotide Kinase Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase reaction buffer/product/New England Biolabs
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase reaction buffer - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results