mirnas  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    PAXgene Blood miRNA Kit
    Description:
    For purification of miRNA and total RNA from whole blood Kit contents Qiagen PAXgene Blood miRNA Kit 50 preps 2 5mL Sample 40L Elution Volume Whole Blood Sample Silica Technology Spin Column Format Manual Processing Ideal for RT PCR and Real time RT PCR cDNA synthesis Microarray Analysis Primer Extension RNase S1 Nuclease Protection For Purification of miRNA and Total RNA from Whole Blood Includes PAXgene Spin Columns PAXgene Shredder Spin Columns Processing Tubes Microcentrifuge Tubes RNase free DNase RNase free Reagents and Buffers Benefits Integrated system for collection stabilization and purification Effective purification of miRNA and total RNA RNA stabilization for up to 3 days at 18 25°C Stabilization for at least 50 months at 20°C or 70°C
    Catalog Number:
    763134
    Price:
    676
    Category:
    PAXgene Blood miRNA Kit
    Buy from Supplier


    Structured Review

    Qiagen mirnas
    PAXgene Blood miRNA Kit
    For purification of miRNA and total RNA from whole blood Kit contents Qiagen PAXgene Blood miRNA Kit 50 preps 2 5mL Sample 40L Elution Volume Whole Blood Sample Silica Technology Spin Column Format Manual Processing Ideal for RT PCR and Real time RT PCR cDNA synthesis Microarray Analysis Primer Extension RNase S1 Nuclease Protection For Purification of miRNA and Total RNA from Whole Blood Includes PAXgene Spin Columns PAXgene Shredder Spin Columns Processing Tubes Microcentrifuge Tubes RNase free DNase RNase free Reagents and Buffers Benefits Integrated system for collection stabilization and purification Effective purification of miRNA and total RNA RNA stabilization for up to 3 days at 18 25°C Stabilization for at least 50 months at 20°C or 70°C
    https://www.bioz.com/result/mirnas/product/Qiagen
    Average 99 stars, based on 27375 article reviews
    Price from $9.99 to $1999.99
    mirnas - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Next generation MicroRNA sequencing to identify coronary artery disease patients at risk of recurrent myocardial infarction"

    Article Title: Next generation MicroRNA sequencing to identify coronary artery disease patients at risk of recurrent myocardial infarction

    Journal: Atherosclerosis

    doi: 10.1016/j.atherosclerosis.2018.09.021

    Heat map of the expression profiles of the miRNA array analysis of 22 coronary artery disease patients with recurrent coronary events (blue) and 26 patients with no recurrent thrombotic coronary events (red). Subjects with stent thrombosis during follow up are identified. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
    Figure Legend Snippet: Heat map of the expression profiles of the miRNA array analysis of 22 coronary artery disease patients with recurrent coronary events (blue) and 26 patients with no recurrent thrombotic coronary events (red). Subjects with stent thrombosis during follow up are identified. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

    Techniques Used: Expressing

    Expression pattern of circulating distinct miRNA levels in blood samples of patients undergoing cardiac catheterization. Next generation miRNA sequence analysis of miRNA of whole blood samples of subjects with coronary disease and recurrent events and subjects with coronary disease and no recurrent events with false discovery rate of
    Figure Legend Snippet: Expression pattern of circulating distinct miRNA levels in blood samples of patients undergoing cardiac catheterization. Next generation miRNA sequence analysis of miRNA of whole blood samples of subjects with coronary disease and recurrent events and subjects with coronary disease and no recurrent events with false discovery rate of

    Techniques Used: Expressing, Sequencing

    Heat map of the expression profiles of the miRNA array analysis of 48 coronary artery disease patients (blue) and 24 controls without coronary disease on angiography (yellow). Differences in miRNA expression in CAD patients with recurrent thrombotic events vs. CAD patients with no recurrent events. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
    Figure Legend Snippet: Heat map of the expression profiles of the miRNA array analysis of 48 coronary artery disease patients (blue) and 24 controls without coronary disease on angiography (yellow). Differences in miRNA expression in CAD patients with recurrent thrombotic events vs. CAD patients with no recurrent events. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

    Techniques Used: Expressing

    2) Product Images from "Towards Clinical Applications of Blood-Borne miRNA Signatures: The Influence of the Anticoagulant EDTA on miRNA Abundance"

    Article Title: Towards Clinical Applications of Blood-Borne miRNA Signatures: The Influence of the Anticoagulant EDTA on miRNA Abundance

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0143321

    Heatmap of 321 miRNAs detected in at least 25% of samples. The X-axis differentiates between the four different blood sampling conditions. The light blue shading indicates blood that is directly (0 min) transferred into PAXgene TM tubes, the middle blue shading blood that is transferred 10min after phlebotomy and the dark blue shading blood that is transferred after 2 h. Blood that was directly collected in PAXgene TM blood RNA tubes is indicated in orange. The 6 individuals are indicated by symbols on top of the dendrogram. While the four samples belonging to one of the six individuals mostly cluster together there was no comparable clustering for any of the four tested blood sampling conditions.
    Figure Legend Snippet: Heatmap of 321 miRNAs detected in at least 25% of samples. The X-axis differentiates between the four different blood sampling conditions. The light blue shading indicates blood that is directly (0 min) transferred into PAXgene TM tubes, the middle blue shading blood that is transferred 10min after phlebotomy and the dark blue shading blood that is transferred after 2 h. Blood that was directly collected in PAXgene TM blood RNA tubes is indicated in orange. The 6 individuals are indicated by symbols on top of the dendrogram. While the four samples belonging to one of the six individuals mostly cluster together there was no comparable clustering for any of the four tested blood sampling conditions.

    Techniques Used: Sampling

    Microarray present call analysis. A) Average number (Y-axis) and standard deviation of miRNA detected in blood samples of six healthy individuals under four different blood sampling conditions (X-axis). Blood was collected in EDTA blood collection tubes and subsequently transferred into PAXgene TM tubes at three different time points, i.e. directly (0 min), 10 min, and 2 h after phlebotomy. As control blood was also directly collected in PAXgene TM blood RNA tubes. B) Venn diagram of miRNAs that were present in all six individuals under different blood sampling conditions. There were 201 miRNAs detected in all individuals under all conditions. No miRNA was detected both in blood that was directly collected in PAXgene TM blood RNA tubes and in blood that was transferred into PAXgene TM tubes 2 h after phlebotomy without also being detected in blood directly transferred or transferred 10 min after phlebotomy. C) Balloon plot of miRNAs that show a difference in frequency under the different blood sampling conditions. The X-axis shows the minimal number of individuals that are positive for a miRNA under one condition. The Y-axis shows the maximum number of individuals that are positive for a miRNA under one condition. The top left balloon denotes the 806 miRNAs that were not detected in any of the 24 samples (minimum and maximum of 0). The lower right balloon denotes the 201 miRNAs that were detected in all samples (minimum and maximum of 6). The orange shaded area presents 12 miRNAs that show a difference in frequency of at least three under one of the four conditions as compared to the other conditions. The largest difference was found for miR-769-3p indicated in the lower left corner that was positive in 6 samples under the 2h EDTA condition and not in any sample of the PAXgene condition.
    Figure Legend Snippet: Microarray present call analysis. A) Average number (Y-axis) and standard deviation of miRNA detected in blood samples of six healthy individuals under four different blood sampling conditions (X-axis). Blood was collected in EDTA blood collection tubes and subsequently transferred into PAXgene TM tubes at three different time points, i.e. directly (0 min), 10 min, and 2 h after phlebotomy. As control blood was also directly collected in PAXgene TM blood RNA tubes. B) Venn diagram of miRNAs that were present in all six individuals under different blood sampling conditions. There were 201 miRNAs detected in all individuals under all conditions. No miRNA was detected both in blood that was directly collected in PAXgene TM blood RNA tubes and in blood that was transferred into PAXgene TM tubes 2 h after phlebotomy without also being detected in blood directly transferred or transferred 10 min after phlebotomy. C) Balloon plot of miRNAs that show a difference in frequency under the different blood sampling conditions. The X-axis shows the minimal number of individuals that are positive for a miRNA under one condition. The Y-axis shows the maximum number of individuals that are positive for a miRNA under one condition. The top left balloon denotes the 806 miRNAs that were not detected in any of the 24 samples (minimum and maximum of 0). The lower right balloon denotes the 201 miRNAs that were detected in all samples (minimum and maximum of 6). The orange shaded area presents 12 miRNAs that show a difference in frequency of at least three under one of the four conditions as compared to the other conditions. The largest difference was found for miR-769-3p indicated in the lower left corner that was positive in 6 samples under the 2h EDTA condition and not in any sample of the PAXgene condition.

    Techniques Used: Microarray, Standard Deviation, Sampling

    3) Product Images from "Next generation MicroRNA sequencing to identify coronary artery disease patients at risk of recurrent myocardial infarction"

    Article Title: Next generation MicroRNA sequencing to identify coronary artery disease patients at risk of recurrent myocardial infarction

    Journal: Atherosclerosis

    doi: 10.1016/j.atherosclerosis.2018.09.021

    Heat map of the expression profiles of the miRNA array analysis of 22 coronary artery disease patients with recurrent coronary events (blue) and 26 patients with no recurrent thrombotic coronary events (red). Subjects with stent thrombosis during follow up are identified. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
    Figure Legend Snippet: Heat map of the expression profiles of the miRNA array analysis of 22 coronary artery disease patients with recurrent coronary events (blue) and 26 patients with no recurrent thrombotic coronary events (red). Subjects with stent thrombosis during follow up are identified. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

    Techniques Used: Expressing

    Expression pattern of circulating distinct miRNA levels in blood samples of patients undergoing cardiac catheterization. Next generation miRNA sequence analysis of miRNA of whole blood samples of subjects with coronary disease and recurrent events and subjects with coronary disease and no recurrent events with false discovery rate of
    Figure Legend Snippet: Expression pattern of circulating distinct miRNA levels in blood samples of patients undergoing cardiac catheterization. Next generation miRNA sequence analysis of miRNA of whole blood samples of subjects with coronary disease and recurrent events and subjects with coronary disease and no recurrent events with false discovery rate of

    Techniques Used: Expressing, Sequencing

    Heat map of the expression profiles of the miRNA array analysis of 48 coronary artery disease patients (blue) and 24 controls without coronary disease on angiography (yellow). Differences in miRNA expression in CAD patients with recurrent thrombotic events vs. CAD patients with no recurrent events. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
    Figure Legend Snippet: Heat map of the expression profiles of the miRNA array analysis of 48 coronary artery disease patients (blue) and 24 controls without coronary disease on angiography (yellow). Differences in miRNA expression in CAD patients with recurrent thrombotic events vs. CAD patients with no recurrent events. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

    Techniques Used: Expressing

    Related Articles

    Diagnostic Assay:

    Article Title: Whole blood microRNA expression may not be useful for screening non-small cell lung cancer
    Article Snippet: At least seven studies have suggested that microRNA levels in whole blood can be diagnostic for lung cancer. .. Qiagen® PAXgene™ Blood miRNA System was used to collect blood and extract RNA from it for 85 pathologic stage I-IV non-small cell lung cancer (NSCLC) cases and 76 clinically-relevant controls who had a benign pulmonary mass, or a high risk of developing lung cancer because of a history of cigarette smoking or age > 60 years.

    Clone Assay:

    Article Title: Self-reported prenatal tobacco smoke exposure, AXL gene-body methylation, and childhood asthma phenotypes
    Article Snippet: Total mRNA was isolated from stored PAXgene tubes of cord blood using the PAXgene blood miRNA isolation kit (Qiagen, Valencia, CA). .. Plasmid DNA containing a cloned fragment of the target gene was used as the qPCR copy number standard.

    Centrifugation:

    Article Title: Gene expression profiling of whole blood: A comparative assessment of RNA-stabilizing collection methods
    Article Snippet: This was accomplished by centrifugation of the samples at 1700 × G for 20 minutes at room temperature within two hours of blood collection, followed by carefully removing PBMCs using a transfer pipette. .. A 2.0 mL (PAXgene® RNA + blood) aliquot was used for automated RNA extractions with the PAXgene® RNA blood miRNA kit (Qiagen) employing an amended version of the manufacturer’s guidelines on the QIAcube Workstation (Qiagen) [ – ] Briefly, the tubes were centrifuged for 10 min at 3500 g, the supernatant decanted and 1000 μL of RNase-free water added to the pellet.

    Cycling Probe Technology:

    Article Title: Gene expression profiling of whole blood: A comparative assessment of RNA-stabilizing collection methods
    Article Snippet: Tubes were subsequently frozen at -20°C for at least 24 hours followed by storage at -80°C … In parallel, PBMCs separation was carried out using BD Vacutainer® CPT™ (BD Biosciences) at the collection site following the manufacturer’s instructions. .. A 2.0 mL (PAXgene® RNA + blood) aliquot was used for automated RNA extractions with the PAXgene® RNA blood miRNA kit (Qiagen) employing an amended version of the manufacturer’s guidelines on the QIAcube Workstation (Qiagen) [ – ] Briefly, the tubes were centrifuged for 10 min at 3500 g, the supernatant decanted and 1000 μL of RNase-free water added to the pellet.

    Polymerase Chain Reaction:

    Article Title: Circulating ADAM17 Level Reflects Disease Activity in Proteinase-3 ANCA-Associated Vasculitis
    Article Snippet: Total RNA and miRNA from whole blood stabilized in PAXgene Blood RNA tubes were purified using the PAXgene Blood miRNA Kit according to the manufacturer’s instructions (Qiagen). .. PCR results were normalized to the expression of ribosomal protein 13 A.

    SYBR Green Assay:

    Article Title: Suppressed diversity of survivin splicing in active rheumatoid arthritis
    Article Snippet: RNA isolation and SYBR Green-based real-time PCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and Paxgene Blood miRNA kit (Qiagen) according to the manufacturer’s recommendations. .. Transcription of survivin was assessed using SYBR Green qPCR Mastermix (SABiosciences, Qiagen) and ViiA™ 7 Real-Time PCR (Applied Biosystems).

    Expressing:

    Article Title: Circulating ADAM17 Level Reflects Disease Activity in Proteinase-3 ANCA-Associated Vasculitis
    Article Snippet: Total RNA and miRNA from whole blood stabilized in PAXgene Blood RNA tubes were purified using the PAXgene Blood miRNA Kit according to the manufacturer’s instructions (Qiagen). .. PCR results were normalized to the expression of ribosomal protein 13 A.

    Article Title: Associations between Serum Sex Hormone Concentrations and Whole Blood Gene Expression Profiles in the General Population
    Article Snippet: .. Gene expression data RNA was prepared from whole blood collected and stored in PAXgene Blood RNA Tubes (BD, Heidelberg, Germany) using the PAXgene Blood miRNA Kit (Qiagen, Hilden, Germany). .. Isolation of RNA was performed using a QIAcube according to protocols provided by the manufacturer Qiagen.

    Article Title: The prognostic value of whole blood SOX2, NANOG and OCT4 mRNA expression in advanced small-cell lung cancer
    Article Snippet: .. mRNA expression analysis Total RNA was isolated from whole blood using PAXgene Blood miRNA Kit (Qiagen) using the fully automated QIAcube system (Qiagen) to standardize the RNA isolation procedure. .. Total RNA quantity and purity were assessed using NanoDrop 2000 (ThermoScientific).

    Article Title: Self-reported prenatal tobacco smoke exposure, AXL gene-body methylation, and childhood asthma phenotypes
    Article Snippet: Paragraph title: miRNA and mRNA expression in NEST ... Total mRNA was isolated from stored PAXgene tubes of cord blood using the PAXgene blood miRNA isolation kit (Qiagen, Valencia, CA).

    Transferring:

    Article Title: Gene expression profiling of whole blood: A comparative assessment of RNA-stabilizing collection methods
    Article Snippet: This was accomplished by centrifugation of the samples at 1700 × G for 20 minutes at room temperature within two hours of blood collection, followed by carefully removing PBMCs using a transfer pipette. .. A 2.0 mL (PAXgene® RNA + blood) aliquot was used for automated RNA extractions with the PAXgene® RNA blood miRNA kit (Qiagen) employing an amended version of the manufacturer’s guidelines on the QIAcube Workstation (Qiagen) [ – ] Briefly, the tubes were centrifuged for 10 min at 3500 g, the supernatant decanted and 1000 μL of RNase-free water added to the pellet.

    Sequencing:

    Article Title: Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression. Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression
    Article Snippet: Paragraph title: 2.2. RNA sample preparation and sequencing of multiplexed small RNA samples ... The blood was gently thawed on ice and transferred to a PAXgene blood RNA tube 16 hours before the start of RNA extraction with a PAXgene Blood miRNA Kit (Qiagen, Hombrechtikon, Switzerland).

    Article Title: Minority Stress and Leukocyte Gene Expression in Sexual Minority Men Living with Treated HIV Infection
    Article Snippet: Paragraph title: 2.2.1. Sample preparation and sequencing ... Total RNA was isolated from samples in PAXgene tubes using the PAXgene blood miRNA kit (Qiagen).

    Isolation:

    Article Title: Circulating ADAM17 Level Reflects Disease Activity in Proteinase-3 ANCA-Associated Vasculitis
    Article Snippet: Paragraph title: RNA Isolation and Real-Time Quantitative PCR ... Total RNA and miRNA from whole blood stabilized in PAXgene Blood RNA tubes were purified using the PAXgene Blood miRNA Kit according to the manufacturer’s instructions (Qiagen).

    Article Title: Associations between Serum Sex Hormone Concentrations and Whole Blood Gene Expression Profiles in the General Population
    Article Snippet: Gene expression data RNA was prepared from whole blood collected and stored in PAXgene Blood RNA Tubes (BD, Heidelberg, Germany) using the PAXgene Blood miRNA Kit (Qiagen, Hilden, Germany). .. Isolation of RNA was performed using a QIAcube according to protocols provided by the manufacturer Qiagen.

    Article Title: The prognostic value of whole blood SOX2, NANOG and OCT4 mRNA expression in advanced small-cell lung cancer
    Article Snippet: .. mRNA expression analysis Total RNA was isolated from whole blood using PAXgene Blood miRNA Kit (Qiagen) using the fully automated QIAcube system (Qiagen) to standardize the RNA isolation procedure. .. Total RNA quantity and purity were assessed using NanoDrop 2000 (ThermoScientific).

    Article Title: Towards Clinical Applications of Blood-Borne miRNA Signatures: The Influence of the Anticoagulant EDTA on miRNA Abundance
    Article Snippet: .. RNA isolation Total RNA of all samples was isolated using the PAXgene miRNA blood Kit (Qiagen) and under standardized conditions using the QIAcube (Qiagen). ..

    Article Title: The sbv IMPROVER Systems Toxicology Computational Challenge: Identification of Human and Species-Independent Blood Response Markers as Predictors of Smoking Exposure and Cessation Status
    Article Snippet: .. For the clinical studies, total RNA was isolated using a PAXgene™ Blood miRNA Kit (catalog number 763134; Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. .. For the in vivo mouse studies, total RNA was isolated using a RNeasy Protect Animal Blood Kit (catalog number 73224; Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions.

    Article Title: Suppressed diversity of survivin splicing in active rheumatoid arthritis
    Article Snippet: .. RNA isolation and SYBR Green-based real-time PCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and Paxgene Blood miRNA kit (Qiagen) according to the manufacturer’s recommendations. .. The RNA concentration and quality were measured using a Nanodrop spectrophotometer (ND1000 Spectrophotometer) and Experion™ RNA StdSens Analysis chip (Bio-Rad Laboratories, Hercules, CA, USA). cDNA was synthesised using the Applied Biosystems (Foster City, CA, USA) High-Capacity cDNA Reverse Transcription Kit according to the manufacturer’s recommendations.

    Article Title: Minority Stress and Leukocyte Gene Expression in Sexual Minority Men Living with Treated HIV Infection
    Article Snippet: .. Total RNA was isolated from samples in PAXgene tubes using the PAXgene blood miRNA kit (Qiagen). .. Library preparation and sequencing was done by a Core Facility, the Vincent J. Coates Genomics Sequencing Laboratory at the University of California, Berkeley.

    Article Title: Self-reported prenatal tobacco smoke exposure, AXL gene-body methylation, and childhood asthma phenotypes
    Article Snippet: .. Total mRNA was isolated from stored PAXgene tubes of cord blood using the PAXgene blood miRNA isolation kit (Qiagen, Valencia, CA). .. Expression of miR-199a1 was quantified using Origene’s qStar miRNA detection system (Origene, Rockville, MD) with qStar primer pairs specifically designed for the target (miR-199a1 transcript # ) and its corresponding copy number standard (# ).

    Article Title: Gene expression profiling of whole blood: A comparative assessment of RNA-stabilizing collection methods
    Article Snippet: Paragraph title: Blood collection and nucleic acid isolation ... A 2.0 mL (PAXgene® RNA + blood) aliquot was used for automated RNA extractions with the PAXgene® RNA blood miRNA kit (Qiagen) employing an amended version of the manufacturer’s guidelines on the QIAcube Workstation (Qiagen) [ – ] Briefly, the tubes were centrifuged for 10 min at 3500 g, the supernatant decanted and 1000 μL of RNase-free water added to the pellet.

    RNA Extraction:

    Article Title: Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression. Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression
    Article Snippet: .. The blood was gently thawed on ice and transferred to a PAXgene blood RNA tube 16 hours before the start of RNA extraction with a PAXgene Blood miRNA Kit (Qiagen, Hombrechtikon, Switzerland). .. The RNA concentrations were measured with Qubit RNA BR assay kit (ThermoFisher, Basel, Switzerland).

    Purification:

    Article Title: Circulating ADAM17 Level Reflects Disease Activity in Proteinase-3 ANCA-Associated Vasculitis
    Article Snippet: .. Total RNA and miRNA from whole blood stabilized in PAXgene Blood RNA tubes were purified using the PAXgene Blood miRNA Kit according to the manufacturer’s instructions (Qiagen). .. Gene-specific oligonucleotides for ADAM17, ADAM10, and TIMP3 and miScript primers for miRNA-643 were obtained from Qiagen (QuantiTect Primer Assay) with the following corresponding ordering numbers: ADAM17 (QT00055580), ADAM10 (QT00032641), TIMP3 (QT00046382), and miRNA-634 (MS00005201).

    Article Title: The prognostic value of whole blood SOX2, NANOG and OCT4 mRNA expression in advanced small-cell lung cancer
    Article Snippet: mRNA expression analysis Total RNA was isolated from whole blood using PAXgene Blood miRNA Kit (Qiagen) using the fully automated QIAcube system (Qiagen) to standardize the RNA isolation procedure. .. After isolation and purification of total RNA from blood samples additional step including digestion of genomic DNA with DNaseI (ThermoScientific) was included.

    Article Title: Gene expression profiling of whole blood: A comparative assessment of RNA-stabilizing collection methods
    Article Snippet: A 2.0 mL (PAXgene® RNA + blood) aliquot was used for automated RNA extractions with the PAXgene® RNA blood miRNA kit (Qiagen) employing an amended version of the manufacturer’s guidelines on the QIAcube Workstation (Qiagen) [ – ] Briefly, the tubes were centrifuged for 10 min at 3500 g, the supernatant decanted and 1000 μL of RNase-free water added to the pellet. .. Breifly, The automated RNA purification protocol consists of 2 parts, “PAXgene Blood miRNA Part A” in which the QIAcube performs the steps of the protocol through to elution of RNA in elution buffer, and “PAXgene Blood miRNA Part B” where heat denaturation of samples at 65°C is performed by the QIAcube, with a brief manual intervention between the 2 parts where microcentrifuge tubes, containing the purified RNA, are transferred into the thermoshaker unit of the QIAcube.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Whole blood microRNA expression may not be useful for screening non-small cell lung cancer
    Article Snippet: Qiagen® PAXgene™ Blood miRNA System was used to collect blood and extract RNA from it for 85 pathologic stage I-IV non-small cell lung cancer (NSCLC) cases and 76 clinically-relevant controls who had a benign pulmonary mass, or a high risk of developing lung cancer because of a history of cigarette smoking or age > 60 years. .. Quantification was also performed using Taqman™ microRNA reverse transcription (RT)-PCR assays for five microRNAs whose lung cancer-diagnostic potential had been suggested in seven published studies.

    Chromatin Immunoprecipitation:

    Article Title: Suppressed diversity of survivin splicing in active rheumatoid arthritis
    Article Snippet: RNA isolation and SYBR Green-based real-time PCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and Paxgene Blood miRNA kit (Qiagen) according to the manufacturer’s recommendations. .. The RNA concentration and quality were measured using a Nanodrop spectrophotometer (ND1000 Spectrophotometer) and Experion™ RNA StdSens Analysis chip (Bio-Rad Laboratories, Hercules, CA, USA). cDNA was synthesised using the Applied Biosystems (Foster City, CA, USA) High-Capacity cDNA Reverse Transcription Kit according to the manufacturer’s recommendations.

    Plasmid Preparation:

    Article Title: Self-reported prenatal tobacco smoke exposure, AXL gene-body methylation, and childhood asthma phenotypes
    Article Snippet: Total mRNA was isolated from stored PAXgene tubes of cord blood using the PAXgene blood miRNA isolation kit (Qiagen, Valencia, CA). .. Plasmid DNA containing a cloned fragment of the target gene was used as the qPCR copy number standard.

    Real-time Polymerase Chain Reaction:

    Article Title: Circulating ADAM17 Level Reflects Disease Activity in Proteinase-3 ANCA-Associated Vasculitis
    Article Snippet: Paragraph title: RNA Isolation and Real-Time Quantitative PCR ... Total RNA and miRNA from whole blood stabilized in PAXgene Blood RNA tubes were purified using the PAXgene Blood miRNA Kit according to the manufacturer’s instructions (Qiagen).

    Article Title: Suppressed diversity of survivin splicing in active rheumatoid arthritis
    Article Snippet: .. RNA isolation and SYBR Green-based real-time PCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and Paxgene Blood miRNA kit (Qiagen) according to the manufacturer’s recommendations. .. The RNA concentration and quality were measured using a Nanodrop spectrophotometer (ND1000 Spectrophotometer) and Experion™ RNA StdSens Analysis chip (Bio-Rad Laboratories, Hercules, CA, USA). cDNA was synthesised using the Applied Biosystems (Foster City, CA, USA) High-Capacity cDNA Reverse Transcription Kit according to the manufacturer’s recommendations.

    Article Title: Self-reported prenatal tobacco smoke exposure, AXL gene-body methylation, and childhood asthma phenotypes
    Article Snippet: Total mRNA was isolated from stored PAXgene tubes of cord blood using the PAXgene blood miRNA isolation kit (Qiagen, Valencia, CA). .. Plasmid DNA containing a cloned fragment of the target gene was used as the qPCR copy number standard.

    Multiplex Assay:

    Article Title: Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression. Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression
    Article Snippet: The blood was gently thawed on ice and transferred to a PAXgene blood RNA tube 16 hours before the start of RNA extraction with a PAXgene Blood miRNA Kit (Qiagen, Hombrechtikon, Switzerland). .. A total of 14.6‐54.6 ng of small RNA was used for stranded single‐end library preparation (NEBNext Multiplex Small RNA Library Prep Set for Illumina) and sequenced (HiSeq3000, Illumina).

    Sample Prep:

    Article Title: Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression. Differences in miRNA differential expression in whole blood between horses with sarcoid regression and progression
    Article Snippet: Paragraph title: 2.2. RNA sample preparation and sequencing of multiplexed small RNA samples ... The blood was gently thawed on ice and transferred to a PAXgene blood RNA tube 16 hours before the start of RNA extraction with a PAXgene Blood miRNA Kit (Qiagen, Hombrechtikon, Switzerland).

    Article Title: Minority Stress and Leukocyte Gene Expression in Sexual Minority Men Living with Treated HIV Infection
    Article Snippet: Paragraph title: 2.2.1. Sample preparation and sequencing ... Total RNA was isolated from samples in PAXgene tubes using the PAXgene blood miRNA kit (Qiagen).

    Preserving:

    Article Title: Using Domestic and Free-Ranging Arctic Canid Models for Environmental Molecular Toxicology Research
    Article Snippet: Paragraph title: 2.4.1. RNA Preservation and Extraction ... RNA was extracted using PaxGene Blood miRNA Kit (Qiagen) and quantity and integrity determined using an Agilent 2100 Bioanalyzer (Agilent Technologies) or a Nano-Drop ND-1000 Spectrophotometer (Thermo Fisher Scientific).

    Spectrophotometry:

    Article Title: Associations between Serum Sex Hormone Concentrations and Whole Blood Gene Expression Profiles in the General Population
    Article Snippet: Gene expression data RNA was prepared from whole blood collected and stored in PAXgene Blood RNA Tubes (BD, Heidelberg, Germany) using the PAXgene Blood miRNA Kit (Qiagen, Hilden, Germany). .. Purity and concentration of RNA were determined using a NanoDrop ND-1000 UV-Vis Spectrophotometer (Thermo Scientific, Hennigsdorf, Germany).

    Article Title: The sbv IMPROVER Systems Toxicology Computational Challenge: Identification of Human and Species-Independent Blood Response Markers as Predictors of Smoking Exposure and Cessation Status
    Article Snippet: For the clinical studies, total RNA was isolated using a PAXgene™ Blood miRNA Kit (catalog number 763134; Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. .. The concentration and purity of the RNA samples were determined using a UV spectrophotometer (NanoDrop® 1000 or Nanodrop 8000; Thermo Fisher Scientific, Waltham, MA, USA) by measuring the absorbance at 230, 260, and 280 nm.

    Article Title: Suppressed diversity of survivin splicing in active rheumatoid arthritis
    Article Snippet: RNA isolation and SYBR Green-based real-time PCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and Paxgene Blood miRNA kit (Qiagen) according to the manufacturer’s recommendations. .. The RNA concentration and quality were measured using a Nanodrop spectrophotometer (ND1000 Spectrophotometer) and Experion™ RNA StdSens Analysis chip (Bio-Rad Laboratories, Hercules, CA, USA). cDNA was synthesised using the Applied Biosystems (Foster City, CA, USA) High-Capacity cDNA Reverse Transcription Kit according to the manufacturer’s recommendations.

    Article Title: Using Domestic and Free-Ranging Arctic Canid Models for Environmental Molecular Toxicology Research
    Article Snippet: .. RNA was extracted using PaxGene Blood miRNA Kit (Qiagen) and quantity and integrity determined using an Agilent 2100 Bioanalyzer (Agilent Technologies) or a Nano-Drop ND-1000 Spectrophotometer (Thermo Fisher Scientific). .. RNA integrity within the cell is dependent on a complex series of responses that are set in motion in response to insult (prior to or concurrent with sampling), including the critical interval between the time of collection and time of tissue preservation (e.g., stabilization of mRNA).

    Concentration Assay:

    Article Title: Associations between Serum Sex Hormone Concentrations and Whole Blood Gene Expression Profiles in the General Population
    Article Snippet: Gene expression data RNA was prepared from whole blood collected and stored in PAXgene Blood RNA Tubes (BD, Heidelberg, Germany) using the PAXgene Blood miRNA Kit (Qiagen, Hilden, Germany). .. Purity and concentration of RNA were determined using a NanoDrop ND-1000 UV-Vis Spectrophotometer (Thermo Scientific, Hennigsdorf, Germany).

    Article Title: The sbv IMPROVER Systems Toxicology Computational Challenge: Identification of Human and Species-Independent Blood Response Markers as Predictors of Smoking Exposure and Cessation Status
    Article Snippet: For the clinical studies, total RNA was isolated using a PAXgene™ Blood miRNA Kit (catalog number 763134; Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. .. The concentration and purity of the RNA samples were determined using a UV spectrophotometer (NanoDrop® 1000 or Nanodrop 8000; Thermo Fisher Scientific, Waltham, MA, USA) by measuring the absorbance at 230, 260, and 280 nm.

    Article Title: Suppressed diversity of survivin splicing in active rheumatoid arthritis
    Article Snippet: RNA isolation and SYBR Green-based real-time PCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and Paxgene Blood miRNA kit (Qiagen) according to the manufacturer’s recommendations. .. The RNA concentration and quality were measured using a Nanodrop spectrophotometer (ND1000 Spectrophotometer) and Experion™ RNA StdSens Analysis chip (Bio-Rad Laboratories, Hercules, CA, USA). cDNA was synthesised using the Applied Biosystems (Foster City, CA, USA) High-Capacity cDNA Reverse Transcription Kit according to the manufacturer’s recommendations.

    Lysis:

    Article Title: Gene expression profiling of whole blood: A comparative assessment of RNA-stabilizing collection methods
    Article Snippet: The tubes were thawed overnight at room temperature to ensure complete lysis of blood cells and maximize the mRNA yield. .. A 2.0 mL (PAXgene® RNA + blood) aliquot was used for automated RNA extractions with the PAXgene® RNA blood miRNA kit (Qiagen) employing an amended version of the manufacturer’s guidelines on the QIAcube Workstation (Qiagen) [ – ] Briefly, the tubes were centrifuged for 10 min at 3500 g, the supernatant decanted and 1000 μL of RNase-free water added to the pellet.

    Variant Assay:

    Article Title: Suppressed diversity of survivin splicing in active rheumatoid arthritis
    Article Snippet: RNA isolation and SYBR Green-based real-time PCR Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and Paxgene Blood miRNA kit (Qiagen) according to the manufacturer’s recommendations. .. All samples used the identical forward primer GACCACCGCATCTCTACATTC and splice variant specific reverse primers (Fig. ): survivin-WT, TGCTTTTTATGTTCCTCTATGGG; survivin-2B, AAGTGCTGGTATTACAGGCGT; and survivin-ΔEx3, ATTGTTGGTTTCCTTTGCATG [ ] (Sigma).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen paxgene mirna blood kit
    Heatmap of 321 <t>miRNAs</t> detected in at least 25% of samples. The X-axis differentiates between the four different blood sampling conditions. The light blue shading indicates blood that is directly (0 min) transferred into <t>PAXgene</t> TM tubes, the middle blue shading blood that is transferred 10min after phlebotomy and the dark blue shading blood that is transferred after 2 h. Blood that was directly collected in PAXgene TM blood RNA tubes is indicated in orange. The 6 individuals are indicated by symbols on top of the dendrogram. While the four samples belonging to one of the six individuals mostly cluster together there was no comparable clustering for any of the four tested blood sampling conditions.
    Paxgene Mirna Blood Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/paxgene mirna blood kit/product/Qiagen
    Average 99 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    paxgene mirna blood kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Heatmap of 321 miRNAs detected in at least 25% of samples. The X-axis differentiates between the four different blood sampling conditions. The light blue shading indicates blood that is directly (0 min) transferred into PAXgene TM tubes, the middle blue shading blood that is transferred 10min after phlebotomy and the dark blue shading blood that is transferred after 2 h. Blood that was directly collected in PAXgene TM blood RNA tubes is indicated in orange. The 6 individuals are indicated by symbols on top of the dendrogram. While the four samples belonging to one of the six individuals mostly cluster together there was no comparable clustering for any of the four tested blood sampling conditions.

    Journal: PLoS ONE

    Article Title: Towards Clinical Applications of Blood-Borne miRNA Signatures: The Influence of the Anticoagulant EDTA on miRNA Abundance

    doi: 10.1371/journal.pone.0143321

    Figure Lengend Snippet: Heatmap of 321 miRNAs detected in at least 25% of samples. The X-axis differentiates between the four different blood sampling conditions. The light blue shading indicates blood that is directly (0 min) transferred into PAXgene TM tubes, the middle blue shading blood that is transferred 10min after phlebotomy and the dark blue shading blood that is transferred after 2 h. Blood that was directly collected in PAXgene TM blood RNA tubes is indicated in orange. The 6 individuals are indicated by symbols on top of the dendrogram. While the four samples belonging to one of the six individuals mostly cluster together there was no comparable clustering for any of the four tested blood sampling conditions.

    Article Snippet: RNA isolation Total RNA of all samples was isolated using the PAXgene miRNA blood Kit (Qiagen) and under standardized conditions using the QIAcube (Qiagen).

    Techniques: Sampling

    Microarray present call analysis. A) Average number (Y-axis) and standard deviation of miRNA detected in blood samples of six healthy individuals under four different blood sampling conditions (X-axis). Blood was collected in EDTA blood collection tubes and subsequently transferred into PAXgene TM tubes at three different time points, i.e. directly (0 min), 10 min, and 2 h after phlebotomy. As control blood was also directly collected in PAXgene TM blood RNA tubes. B) Venn diagram of miRNAs that were present in all six individuals under different blood sampling conditions. There were 201 miRNAs detected in all individuals under all conditions. No miRNA was detected both in blood that was directly collected in PAXgene TM blood RNA tubes and in blood that was transferred into PAXgene TM tubes 2 h after phlebotomy without also being detected in blood directly transferred or transferred 10 min after phlebotomy. C) Balloon plot of miRNAs that show a difference in frequency under the different blood sampling conditions. The X-axis shows the minimal number of individuals that are positive for a miRNA under one condition. The Y-axis shows the maximum number of individuals that are positive for a miRNA under one condition. The top left balloon denotes the 806 miRNAs that were not detected in any of the 24 samples (minimum and maximum of 0). The lower right balloon denotes the 201 miRNAs that were detected in all samples (minimum and maximum of 6). The orange shaded area presents 12 miRNAs that show a difference in frequency of at least three under one of the four conditions as compared to the other conditions. The largest difference was found for miR-769-3p indicated in the lower left corner that was positive in 6 samples under the 2h EDTA condition and not in any sample of the PAXgene condition.

    Journal: PLoS ONE

    Article Title: Towards Clinical Applications of Blood-Borne miRNA Signatures: The Influence of the Anticoagulant EDTA on miRNA Abundance

    doi: 10.1371/journal.pone.0143321

    Figure Lengend Snippet: Microarray present call analysis. A) Average number (Y-axis) and standard deviation of miRNA detected in blood samples of six healthy individuals under four different blood sampling conditions (X-axis). Blood was collected in EDTA blood collection tubes and subsequently transferred into PAXgene TM tubes at three different time points, i.e. directly (0 min), 10 min, and 2 h after phlebotomy. As control blood was also directly collected in PAXgene TM blood RNA tubes. B) Venn diagram of miRNAs that were present in all six individuals under different blood sampling conditions. There were 201 miRNAs detected in all individuals under all conditions. No miRNA was detected both in blood that was directly collected in PAXgene TM blood RNA tubes and in blood that was transferred into PAXgene TM tubes 2 h after phlebotomy without also being detected in blood directly transferred or transferred 10 min after phlebotomy. C) Balloon plot of miRNAs that show a difference in frequency under the different blood sampling conditions. The X-axis shows the minimal number of individuals that are positive for a miRNA under one condition. The Y-axis shows the maximum number of individuals that are positive for a miRNA under one condition. The top left balloon denotes the 806 miRNAs that were not detected in any of the 24 samples (minimum and maximum of 0). The lower right balloon denotes the 201 miRNAs that were detected in all samples (minimum and maximum of 6). The orange shaded area presents 12 miRNAs that show a difference in frequency of at least three under one of the four conditions as compared to the other conditions. The largest difference was found for miR-769-3p indicated in the lower left corner that was positive in 6 samples under the 2h EDTA condition and not in any sample of the PAXgene condition.

    Article Snippet: RNA isolation Total RNA of all samples was isolated using the PAXgene miRNA blood Kit (Qiagen) and under standardized conditions using the QIAcube (Qiagen).

    Techniques: Microarray, Standard Deviation, Sampling