96 well nunc immuno microwell maxisorp plate  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Nunc MicroWell Plates
    Description:
    Improve efficiency in mixing washing and recovery of samples with Thermo Scientific Nunc 96 Well Polystyrene Round Bottom Microwell Plates The clear and U shaped wells are ideal for solution based assays e g agglutination assays and common serial dilutions allowing clean and easy pipetting Available in a variety of options for surfaces sterility closures and packaging sizes
    Catalog Number:
    143761
    Price:
    None
    Applications:
    Cell Culture|Cell Culture Plastics
    Category:
    Lab Supplies Plastics Glassware
    Buy from Supplier


    Structured Review

    Thermo Fisher 96 well nunc immuno microwell maxisorp plate
    Improve efficiency in mixing washing and recovery of samples with Thermo Scientific Nunc 96 Well Polystyrene Round Bottom Microwell Plates The clear and U shaped wells are ideal for solution based assays e g agglutination assays and common serial dilutions allowing clean and easy pipetting Available in a variety of options for surfaces sterility closures and packaging sizes
    https://www.bioz.com/result/96 well nunc immuno microwell maxisorp plate/product/Thermo Fisher
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    96 well nunc immuno microwell maxisorp plate - by Bioz Stars, 2020-09
    99/100 stars

    Related Products / Commonly Used Together

    p. parvulus 2.6
    eps
    β-glucan

    Images

    Related Articles

    Electroporation:

    Article Title: Testing of the survivin suppressant YM155 in a large panel of drug-resistant neuroblastoma cell lines
    Article Snippet: .. The electroporation was performed using two 20 millisecond pulses of 1400 V. Subsequently, the cells were transferred into cell culture plates or flasks, containing pre-warmed cell culture medium. .. TP53 sequencing TP53 gene sequencing on cDNAs was performed using the following four pairs of primers: TP53 Ex2-3-f GTGACACGCTTCCCTGGAT and TP53 Ex2-3-r TCATCTGGACCTGGGTCTTC; TP53 Ex4-5-f CCCTTCCCAGAAAACCTACC and TP53 Ex4-5-r CTCCGTCATGTGCTGTGACT; TP53 EX6-7f GTGCAGCTGTGGGTTGATT and TP53 Ex6-7r GGTGGTACAGTCAGAGCCAAC; Tp53 Ex8-9-f CCTCACCATCATCACACTGG and TP53 Ex8-9-r GTCTGGTCCTGAAGGGTGAA.

    Transfection:

    Article Title: Drug discovery with an RBM20 dependent titin splice reporter identifies cardenolides as lead structures to improve cardiac filling
    Article Snippet: .. For transfection 25000 cells/well were seeded on 96-well Nunc F96 MicroWell™ plates (Life Technologies GmbH, Darmstadt, Germany) and transfected with a total of 200 ng of plasmid DNA of which 1 ng was splice reporter plus a corresponding amount of RBM20, RBFOX1 or control plasmid (pcDNA3.1) in a 20x molar excess. .. To deliver plasmid DNA we used the 40 kDa linear polyethylenimine (Polysciences Europe GmbH, Hirschberg, Germany) at a 1:3 ratio (DNA:PEI40).

    Fluorescence:

    Article Title: Fluorescence Quenching-Based Mechanism for Determination of Hypochlorite by Coumarin-Derived Sensors
    Article Snippet: .. Steady-state fluorescence measurements were performed in 96-well black plates (Nunc™ F96 MicroWell™ Black Polystyrene Plate, Thermo Scientific™, Roskilde, Denmark) on a Tecan Infinite 200 microplate reader (Tecan Austria GmbH, Grödig/Salzburg, Austria). .. HPLC-ESI-MS analyses were performed on an LCMS-8030 mass spectrometer (Shimadzu, Kyoto, Japan).

    Cell Culture:

    Article Title: Testing of the survivin suppressant YM155 in a large panel of drug-resistant neuroblastoma cell lines
    Article Snippet: .. The electroporation was performed using two 20 millisecond pulses of 1400 V. Subsequently, the cells were transferred into cell culture plates or flasks, containing pre-warmed cell culture medium. .. TP53 sequencing TP53 gene sequencing on cDNAs was performed using the following four pairs of primers: TP53 Ex2-3-f GTGACACGCTTCCCTGGAT and TP53 Ex2-3-r TCATCTGGACCTGGGTCTTC; TP53 Ex4-5-f CCCTTCCCAGAAAACCTACC and TP53 Ex4-5-r CTCCGTCATGTGCTGTGACT; TP53 EX6-7f GTGCAGCTGTGGGTTGATT and TP53 Ex6-7r GGTGGTACAGTCAGAGCCAAC; Tp53 Ex8-9-f CCTCACCATCATCACACTGG and TP53 Ex8-9-r GTCTGGTCCTGAAGGGTGAA.

    Article Title: Levels of circulating myeloid subpopulations and of heme oxygenase-1 do not predict CD4+ T cell recovery after the initiation of antiretroviral therapy for HIV disease
    Article Snippet: .. PBMCs were cultured on Upcell™ 96 F MicroWell plates (Nalge Nunc, Rochester, NY), either with saline or 25 μM CoPP in R10 at 37°C for 48 hours. .. Flow cytometry antibody labeling The monoclonal antibodies (mAbs) used in this study were purchased from Abcam (Cambridge, MA), BD Biosciences (Franklin Lakes, NJ), Beckman Coulter (Indianapolis, IN), BioLegend (San Diego, CA), eBiosciences (San Diego, CA), and Invitrogen (Carlsbad, CA), and are summarized in detail in Additional file : Table S1.

    Purification:

    Article Title: β-Glucan-Producing Pediococcus parvulus 2.6: Test of Probiotic and Immunomodulatory Properties in Zebrafish Models
    Article Snippet: .. The purified β-glucan of P. parvulus 2.6 was immobilized in each well of a 96-Well Nunc-Immuno MicroWell MaxiSorp plate (Thermo Fisher Scientific, Roskilde, Denmark) and used to compete with the β-glucan presented in the culture supernatants for binding to the primary antibody (antiserotype 37, Statens Serum Institut, Copenhagen, Denmark). .. The ELISA method was also used to determine the concentration of β-glucan attached to the producing bacteria, with or without its removal, that were used for the adhesion assays to Caco-2 cells (see details above).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Development of a Whole-Virus ELISA for Serological Evaluation of Domestic Livestock as Possible Hosts of Human Coronavirus NL63
    Article Snippet: .. Final ELISA Testing Procedure In brief, viral protein was coated into 96-well Nunc MicroWellTM plates (Thermo Fisher, US) by diluting the stock to 0.75 µg/mL in NaCO3 buffer (0.1 M, PH 9.6) and coating with 50 µL per well with overnight incubation at 4 °C. .. The plates were washed 5 times with 0.1% PBS-T then blocked with 5% milk powder (Carl Roth, Germany) in PBS-T for one hour at room temperature and the wash repeated.

    Incubation:

    Article Title: Induction and maintenance of anti‐influenza antigen‐specific nasal secretory IgA levels and serum IgG levels after influenza infection in adults
    Article Snippet: .. For quantification of anti‐IAV‐specific s‐IgA in nasal washes, 96‐MicroWell Plates (Nalge Nunc International, Tokyo, Japan) were coated with the IAV vaccine antigens (0·1 μg/well) described previously, incubated overnight in phosphate‐buffered saline (PBS) at 4°C, and then blocked with 1% BSA in 50 m m Tris–HCl (pH 8·0) containing 0·14 m NaCl and 0·05% Tween‐20 (TTBS) for 1 h at room temperature. .. The nasal wash diluted with TTBS was added to each well and incubated for 2 h at room temperature.

    Article Title: Development of a Whole-Virus ELISA for Serological Evaluation of Domestic Livestock as Possible Hosts of Human Coronavirus NL63
    Article Snippet: .. Final ELISA Testing Procedure In brief, viral protein was coated into 96-well Nunc MicroWellTM plates (Thermo Fisher, US) by diluting the stock to 0.75 µg/mL in NaCO3 buffer (0.1 M, PH 9.6) and coating with 50 µL per well with overnight incubation at 4 °C. .. The plates were washed 5 times with 0.1% PBS-T then blocked with 5% milk powder (Carl Roth, Germany) in PBS-T for one hour at room temperature and the wash repeated.

    Western Blot:

    Article Title: C-terminal calcium binding of α-synuclein modulates synaptic vesicle interaction
    Article Snippet: .. Cells were plated at 5000 cells/well in Nunc MicroWell 96-well plates (Thermo Fisher Scientific) for cytotoxicity assays and at 700,000 cells/dish in 48 mm dishes (Nunc A/A) for western blotting studies. ..

    Binding Assay:

    Article Title: β-Glucan-Producing Pediococcus parvulus 2.6: Test of Probiotic and Immunomodulatory Properties in Zebrafish Models
    Article Snippet: .. The purified β-glucan of P. parvulus 2.6 was immobilized in each well of a 96-Well Nunc-Immuno MicroWell MaxiSorp plate (Thermo Fisher Scientific, Roskilde, Denmark) and used to compete with the β-glucan presented in the culture supernatants for binding to the primary antibody (antiserotype 37, Statens Serum Institut, Copenhagen, Denmark). .. The ELISA method was also used to determine the concentration of β-glucan attached to the producing bacteria, with or without its removal, that were used for the adhesion assays to Caco-2 cells (see details above).

    Plasmid Preparation:

    Article Title: Drug discovery with an RBM20 dependent titin splice reporter identifies cardenolides as lead structures to improve cardiac filling
    Article Snippet: .. For transfection 25000 cells/well were seeded on 96-well Nunc F96 MicroWell™ plates (Life Technologies GmbH, Darmstadt, Germany) and transfected with a total of 200 ng of plasmid DNA of which 1 ng was splice reporter plus a corresponding amount of RBM20, RBFOX1 or control plasmid (pcDNA3.1) in a 20x molar excess. .. To deliver plasmid DNA we used the 40 kDa linear polyethylenimine (Polysciences Europe GmbH, Hirschberg, Germany) at a 1:3 ratio (DNA:PEI40).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 96 well nunc immuno microwell maxisorp plate
    96 Well Nunc Immuno Microwell Maxisorp Plate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/96 well nunc immuno microwell maxisorp plate/product/Thermo Fisher
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    96 well nunc immuno microwell maxisorp plate - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results