7900ht fast realtime pcr system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    7900HT Fast Real Time PCR System
    Description:
    The 7900HT Fast Real Time PCR System is a real time quantitative PCR system that combines 96 and 384 well plate compatibility and the TaqMan Low Density Array with fully automated robotic loading and now also offers optional Fast real time PCR capability • Fast PCR option reduces run time to about 35 minutes in a standard 96 well format or about 55 minutes in a 384 well plate• Continuous wavelength detection from 500 660 nm allows the use of multiple fluorophores in a single reaction• Measure gene expression levels detect and quantitate pathogens perform allelic discrimination SNP genotyping assays as well as score the presence of gene sequences• 96 or 384 well plate compatibility including the TaqMan Low Density Array • Optional Enterprise edition software provides data analysis tools that support 21 CFR Part 11 guidelines providing data integrity and security• Hands free plate loading and unloading provides true walkaway automation allowing you to increase your lab s productivity• Proven assay development guidelines save time and moneyHigh ThroughputThe 7900HT System is a high throughput real time PCR system that detects and quantitates nucleic acid sequences An optional Automation Accessory not included combined with 384 well plate capability make the 7900HT system ideally suited to meet the high throughput requirements of today s drug discovery process Key applications include gene expression quantitation and the detection of single nucleotide polymorphisms SNPs using the fluorogenic 5 nuclease assay FlexibilityThe 7900HT system is a versatile research tool that can accommodate any real time PCR need User interchangeable thermal cycling block formats let you select the format that s right for your project using industry standard 96 and 384 well formats as well as a novel 384 well TaqMan Low Density Array and a new Fast 96 well block that reduces run times from 2 hours to about 30 minutes An easy automation upgrade path lets you add features to meet throughput demands A Fast PCR option reduces run times from 2 hours to about 30 minutes Powerful SoftwareUsing two automation software tools Plate Utility and Automation Controller most of the gene expression and SNP genotyping workflow is fully automated for high throughput applications and requires minimal user intervention You can now process 5 000 x 384 well plates 384 markers which equates to 1 92 million genotypes Using Relative Quantification RQ Manager you can also process 200 x 384 well plates 96 detectors with quadruplicate data points⁄multiplexed endogenous control which equates to 153 600 data points Fully integrated into one complete Enterprise system SNP Manager and RQ Manager eliminate data analysis bottlenecks in high throughput SNP and gene expression research by allowing significantly more plates to be analyzed simultaneously This reduces hands on analysis time and simplifies the data analysis workflow For Research Use Only Not for use in diagnostics procedures
    Catalog Number:
    4329001
    Price:
    None
    Applications:
    Fast Real-Time PCR|Genotyping & Genomic Profiling|PCR & Real-Time PCR|Real Time PCR (qPCR)|Real Time PCR-Based Gene Expression Profiling|Real-Time PCR Instruments, Software & Calibration|High Resolution Melting (HRM) Analysis|SNP Genotyping|Genotyping Instruments, Software & Calibration|Gene Expression Analysis & Genotyping
    Category:
    Instruments and Equipment
    Buy from Supplier


    Structured Review

    Thermo Fisher 7900ht fast realtime pcr system
    The 7900HT Fast Real Time PCR System is a real time quantitative PCR system that combines 96 and 384 well plate compatibility and the TaqMan Low Density Array with fully automated robotic loading and now also offers optional Fast real time PCR capability • Fast PCR option reduces run time to about 35 minutes in a standard 96 well format or about 55 minutes in a 384 well plate• Continuous wavelength detection from 500 660 nm allows the use of multiple fluorophores in a single reaction• Measure gene expression levels detect and quantitate pathogens perform allelic discrimination SNP genotyping assays as well as score the presence of gene sequences• 96 or 384 well plate compatibility including the TaqMan Low Density Array • Optional Enterprise edition software provides data analysis tools that support 21 CFR Part 11 guidelines providing data integrity and security• Hands free plate loading and unloading provides true walkaway automation allowing you to increase your lab s productivity• Proven assay development guidelines save time and moneyHigh ThroughputThe 7900HT System is a high throughput real time PCR system that detects and quantitates nucleic acid sequences An optional Automation Accessory not included combined with 384 well plate capability make the 7900HT system ideally suited to meet the high throughput requirements of today s drug discovery process Key applications include gene expression quantitation and the detection of single nucleotide polymorphisms SNPs using the fluorogenic 5 nuclease assay FlexibilityThe 7900HT system is a versatile research tool that can accommodate any real time PCR need User interchangeable thermal cycling block formats let you select the format that s right for your project using industry standard 96 and 384 well formats as well as a novel 384 well TaqMan Low Density Array and a new Fast 96 well block that reduces run times from 2 hours to about 30 minutes An easy automation upgrade path lets you add features to meet throughput demands A Fast PCR option reduces run times from 2 hours to about 30 minutes Powerful SoftwareUsing two automation software tools Plate Utility and Automation Controller most of the gene expression and SNP genotyping workflow is fully automated for high throughput applications and requires minimal user intervention You can now process 5 000 x 384 well plates 384 markers which equates to 1 92 million genotypes Using Relative Quantification RQ Manager you can also process 200 x 384 well plates 96 detectors with quadruplicate data points⁄multiplexed endogenous control which equates to 153 600 data points Fully integrated into one complete Enterprise system SNP Manager and RQ Manager eliminate data analysis bottlenecks in high throughput SNP and gene expression research by allowing significantly more plates to be analyzed simultaneously This reduces hands on analysis time and simplifies the data analysis workflow For Research Use Only Not for use in diagnostics procedures
    https://www.bioz.com/result/7900ht fast realtime pcr system/product/Thermo Fisher
    Average 99 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    7900ht fast realtime pcr system - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L _human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: Replication Study: BET bromodomain inhibition as a therapeutic strategy to target c-Myc
    Article Snippet: .. A negative control contained 12 μ l of water with no RNA template was also included. qRT-PCR was performed using a real-time PCR system (Applied Biosystems, cat# 7900HT). .. Reaction volumes were 20 μ l and consisted of 10 μ l 2X TaqMan Gene Expression Master Mix (Life Technologies, cat# 4369016), 1 μ l 20X TaqMan Gene Expression Assay (Applied Biosystems, cat# 4331182) for either MYC (Hs00905030_m1) or GAPDH (Hs02758991_g1), 2 μ l cDNA template, and 7 μ l water.

    Article Title: The Epithelial-Mesenchymal Transition (EMT) Regulatory Factor SLUG (SNAI2) Is a Downstream Target of SPARC and AKT in Promoting Melanoma Cell Invasion
    Article Snippet: .. Quantitative PCR was performed on 25 ng cDNA samples, in sealed 384-well microtiter plates using the SYBR Green™ PCR Master Mix (Applied Biosystems) with the 7900HT Fast Real-Time PCR System (Applied Biosystems). ..

    Article Title: Cooperative TRAIL production mediates IFNα/Smac mimetic-induced cell death in TNFα-resistant solid cancer cells
    Article Snippet: .. TNFα and TRAIL mRNA levels were assessed by Taqman Gene Expression Assay purchased from Life Technologies (TNFα: Hs01113624_g1, TRAIL: Hs00921974_m1) and the levels of 28S rRNA by SYBR®Green qPCR assay from Applied Biosystems (Darmstadt, Germany) according to the manufacturer's instructions using the 7900HT fast real-time PCR system from Applied Biosystems (Darmstadt, Germany); 28S rRNA forward primer: TTGAAAATCCGGGGGAGAG; reverse primer: ACATTGTTCCAACATGCCAG. .. The relative expression of the target gene transcript and reference gene transcript was calculated as ΔΔCt.

    Article Title: Serum RARRES2 Is a Prognostic Marker in Patients With Adrenocortical Carcinoma
    Article Snippet: .. TaqMan real-time quantitative polymerase chain reaction was performed on 7900HT fast real-time PCR systems (Applied Biosystems). .. The reaction was prepared by mixing cDNA, TaqMan 2× universal PCR master mix and TaqMan gene expression assays (Applied Biosystems).

    Article Title: Potential Role of Activating Transcription Factor 5 during Osteogenesis
    Article Snippet: .. Real-Time RT-PCR Target mRNAs concentration was assessed by quantitative real-time PCR (qRT-PCR) on Applied Biosystem 7900HT fast real-time PCR system using comparative Ct method with fast SYBR Green chemistry (Applied Biosystem). .. PCR primers were designed using Primer BLAST [ ] to specifically recognize selected transcripts by targeting exon-exon junctions and tested for off-targeting using human RefSeq database [ ].

    Article Title: Osteopontin Expression in the Brain Triggers Localized Inflammation and Cell Death When Immune Cells Are Activated by Pertussis Toxin
    Article Snippet: .. PCRs were performed in ABI 7900HT Fast Real Time PCR apparatus (Applied Biosystems, Grand Island, NY, USA). .. Statistics Two-way ANOVA, followed by Bonferroni's test, was performed using Prism Software (Graphpad software, San Diego, CA, USA).

    Article Title: MiR-31 regulates the cisplatin resistance by targeting Src in gallbladder cancer
    Article Snippet: .. To measure the level of miR-31, quantitative real-time PCR (qRT-PCR) was performed on an ABI 7900HT fast real-time PCR system (Applied Biosystems, FosterCity, CA, USA) according to TaqMan Small RNA Assays protocol. ..

    Negative Control:

    Article Title: Replication Study: BET bromodomain inhibition as a therapeutic strategy to target c-Myc
    Article Snippet: .. A negative control contained 12 μ l of water with no RNA template was also included. qRT-PCR was performed using a real-time PCR system (Applied Biosystems, cat# 7900HT). .. Reaction volumes were 20 μ l and consisted of 10 μ l 2X TaqMan Gene Expression Master Mix (Life Technologies, cat# 4369016), 1 μ l 20X TaqMan Gene Expression Assay (Applied Biosystems, cat# 4331182) for either MYC (Hs00905030_m1) or GAPDH (Hs02758991_g1), 2 μ l cDNA template, and 7 μ l water.

    Quantitative RT-PCR:

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L _human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: Replication Study: BET bromodomain inhibition as a therapeutic strategy to target c-Myc
    Article Snippet: .. A negative control contained 12 μ l of water with no RNA template was also included. qRT-PCR was performed using a real-time PCR system (Applied Biosystems, cat# 7900HT). .. Reaction volumes were 20 μ l and consisted of 10 μ l 2X TaqMan Gene Expression Master Mix (Life Technologies, cat# 4369016), 1 μ l 20X TaqMan Gene Expression Assay (Applied Biosystems, cat# 4331182) for either MYC (Hs00905030_m1) or GAPDH (Hs02758991_g1), 2 μ l cDNA template, and 7 μ l water.

    Article Title: Potential Role of Activating Transcription Factor 5 during Osteogenesis
    Article Snippet: .. Real-Time RT-PCR Target mRNAs concentration was assessed by quantitative real-time PCR (qRT-PCR) on Applied Biosystem 7900HT fast real-time PCR system using comparative Ct method with fast SYBR Green chemistry (Applied Biosystem). .. PCR primers were designed using Primer BLAST [ ] to specifically recognize selected transcripts by targeting exon-exon junctions and tested for off-targeting using human RefSeq database [ ].

    Article Title: MiR-31 regulates the cisplatin resistance by targeting Src in gallbladder cancer
    Article Snippet: .. To measure the level of miR-31, quantitative real-time PCR (qRT-PCR) was performed on an ABI 7900HT fast real-time PCR system (Applied Biosystems, FosterCity, CA, USA) according to TaqMan Small RNA Assays protocol. ..

    SYBR Green Assay:

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L _human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: The Epithelial-Mesenchymal Transition (EMT) Regulatory Factor SLUG (SNAI2) Is a Downstream Target of SPARC and AKT in Promoting Melanoma Cell Invasion
    Article Snippet: .. Quantitative PCR was performed on 25 ng cDNA samples, in sealed 384-well microtiter plates using the SYBR Green™ PCR Master Mix (Applied Biosystems) with the 7900HT Fast Real-Time PCR System (Applied Biosystems). ..

    Article Title: Cooperative TRAIL production mediates IFNα/Smac mimetic-induced cell death in TNFα-resistant solid cancer cells
    Article Snippet: .. TNFα and TRAIL mRNA levels were assessed by Taqman Gene Expression Assay purchased from Life Technologies (TNFα: Hs01113624_g1, TRAIL: Hs00921974_m1) and the levels of 28S rRNA by SYBR®Green qPCR assay from Applied Biosystems (Darmstadt, Germany) according to the manufacturer's instructions using the 7900HT fast real-time PCR system from Applied Biosystems (Darmstadt, Germany); 28S rRNA forward primer: TTGAAAATCCGGGGGAGAG; reverse primer: ACATTGTTCCAACATGCCAG. .. The relative expression of the target gene transcript and reference gene transcript was calculated as ΔΔCt.

    Article Title: Potential Role of Activating Transcription Factor 5 during Osteogenesis
    Article Snippet: .. Real-Time RT-PCR Target mRNAs concentration was assessed by quantitative real-time PCR (qRT-PCR) on Applied Biosystem 7900HT fast real-time PCR system using comparative Ct method with fast SYBR Green chemistry (Applied Biosystem). .. PCR primers were designed using Primer BLAST [ ] to specifically recognize selected transcripts by targeting exon-exon junctions and tested for off-targeting using human RefSeq database [ ].

    Concentration Assay:

    Article Title: Potential Role of Activating Transcription Factor 5 during Osteogenesis
    Article Snippet: .. Real-Time RT-PCR Target mRNAs concentration was assessed by quantitative real-time PCR (qRT-PCR) on Applied Biosystem 7900HT fast real-time PCR system using comparative Ct method with fast SYBR Green chemistry (Applied Biosystem). .. PCR primers were designed using Primer BLAST [ ] to specifically recognize selected transcripts by targeting exon-exon junctions and tested for off-targeting using human RefSeq database [ ].

    Expressing:

    Article Title: Cooperative TRAIL production mediates IFNα/Smac mimetic-induced cell death in TNFα-resistant solid cancer cells
    Article Snippet: .. TNFα and TRAIL mRNA levels were assessed by Taqman Gene Expression Assay purchased from Life Technologies (TNFα: Hs01113624_g1, TRAIL: Hs00921974_m1) and the levels of 28S rRNA by SYBR®Green qPCR assay from Applied Biosystems (Darmstadt, Germany) according to the manufacturer's instructions using the 7900HT fast real-time PCR system from Applied Biosystems (Darmstadt, Germany); 28S rRNA forward primer: TTGAAAATCCGGGGGAGAG; reverse primer: ACATTGTTCCAACATGCCAG. .. The relative expression of the target gene transcript and reference gene transcript was calculated as ΔΔCt.

    Polymerase Chain Reaction:

    Article Title: Next-generation sequencing identified SPATC1L as a possible candidate gene for both early-onset and age-related hearing loss
    Article Snippet: .. Total RNA (1 μg) was reverse transcribed using Transcriptor First Strand cDNA Synthesis kit (Roche). qRT-PCR was performed using standard PCR conditions in a 7900HT fast real-time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). .. Gene-specific primers were designed with Primer3Web software ( http://bioinfo.ut.ee/primer3/ ) (Myc_For: 5′ AGCAGAAACTCATCTCAGAAG 3′; SPATC1L _human_cells_Rev: 5′ CGTGAACCTTCCGAAATCTG 3′).

    Article Title: The Epithelial-Mesenchymal Transition (EMT) Regulatory Factor SLUG (SNAI2) Is a Downstream Target of SPARC and AKT in Promoting Melanoma Cell Invasion
    Article Snippet: .. Quantitative PCR was performed on 25 ng cDNA samples, in sealed 384-well microtiter plates using the SYBR Green™ PCR Master Mix (Applied Biosystems) with the 7900HT Fast Real-Time PCR System (Applied Biosystems). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 7900ht fast realtime system
    7900ht Fast Realtime System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 246 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7900ht fast realtime system/product/Thermo Fisher
    Average 99 stars, based on 246 article reviews
    Price from $9.99 to $1999.99
    7900ht fast realtime system - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    88
    Thermo Fisher 7900ht fast realtime pcr system
    7900ht Fast Realtime Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7900ht fast realtime pcr system/product/Thermo Fisher
    Average 88 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    7900ht fast realtime pcr system - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results