qiashredder 79654  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    QIAshredder
    Description:
    For simple and rapid homogenization of cell and tissue lysates Kit contents Qiagen QIAshredder 50 Disposable Cell lysate Homogenizers for use in Nucleic acid preps Caps For Simple and Rapid Homogenization of Cell and Tissue Lysates Replaces Syringe and needle Homogenization Reduces Loss of Sample Material Eliminates Cross contamination Between Samples Filters out Insoluble Debris and Reduces Viscosity Spin column Format QIAshredder Homogenizer Placed in a Collection Tube and Centrifuged Benefits Replaces syringe and needle homogenization Reduces loss of sample material Eliminates cross contamination between samples Filters out insoluble debris and reduces viscosity
    Catalog Number:
    79654
    Price:
    88
    Category:
    QIAshredder
    Buy from Supplier


    Structured Review

    Qiagen qiashredder 79654
    QIAshredder
    For simple and rapid homogenization of cell and tissue lysates Kit contents Qiagen QIAshredder 50 Disposable Cell lysate Homogenizers for use in Nucleic acid preps Caps For Simple and Rapid Homogenization of Cell and Tissue Lysates Replaces Syringe and needle Homogenization Reduces Loss of Sample Material Eliminates Cross contamination Between Samples Filters out Insoluble Debris and Reduces Viscosity Spin column Format QIAshredder Homogenizer Placed in a Collection Tube and Centrifuged Benefits Replaces syringe and needle homogenization Reduces loss of sample material Eliminates cross contamination between samples Filters out insoluble debris and reduces viscosity
    https://www.bioz.com/result/qiashredder 79654/product/Qiagen
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qiashredder 79654 - by Bioz Stars, 2020-01
    90/100 stars

    Related Products / Commonly Used Together

    rneasy mini kits
    hcmv-infected hpasmcs
    total rna

    Images

    Related Articles

    Functional Assay:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: DNA sequencing was carried out at the Functional Genomics and Proteomics Laboratory of the University of Birmingham. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Amplification:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 200 ng RNA were used to generate cyanine 3 (Cy3) cRNA with the aid of Low RNA Input Linear Amplification kit, one-color (Agilent Technologies, Wilmington, De) according to the manufacturer's instructions.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Paragraph title: RNA purification, amplification, labeling and hybridization ... Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA.

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit. .. Each sample was amplified in duplicate and target transcripts were normalized to Gapdh mRNA as an internal control.

    Synthesized:

    Article Title: Apoptotic cell clearance by bronchial epithelial cells critically influences airway inflammation
    Article Snippet: .. Total RNA was extracted from epithelial cells using the Qiagen Qiashredder and RNeasy kit, and cDNA was synthesized using SuperScript III kit (Invitrogen). .. Quantitative PCR for Rac1, Rac2, TGF-β and IL-33 was performed using the TagMan Gene Expression Assay (Applied Biosystems), and were run on a STEP One plus instrument (ABI).

    Quantitative RT-PCR:

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: Assessment of viremia and viral shedding Mononuclear cells were isolated from blood, biopsy specimens, throat washings and urine according to protocol, and viral replication quantitative RT-PCR to determine virus RNA copy number was done. ( ) Peripheral blood was collected in PAXgene tubes. .. RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder.

    Real-time Polymerase Chain Reaction:

    Article Title: Hedgehog Signaling in Pancreas Epithelium Regulates Embryonic Organ Formation and Adult ?-Cell Function
    Article Snippet: Paragraph title: RNA isolation, Sybr Green, and Taqman real0time quantitative PCR. ... RNA from isolated islets and microdissected pancreatic buds was prepared according to the Qiagen Qiashredder and RNAEasy Micro protocols. cDNA was transcribed according to BioRad iScript Kit instructions.

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder. .. Q-RT-PCR was done using primers, the TaqMan One-step RT-PCR Master Mix Reagents Kit. (Applied Biosystems,Foster City, CA), on a Stratagene MX4000 Multiplex Quantitative PCR System – a spectrophotometric thermocycler (Stratagene, LaJolla, CA).

    Article Title: Inhibition of the Inositol Kinase Itpkb Augments Calcium Signaling in Lymphocytes and Reveals a Novel Strategy to Treat Autoimmune Disease
    Article Snippet: Cells were removed from the plate and total RNA was extracted using the Qiagen QIAshredder and RNeasy Kit. .. Real time qPCR was performed using Applied Biosystem 7900HT Fast Real-Time PCR System, FastStart Universal Probe Master (Rox) and the following Taqman primer probe sets (Applied Biosystems): GAPDH-FAM (Mm99999915_g1), Bcl2-FAM (Mm00477631_m1), Bim or Bcl2l11-FAM (Mm00437796_m1), FasL-FAM (Mm00438864_m1), and Fas-FAM (Mm01204974_m1).

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: Paragraph title: Real-time Polymerase Chain Reaction (RT-PCR) ... RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA).

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Paragraph title: Quantitative PCR ... Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit.

    Article Title: Apoptotic cell clearance by bronchial epithelial cells critically influences airway inflammation
    Article Snippet: Paragraph title: Quantitative PCR analysis ... Total RNA was extracted from epithelial cells using the Qiagen Qiashredder and RNeasy kit, and cDNA was synthesized using SuperScript III kit (Invitrogen).

    Microarray:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 1.65 ug of each labeled cRNA sample were fragmented at 60°C for 30 min using an Agilent Gene Expression Hybridization kit (Agilent Technologies, Wilmington, De) followed by hybridization to a whole human genome Agilent oligonucleotide slide containing four high-definition 44 K microarray (Agilent Technologies, Wilmington, De) at 65°C for 17 hours.

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Paragraph title: Microarray and analysis ... Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.

    Incubation:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: Gene expression analysis in Ect1/E6E7 cells Cultured Ect1/E6E7 cells were incubated with dilutions of GRFT, GRFTLec- , CV-N, ConA, or vehicle only (PBS, pH 7.4) for 16 hours. .. The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit.

    Infection:

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: Paragraph title: Cell culture, adenovirus infection, and RT-PCR ... For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions.

    Expressing:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: Paragraph title: Gene expression analysis in Ect1/E6E7 cells ... The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit.

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Quantitative PCR Thymocyte subsets from Cxcr4 f l/fl , Lck-Cre+ Cxcr4 +/+ or, Lck-Cre+ Cxcr4 fl/fl mice were electronically sorted based on CD3, CD4, CD8, c-kit, CD44, and CD25 surface expression after gating out cells expressing hematopoietic lineage markers (CD11b, CD11c, B220, Ly6G, Ter119). .. Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit.

    Article Title: Apoptotic cell clearance by bronchial epithelial cells critically influences airway inflammation
    Article Snippet: Total RNA was extracted from epithelial cells using the Qiagen Qiashredder and RNeasy kit, and cDNA was synthesized using SuperScript III kit (Invitrogen). .. Quantitative PCR for Rac1, Rac2, TGF-β and IL-33 was performed using the TagMan Gene Expression Assay (Applied Biosystems), and were run on a STEP One plus instrument (ABI).

    Derivative Assay:

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Three hES-MC (B4, E22h, and E28h) derived independently from hESC were grown as described. .. Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.

    Article Title: Apoptotic cell clearance by bronchial epithelial cells critically influences airway inflammation
    Article Snippet: Total RNA was extracted from epithelial cells using the Qiagen Qiashredder and RNeasy kit, and cDNA was synthesized using SuperScript III kit (Invitrogen). .. It is noteworthy that the higher IL-33 measured was not derived from the apoptotic cells as species-specific primers were used ( ).

    Hybridization:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 1.65 ug of each labeled cRNA sample were fragmented at 60°C for 30 min using an Agilent Gene Expression Hybridization kit (Agilent Technologies, Wilmington, De) followed by hybridization to a whole human genome Agilent oligonucleotide slide containing four high-definition 44 K microarray (Agilent Technologies, Wilmington, De) at 65°C for 17 hours.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Paragraph title: RNA purification, amplification, labeling and hybridization ... Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA.

    Transfection:

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: HEK293FT cells at 90% confluence were transfected with endotoxin-free DNA using Lipofectamine 2000 (Invitrogen) following the manufacturer protocol. .. Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder).

    Cell Culture:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: Gene expression analysis in Ect1/E6E7 cells Cultured Ect1/E6E7 cells were incubated with dilutions of GRFT, GRFTLec- , CV-N, ConA, or vehicle only (PBS, pH 7.4) for 16 hours. .. The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit.

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: Paragraph title: Cell culture, adenovirus infection, and RT-PCR ... For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions.

    other:

    Article Title: Whole transcriptome responses among females of the filariasis and arbovirus vector mosquito Culex pipiens implicate TGF-β signaling and chromatin modification as key drivers of diapause induction
    Article Snippet: Total RNA was extracted from pools of 10 pupae using the Qiagen Qiashredder and RNeasy Extraction Kits (Qiagen).

    DNA Sequencing:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: DNA sequencing was carried out at the Functional Genomics and Proteomics Laboratory of the University of Birmingham. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Polymerase Chain Reaction:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: PCR experiments were performed using Phusion high-fidelity DNA polymerase (F530-L; New England BioLabs) or 1× ReddyMix PCR master mix (Ab-0575; Thermo Scientific). .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA). .. Primers specific to necdin (forward: gctggtgcagaaggcgcacga, reverse: gctggtacttcaggtaattc) were used to amplify a 455bp fragment by PCR (Tm = 58, 35 cycles).

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. The PCR product was gel purified and sequenced to determine splice junctions.

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: .. For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions. .. Invitrogen SuperScript III One-Step RT-PCR system then used to make cDNA before PCR.

    DNA Extraction:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Isolation:

    Article Title: Hedgehog Signaling in Pancreas Epithelium Regulates Embryonic Organ Formation and Adult ?-Cell Function
    Article Snippet: .. RNA from isolated islets and microdissected pancreatic buds was prepared according to the Qiagen Qiashredder and RNAEasy Micro protocols. cDNA was transcribed according to BioRad iScript Kit instructions. .. Real-time PCR was performed as previously described ( , ) using Sybr Green Fast Universal mix or Taqman Fast Universal Mixes from Applied Biosystems.

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder. .. Subsequently, RNA was isolated using Qiagen's RNeasy minikit and RNase-Free DNase set in accordance with the manufacturer's instructions.

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: Assessment of viremia and viral shedding Mononuclear cells were isolated from blood, biopsy specimens, throat washings and urine according to protocol, and viral replication quantitative RT-PCR to determine virus RNA copy number was done. ( ) Peripheral blood was collected in PAXgene tubes. .. RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder.

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: .. RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA). .. Genomic DNA was digested with DNase I (Invitrogen, Carlsbad, CA).

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: .. Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. .. Total sample RNA was labeled with Cy3 and Universal Human Reference RNA control (#740000; Strategene, Santa Clara, CA) was labeled with Cy5.

    Article Title: Evaluation of Genetic Variation Contributing to Differences in Gene Expression between Populations
    Article Snippet: Paragraph title: RNA Isolation ... Cell pellets were thawed and total RNA was extracted with QIAGEN Qiashredder and RNeasy plus kits (QIAGEN) according to the manufacturer's protocol.

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Paragraph title: mRNA Isolation and cDNA Synthesis ... Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder).

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: .. For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions. .. Invitrogen SuperScript III One-Step RT-PCR system then used to make cDNA before PCR.

    Multiplex Assay:

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder. .. Q-RT-PCR was done using primers, the TaqMan One-step RT-PCR Master Mix Reagents Kit. (Applied Biosystems,Foster City, CA), on a Stratagene MX4000 Multiplex Quantitative PCR System – a spectrophotometric thermocycler (Stratagene, LaJolla, CA).

    Labeling:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 1.65 ug of each labeled cRNA sample were fragmented at 60°C for 30 min using an Agilent Gene Expression Hybridization kit (Agilent Technologies, Wilmington, De) followed by hybridization to a whole human genome Agilent oligonucleotide slide containing four high-definition 44 K microarray (Agilent Technologies, Wilmington, De) at 65°C for 17 hours.

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. .. Total sample RNA was labeled with Cy3 and Universal Human Reference RNA control (#740000; Strategene, Santa Clara, CA) was labeled with Cy5.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Paragraph title: RNA purification, amplification, labeling and hybridization ... Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA.

    Purification:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Article Title: Inhibition of the Inositol Kinase Itpkb Augments Calcium Signaling in Lymphocytes and Reveals a Novel Strategy to Treat Autoimmune Disease
    Article Snippet: Q-PCR analysis Purified CD4+ T cells from Itpkb +/+ and Itpkb fl/fl mice were stimulated for 0, 2 or 6 hrs with anti-mouse CD3/28 beads (Invitrogen, 2:1 bead to cell ratio). .. Cells were removed from the plate and total RNA was extracted using the Qiagen QIAshredder and RNeasy Kit.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: .. Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA. .. The integrity and concentration of the isolated total RNA was confirmed by analysis on an Agilent Bioanalyzer.

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. The PCR product was gel purified and sequenced to determine splice junctions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder. .. RNA was quantified using NanoDrop prior to cDNA synthesis using SuperScript II reverse transcriptase and random hexamers (Invitrogen) and prior to reverse transcriptase (RT)-PCR using Taq polymerase and primers D3 and RT1.

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder. .. Q-RT-PCR was done using primers, the TaqMan One-step RT-PCR Master Mix Reagents Kit. (Applied Biosystems,Foster City, CA), on a Stratagene MX4000 Multiplex Quantitative PCR System – a spectrophotometric thermocycler (Stratagene, LaJolla, CA).

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: Paragraph title: Real-time Polymerase Chain Reaction (RT-PCR) ... RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA).

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. Combined first-strand cDNA/PCR (Invitrogen SuperScript III One-Step RT-PCR) was performed with the following reaction conditions and primers (all sequences 5′ - > 3′ ): oG: 50°C × 30 min, 94°C × 2 min followed by 40 cycles of 94°C × 20 s, 50°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. TVA-mCherry: 55°C × 30 min, 94°C × 2 min, followed by 40 cycles 94°C × 20 s, 55°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. oG primers: Exon 1 Forward (1F): gctatgaggaaagcctgcac; Exon 1 Reverse (1R): gtgcaggctttcctcatagc; Exon 2 Forward (2F): aagagcgtgagcttcag gag; Exon 2 Reverse (2R): ctcctgaagctcacgctctt.

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: .. For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions. .. Invitrogen SuperScript III One-Step RT-PCR system then used to make cDNA before PCR.

    Mouse Assay:

    Article Title: Inhibition of the Inositol Kinase Itpkb Augments Calcium Signaling in Lymphocytes and Reveals a Novel Strategy to Treat Autoimmune Disease
    Article Snippet: Q-PCR analysis Purified CD4+ T cells from Itpkb +/+ and Itpkb fl/fl mice were stimulated for 0, 2 or 6 hrs with anti-mouse CD3/28 beads (Invitrogen, 2:1 bead to cell ratio). .. Cells were removed from the plate and total RNA was extracted using the Qiagen QIAshredder and RNeasy Kit.

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Quantitative PCR Thymocyte subsets from Cxcr4 f l/fl , Lck-Cre+ Cxcr4 +/+ or, Lck-Cre+ Cxcr4 fl/fl mice were electronically sorted based on CD3, CD4, CD8, c-kit, CD44, and CD25 surface expression after gating out cells expressing hematopoietic lineage markers (CD11b, CD11c, B220, Ly6G, Ter119). .. Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit.

    RNA Extraction:

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Five days post-transfection, RNA extraction was performed (QIAGEN RNeasy Mini). .. Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder).

    Article Title: Effect of Topical Microbicides on Infectious Human Immunodeficiency Virus Type 1 Binding to Epithelial Cells ▿
    Article Snippet: Paragraph title: RNA extraction. ... Cells were lysed using RNeasy lysis buffer (QIAGEN, Valencia, CA), homogenized with the QIAGEN QIAshredder, and extracted using the RNeasy protocol with optional DNase digestion.

    Plasmid Preparation:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Software:

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. .. The samples and control were added to Agilent Human Whole Genome microarray (G4112A) and the array data extracted using Agilent G2567AA Feature Extraction Software v9.5 (Agilent Technologies, Santa Clara, CA).

    SYBR Green Assay:

    Article Title: Hedgehog Signaling in Pancreas Epithelium Regulates Embryonic Organ Formation and Adult ?-Cell Function
    Article Snippet: Paragraph title: RNA isolation, Sybr Green, and Taqman real0time quantitative PCR. ... RNA from isolated islets and microdissected pancreatic buds was prepared according to the Qiagen Qiashredder and RNAEasy Micro protocols. cDNA was transcribed according to BioRad iScript Kit instructions.

    Negative Control:

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA). .. The reverse transcriptase reaction was performed using the SuperScript III First-Strand Synthesis System (Invitrogen) with or without (negative control) reverse transcriptase.

    Agarose Gel Electrophoresis:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Spectrophotometry:

    Article Title: Evaluation of Genetic Variation Contributing to Differences in Gene Expression between Populations
    Article Snippet: Cell pellets were thawed and total RNA was extracted with QIAGEN Qiashredder and RNeasy plus kits (QIAGEN) according to the manufacturer's protocol. .. RNA concentration and purity was determined through measurement of A260/A280 ratios with the Spectronic Genesys 6 UV/Vis Spectrophotometer (Thermo Electron).

    Concentration Assay:

    Article Title: Evaluation of Genetic Variation Contributing to Differences in Gene Expression between Populations
    Article Snippet: Cell pellets were thawed and total RNA was extracted with QIAGEN Qiashredder and RNeasy plus kits (QIAGEN) according to the manufacturer's protocol. .. RNA concentration and purity was determined through measurement of A260/A280 ratios with the Spectronic Genesys 6 UV/Vis Spectrophotometer (Thermo Electron).

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA. .. The integrity and concentration of the isolated total RNA was confirmed by analysis on an Agilent Bioanalyzer.

    Lysis:

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: .. Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. Combined first-strand cDNA/PCR (Invitrogen SuperScript III One-Step RT-PCR) was performed with the following reaction conditions and primers (all sequences 5′ - > 3′ ): oG: 50°C × 30 min, 94°C × 2 min followed by 40 cycles of 94°C × 20 s, 50°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. TVA-mCherry: 55°C × 30 min, 94°C × 2 min, followed by 40 cycles 94°C × 20 s, 55°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. oG primers: Exon 1 Forward (1F): gctatgaggaaagcctgcac; Exon 1 Reverse (1R): gtgcaggctttcctcatagc; Exon 2 Forward (2F): aagagcgtgagcttcag gag; Exon 2 Reverse (2R): ctcctgaagctcacgctctt.

    Article Title: Effect of Topical Microbicides on Infectious Human Immunodeficiency Virus Type 1 Binding to Epithelial Cells ▿
    Article Snippet: .. Cells were lysed using RNeasy lysis buffer (QIAGEN, Valencia, CA), homogenized with the QIAGEN QIAshredder, and extracted using the RNeasy protocol with optional DNase digestion. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen qiagen qiashredder
    Qiagen Qiashredder, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiagen qiashredder/product/Qiagen
    Average 90 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    qiagen qiashredder - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results