rneasy plant mini kit 74903  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    RNeasy Plant Mini Kit
    Description:
    For purification of total RNA from plants and fungi Kit contents Qiagen RNeasy Plant Mini Kit 20 preps 10 to 100mg Sample 30 to 100L Elution Volume Plant Sample Total RNA Purification Spin Column Format Silica Technology Ideal for Northern Dot and Slot Blotting End point RT PCR Quantitative Real time RT PCR Array Analysis Includes 20 RNeasy Mini Spin Columns 20 QIAshredder Mini Spin Columns Collection Tubes 1 5mL and 2mL RNase free Reagents and Buffers Benefits High quality total RNA in 30 minutes No phenol chloroform extraction No CsCl gradients no LiCl or ethanol precipitation Excellent recovery of RNA Ready to use RNA for any downstream applicatio
    Catalog Number:
    74903
    Price:
    155
    Category:
    RNeasy Plant Mini Kit
    Buy from Supplier


    Structured Review

    Qiagen rneasy plant mini kit 74903
    RNeasy Plant Mini Kit
    For purification of total RNA from plants and fungi Kit contents Qiagen RNeasy Plant Mini Kit 20 preps 10 to 100mg Sample 30 to 100L Elution Volume Plant Sample Total RNA Purification Spin Column Format Silica Technology Ideal for Northern Dot and Slot Blotting End point RT PCR Quantitative Real time RT PCR Array Analysis Includes 20 RNeasy Mini Spin Columns 20 QIAshredder Mini Spin Columns Collection Tubes 1 5mL and 2mL RNase free Reagents and Buffers Benefits High quality total RNA in 30 minutes No phenol chloroform extraction No CsCl gradients no LiCl or ethanol precipitation Excellent recovery of RNA Ready to use RNA for any downstream applicatio
    https://www.bioz.com/result/rneasy plant mini kit 74903/product/Qiagen
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rneasy plant mini kit 74903 - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: The resulting fragment was cloned into the binary vector pTkan, a derivative of pPZP221 ( ). .. To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer.

    Amplification:

    Article Title: CYP703 Is an Ancient Cytochrome P450 in Land Plants Catalyzing in-Chain Hydroxylation of Lauric Acid to Provide Building Blocks for Sporopollenin Synthesis in Pollen [W]
    Article Snippet: Total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) from flowers at stages 6.10 to 6.50 ( ). .. Forty amplification cycles were performed: 10 s at 98°C, 30 s at 60°C, and 15 s at 72°C.

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi. .. For PCR amplification of the partial cnl gene and cDNA sequences, genomic DNA and reverse transcript were used as templates.

    Article Title: Light Regulation of Carotenoid Biosynthesis in the Peel of Mandarin and Sweet Orange Fruits
    Article Snippet: Quantitative Real Time-PCR Total RNA was isolated from the fruit flavedo at each harvesting date, using RNeasy Plant Mini Kit (Qiagen) and subsequently treated with DNase (DNA free, DNase treatment & removal, Ambion). .. One microliter of a 5 times diluted first-strand cDNA, containing approximately 100 ng of cDNA, was used for each amplification reaction.

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer. .. AtVMA21∷GFP cDNA was amplified using the primers AtVMA21cds.FOR (5’- ATG GCT GGG GTT ATG CAC AAG-3’) and AtVMA21cds.REV (5’- CTC TTG TTT CTT CAG CGC AG-3’).

    Article Title: INCREASED SIZE EXCLUSION LIMIT2 Encodes a Putative DEVH Box RNA Helicase Involved in Plasmodesmata Function during Arabidopsis Embryogenesis [W]
    Article Snippet: To analyze the expression of ISE2 mRNA in different tissues, total RNA was extracted from quick-frozen tissue using the RNeasy plant mini kit (Qiagen), followed by digestion with DNase I (DNA-free; Ambion). .. C-terminal ISE2 sequences were amplified and subsequently subcloned using pGATEWAY technology (Invitrogen).

    Article Title: Ectopic expression of a Citrus kinokuni β-carotene hydroxylase gene (chyb) promotes UV and oxidative stress resistance by metabolic engineering of zeaxanthin in tobacco
    Article Snippet: Total RNA was isolated from 100 mg of frozen tobacco leaves using the RNeasy® Plant Mini Kit [QIAGEN China (Shanghai) Co., Ltd, China]. .. Tobacco Ubi gene (GenBank accession no. ) (Zhao et al. ) was amplified along with chyb gene as an internal control to normalize the relative transcript levels.

    Expressing:

    Article Title: CYP703 Is an Ancient Cytochrome P450 in Land Plants Catalyzing in-Chain Hydroxylation of Lauric Acid to Provide Building Blocks for Sporopollenin Synthesis in Pollen [W]
    Article Snippet: Total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) from flowers at stages 6.10 to 6.50 ( ). .. RNA (1 μg) was reverse-transcribed with the iScript cDNA synthesis kit (Bio-Rad), and CYP703A2 expression was subsequently visualized by PCR with the primers 5′-TTAAAGCTCTAATTCAGGACATGATAG-3′ and 5′-CCATAAACTTCCACCGTATCAATATTTC-3′ using the Phusion High-Fidelity DNA polymerase (Finnzymes) and following the manufacturer's protocol.

    Article Title: PpAKR1A, a Novel Aldo-Keto Reductase from Physcomitrella Patens, Plays a Positive Role in Salt Stress
    Article Snippet: Quantitative Real-Time Reverse Transcription PCR (qRT-PCR) Analysis Total RNA was extracted from plant tissues using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). .. The P. patens gene encoding tubulin (forward: GAGTTCACGGAAGCGGAGAG; reverse: TCCTCCAGATCCTCCTCATA) was used as a standard to normalise the cDNA expression concentrations.

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: .. To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer. .. AtVMA21∷GFP cDNA was amplified using the primers AtVMA21cds.FOR (5’- ATG GCT GGG GTT ATG CAC AAG-3’) and AtVMA21cds.REV (5’- CTC TTG TTT CTT CAG CGC AG-3’).

    Article Title: Gibberellin Promotes Sweetpotato Root Vascular Lignification and Reduces Storage-Root Formation
    Article Snippet: .. RNA Extraction and Gene Expression Analysis Total RNA was extracted from sweetpotato ARs at 1W, 2W, and 5W after planting (5W sampled roots included both, ARs and SRs), using RNeasy Plant Mini Kit (Qiagen, Germany). .. The integrity and quantity of RNA was examined by gel-electrophoresis and nanodrop (ND 1000, Thermo Scientific, USA), respectively.

    Article Title: Cytochrome P450 CYP710A Encodes the Sterol C-22 Desaturase in Arabidopsis and Tomato [W] and Tomato [W] [OA]
    Article Snippet: RT-PCR analyses were done for detailed comparison of the expression levels of CYP710A1 , CYP710A2 , CYP710A3 , and CYP710A4 genes in Arabidopsis . .. Total RNA was isolated using an RNeasy plant mini kit (Qiagen), and genomic DNA contamination was eliminated using an RNase free DNase set (Qiagen).

    Article Title: INCREASED SIZE EXCLUSION LIMIT2 Encodes a Putative DEVH Box RNA Helicase Involved in Plasmodesmata Function during Arabidopsis Embryogenesis [W]
    Article Snippet: .. To analyze the expression of ISE2 mRNA in different tissues, total RNA was extracted from quick-frozen tissue using the RNeasy plant mini kit (Qiagen), followed by digestion with DNase I (DNA-free; Ambion). .. Two micrograms of RNA were used as template for reverse transcription followed by PCR.

    Article Title: Ectopic expression of a Citrus kinokuni β-carotene hydroxylase gene (chyb) promotes UV and oxidative stress resistance by metabolic engineering of zeaxanthin in tobacco
    Article Snippet: Paragraph title: Expression analyses by quantitative real-time PCR (qPCR) ... Total RNA was isolated from 100 mg of frozen tobacco leaves using the RNeasy® Plant Mini Kit [QIAGEN China (Shanghai) Co., Ltd, China].

    Synthesized:

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi. .. First strand complementary DNA (cDNA) was synthesized from the total RNA by reverse transcription-polymerase chain reaction (PCR) using a GeneAmp RNA PCR Core Kit (Applied Biosystems, Foster city, CA) with anchored oligo(dT)-adapter primer dT(17)3’RACE ( , Supplementary data).

    Article Title: Genetic engineering of parthenocarpic tomato plants using transient SlIAA9 knockdown by novel tissue-specific promoters
    Article Snippet: DNA and RNA extraction and cDNA synthesis Genomic DNA and total RNA were extracted using a DNeasy or RNeasy plant mini kit (Qiagen) according to the manufacturer’s instructions. .. First-strand cDNA was synthesized from 1 μg of total RNA using the PrimeScript II 1st strand cDNA Synthesis Kit (Takara-bio) and oligo dT primers.

    Article Title: Cytochrome P450 CYP710A Encodes the Sterol C-22 Desaturase in Arabidopsis and Tomato [W] and Tomato [W] [OA]
    Article Snippet: Total RNA was isolated using an RNeasy plant mini kit (Qiagen), and genomic DNA contamination was eliminated using an RNase free DNase set (Qiagen). .. First-strand cDNA was synthesized using the Takara RNA PCR kit (AMV) version 3.0 in a 10-μL reaction mixture containing 300 ng of total RNA using an oligo(dT)16 as the reverse primer.

    Quantitative RT-PCR:

    Article Title: PpAKR1A, a Novel Aldo-Keto Reductase from Physcomitrella Patens, Plays a Positive Role in Salt Stress
    Article Snippet: .. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR) Analysis Total RNA was extracted from plant tissues using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). .. Single-stranded cDNA was synthesised from RNA using the PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio, Dalian, China) according to the manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: Light Regulation of Carotenoid Biosynthesis in the Peel of Mandarin and Sweet Orange Fruits
    Article Snippet: .. Quantitative Real Time-PCR Total RNA was isolated from the fruit flavedo at each harvesting date, using RNeasy Plant Mini Kit (Qiagen) and subsequently treated with DNase (DNA free, DNase treatment & removal, Ambion). .. The transcripts present in 2 μg of total RNA were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) in a total volume of 20 μL.

    Article Title: Ectopic expression of a Citrus kinokuni β-carotene hydroxylase gene (chyb) promotes UV and oxidative stress resistance by metabolic engineering of zeaxanthin in tobacco
    Article Snippet: Paragraph title: Expression analyses by quantitative real-time PCR (qPCR) ... Total RNA was isolated from 100 mg of frozen tobacco leaves using the RNeasy® Plant Mini Kit [QIAGEN China (Shanghai) Co., Ltd, China].

    Microarray:

    Article Title: Transcriptional Profiling Identifies a Role for BrlA in the Response to Nitrogen Depletion and for StuA in the Regulation of Secondary Metabolite Clusters in Aspergillus fumigatus ▿ ▿ ‡
    Article Snippet: Paragraph title: Microarray RNA time course. ... After 1, 8, 16, and 24 h of growth in MOPS-buffered RPMI 1640 medium, an aliquot of each strain was removed and RNA was extracted with the Qiagen RNeasy Plant Mini Kit by following the manufacturer's protocol.

    Incubation:

    Article Title: Transcriptional Profiling Identifies a Role for BrlA in the Response to Nitrogen Depletion and for StuA in the Regulation of Secondary Metabolite Clusters in Aspergillus fumigatus ▿ ▿ ‡
    Article Snippet: Then, in order to stimulate conidiation, hyphae were transferred to RPMI 1640 medium (Sigma-Aldrich product number R6504) buffered at pH 7.0 with 34.5 g/liter 3-( N -morpholino)propanesulfonic acid (MOPS; Sigma-Aldrich) and incubated at 37°C in a shaking incubator. .. After 1, 8, 16, and 24 h of growth in MOPS-buffered RPMI 1640 medium, an aliquot of each strain was removed and RNA was extracted with the Qiagen RNeasy Plant Mini Kit by following the manufacturer's protocol.

    Mass Spectrometry:

    Article Title: A Stress-Associated Protein, PtSAP13, From Populus trichocarpa Provides Tolerance to Salt Stress
    Article Snippet: Subsequently, the seedlings were transferred into 1/2 MS medium containing 0 mM or 150 mM NaCl for 2 weeks. .. Total RNA was also extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and treated with DNase I (Qiagen, Hilden, Germany).

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: Col-0 plants were transformed using standard procedures, and transgenic plants were selected on MS medium + 1% sucrose plates containing 50 μg/mL kanamycin. .. To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer.

    Transformation Assay:

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: Paragraph title: Plasmid Constructs and Plant Transformation ... To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer.

    Article Title: INCREASED SIZE EXCLUSION LIMIT2 Encodes a Putative DEVH Box RNA Helicase Involved in Plasmodesmata Function during Arabidopsis Embryogenesis [W]
    Article Snippet: PCR primers 5′-GTCGCCGGTTGTTCTACACT-3′ and 5′-TGAGAACAAAACACGAAAGCA-3′, amplifying a 5′ region of ISE2 locus containing Bst XI sites, were used to determine the genotype of individual plants transformed with ISE2 cDNA. .. To analyze the expression of ISE2 mRNA in different tissues, total RNA was extracted from quick-frozen tissue using the RNeasy plant mini kit (Qiagen), followed by digestion with DNase I (DNA-free; Ambion).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: CYP703 Is an Ancient Cytochrome P450 in Land Plants Catalyzing in-Chain Hydroxylation of Lauric Acid to Provide Building Blocks for Sporopollenin Synthesis in Pollen [W]
    Article Snippet: Paragraph title: RNA Extractions and RT-PCR ... Total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) from flowers at stages 6.10 to 6.50 ( ).

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi. .. First strand complementary DNA (cDNA) was synthesized from the total RNA by reverse transcription-polymerase chain reaction (PCR) using a GeneAmp RNA PCR Core Kit (Applied Biosystems, Foster city, CA) with anchored oligo(dT)-adapter primer dT(17)3’RACE ( , Supplementary data).

    Article Title: Arabidopsis Sucrose Transporter AtSUC1 Is Important for Pollen Germination and Sucrose-Induced Anthocyanin Accumulation 1Arabidopsis Sucrose Transporter AtSUC1 Is Important for Pollen Germination and Sucrose-Induced Anthocyanin Accumulation 1 [OA]
    Article Snippet: Paragraph title: RT-PCR ... RNA was extracted from 5-d-old seedlings of Col-0 and suc1 mutants using the RNeasy plant mini kit (Qiagen).

    Article Title: Cytochrome P450 CYP710A Encodes the Sterol C-22 Desaturase in Arabidopsis and Tomato [W] and Tomato [W] [OA]
    Article Snippet: Paragraph title: Semiquantitative RT-PCR Analysis ... Total RNA was isolated using an RNeasy plant mini kit (Qiagen), and genomic DNA contamination was eliminated using an RNase free DNase set (Qiagen).

    Generated:

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: .. To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer. .. AtVMA21∷GFP cDNA was amplified using the primers AtVMA21cds.FOR (5’- ATG GCT GGG GTT ATG CAC AAG-3’) and AtVMA21cds.REV (5’- CTC TTG TTT CTT CAG CGC AG-3’).

    Sequencing:

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi. .. Forward (CNL-D-1f) and reverse (CNL-D-1r) degenerate primers ( ) were designed based on the partial amino acid sequence in regions with the lowest degeneracy.

    Article Title: A Stress-Associated Protein, PtSAP13, From Populus trichocarpa Provides Tolerance to Salt Stress
    Article Snippet: Total RNA was also extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and treated with DNase I (Qiagen, Hilden, Germany). .. The cDNA libraries were constructed and sequenced on the Illumina HiSeq2500 sequencing platform by Gene Denovo Biotechnology Co. (Guangzhou, China), with paired-end sequencing and read lengths of 150 bp.

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: A NheI site was introduced into Exon 2 without changing the amino acid sequence. .. To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer.

    Molecular Weight:

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: High molecular weight genomic DNA was isolated from frozen powdered C. nebularis fruiting bodies as described [ ]. .. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi.

    DNA Extraction:

    Article Title: Characterization of a Selenate-Resistant Arabidopsis Mutant. Root Growth as a Potential Target for Selenate Toxicity 1Characterization of a Selenate-Resistant Arabidopsis Mutant. Root Growth as a Potential Target for Selenate Toxicity 1 [OA]
    Article Snippet: Paragraph title: RNA and DNA Extraction ... RNA and DNA were extracted using the RNeasy Plant Mini kit (Qiagen) and the GeneElute Plant Genomic DNA kit (Sigma), respectively, following the manufacturer's instructions.

    Nucleic Acid Electrophoresis:

    Article Title: Gibberellin Promotes Sweetpotato Root Vascular Lignification and Reduces Storage-Root Formation
    Article Snippet: RNA Extraction and Gene Expression Analysis Total RNA was extracted from sweetpotato ARs at 1W, 2W, and 5W after planting (5W sampled roots included both, ARs and SRs), using RNeasy Plant Mini Kit (Qiagen, Germany). .. The integrity and quantity of RNA was examined by gel-electrophoresis and nanodrop (ND 1000, Thermo Scientific, USA), respectively.

    RNA Sequencing Assay:

    Article Title: A Stress-Associated Protein, PtSAP13, From Populus trichocarpa Provides Tolerance to Salt Stress
    Article Snippet: Paragraph title: 4.6. RNA-Seq Analysis of Transgenic Arabidopsis ... Total RNA was also extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and treated with DNase I (Qiagen, Hilden, Germany).

    Mutagenesis:

    Article Title: Transcriptional Profiling Identifies a Role for BrlA in the Response to Nitrogen Depletion and for StuA in the Regulation of Secondary Metabolite Clusters in Aspergillus fumigatus ▿ ▿ ‡
    Article Snippet: Briefly, hyphal fragments from two plates of the Δ brlA mutant were collected with a cotton swab and inoculated into 160 ml of YPD medium. .. After 1, 8, 16, and 24 h of growth in MOPS-buffered RPMI 1640 medium, an aliquot of each strain was removed and RNA was extracted with the Qiagen RNeasy Plant Mini Kit by following the manufacturer's protocol.

    Isolation:

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: .. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi. .. First strand complementary DNA (cDNA) was synthesized from the total RNA by reverse transcription-polymerase chain reaction (PCR) using a GeneAmp RNA PCR Core Kit (Applied Biosystems, Foster city, CA) with anchored oligo(dT)-adapter primer dT(17)3’RACE ( , Supplementary data).

    Article Title: Light Regulation of Carotenoid Biosynthesis in the Peel of Mandarin and Sweet Orange Fruits
    Article Snippet: .. Quantitative Real Time-PCR Total RNA was isolated from the fruit flavedo at each harvesting date, using RNeasy Plant Mini Kit (Qiagen) and subsequently treated with DNase (DNA free, DNase treatment & removal, Ambion). .. The transcripts present in 2 μg of total RNA were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) in a total volume of 20 μL.

    Article Title: How did a duplicated gene copy evolve into a restorer-of-fertility gene in a plant? The case of Oma1
    Article Snippet: .. Total cellular RNA was isolated using an RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). .. Residual genomic DNA was digested with RNase-free DNase (Promega).

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: .. To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer. .. AtVMA21∷GFP cDNA was amplified using the primers AtVMA21cds.FOR (5’- ATG GCT GGG GTT ATG CAC AAG-3’) and AtVMA21cds.REV (5’- CTC TTG TTT CTT CAG CGC AG-3’).

    Article Title: Cytochrome P450 CYP710A Encodes the Sterol C-22 Desaturase in Arabidopsis and Tomato [W] and Tomato [W] [OA]
    Article Snippet: .. Total RNA was isolated using an RNeasy plant mini kit (Qiagen), and genomic DNA contamination was eliminated using an RNase free DNase set (Qiagen). .. First-strand cDNA was synthesized using the Takara RNA PCR kit (AMV) version 3.0 in a 10-μL reaction mixture containing 300 ng of total RNA using an oligo(dT)16 as the reverse primer.

    Article Title: Ectopic expression of a Citrus kinokuni β-carotene hydroxylase gene (chyb) promotes UV and oxidative stress resistance by metabolic engineering of zeaxanthin in tobacco
    Article Snippet: .. Total RNA was isolated from 100 mg of frozen tobacco leaves using the RNeasy® Plant Mini Kit [QIAGEN China (Shanghai) Co., Ltd, China]. .. Total RNA was then quantified using SMA1000 UV Spectrophotometer (Merinton Technology Co., Beijing, People’s Republic of China).

    Purification:

    Article Title: INCREASED SIZE EXCLUSION LIMIT2 Encodes a Putative DEVH Box RNA Helicase Involved in Plasmodesmata Function during Arabidopsis Embryogenesis [W]
    Article Snippet: To analyze the expression of ISE2 mRNA in different tissues, total RNA was extracted from quick-frozen tissue using the RNeasy plant mini kit (Qiagen), followed by digestion with DNase I (DNA-free; Ambion). .. The C-terminal peptide fragment of ISE2 representing the last 320 amino acids was then expressed in Escherichia coli using the pDEST17 plasmid (Invitrogen), and overproduced protein was purified as inclusion bodies and inoculated into mice.

    Polymerase Chain Reaction:

    Article Title: CYP703 Is an Ancient Cytochrome P450 in Land Plants Catalyzing in-Chain Hydroxylation of Lauric Acid to Provide Building Blocks for Sporopollenin Synthesis in Pollen [W]
    Article Snippet: Total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) from flowers at stages 6.10 to 6.50 ( ). .. RNA (1 μg) was reverse-transcribed with the iScript cDNA synthesis kit (Bio-Rad), and CYP703A2 expression was subsequently visualized by PCR with the primers 5′-TTAAAGCTCTAATTCAGGACATGATAG-3′ and 5′-CCATAAACTTCCACCGTATCAATATTTC-3′ using the Phusion High-Fidelity DNA polymerase (Finnzymes) and following the manufacturer's protocol.

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi. .. First strand complementary DNA (cDNA) was synthesized from the total RNA by reverse transcription-polymerase chain reaction (PCR) using a GeneAmp RNA PCR Core Kit (Applied Biosystems, Foster city, CA) with anchored oligo(dT)-adapter primer dT(17)3’RACE ( , Supplementary data).

    Article Title: Genetic engineering of parthenocarpic tomato plants using transient SlIAA9 knockdown by novel tissue-specific promoters
    Article Snippet: DNA and RNA extraction and cDNA synthesis Genomic DNA and total RNA were extracted using a DNeasy or RNeasy plant mini kit (Qiagen) according to the manufacturer’s instructions. .. The synthesized cDNA was subjected to PCR to confirm genomic DNA-free cDNA with a set of SGN-U314153 (CAC) gene primers: forward, CCTCCGTTGTGATGTAACTGG, and reverse, ATTGGTGGAAAGTAACATCATCG .

    Article Title: PpAKR1A, a Novel Aldo-Keto Reductase from Physcomitrella Patens, Plays a Positive Role in Salt Stress
    Article Snippet: .. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR) Analysis Total RNA was extracted from plant tissues using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). .. Single-stranded cDNA was synthesised from RNA using the PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio, Dalian, China) according to the manufacturer’s instructions.

    Article Title: Cytochrome P450 CYP710A Encodes the Sterol C-22 Desaturase in Arabidopsis and Tomato [W] and Tomato [W] [OA]
    Article Snippet: Total RNA was isolated using an RNeasy plant mini kit (Qiagen), and genomic DNA contamination was eliminated using an RNase free DNase set (Qiagen). .. First-strand cDNA was synthesized using the Takara RNA PCR kit (AMV) version 3.0 in a 10-μL reaction mixture containing 300 ng of total RNA using an oligo(dT)16 as the reverse primer.

    Article Title: INCREASED SIZE EXCLUSION LIMIT2 Encodes a Putative DEVH Box RNA Helicase Involved in Plasmodesmata Function during Arabidopsis Embryogenesis [W]
    Article Snippet: PCR primers 5′-GTCGCCGGTTGTTCTACACT-3′ and 5′-TGAGAACAAAACACGAAAGCA-3′, amplifying a 5′ region of ISE2 locus containing Bst XI sites, were used to determine the genotype of individual plants transformed with ISE2 cDNA. .. To analyze the expression of ISE2 mRNA in different tissues, total RNA was extracted from quick-frozen tissue using the RNeasy plant mini kit (Qiagen), followed by digestion with DNase I (DNA-free; Ambion).

    Construct:

    Article Title: A Stress-Associated Protein, PtSAP13, From Populus trichocarpa Provides Tolerance to Salt Stress
    Article Snippet: Total RNA was also extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and treated with DNase I (Qiagen, Hilden, Germany). .. The cDNA libraries were constructed and sequenced on the Illumina HiSeq2500 sequencing platform by Gene Denovo Biotechnology Co. (Guangzhou, China), with paired-end sequencing and read lengths of 150 bp.

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: Paragraph title: Plasmid Constructs and Plant Transformation ... To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer.

    Mouse Assay:

    Article Title: INCREASED SIZE EXCLUSION LIMIT2 Encodes a Putative DEVH Box RNA Helicase Involved in Plasmodesmata Function during Arabidopsis Embryogenesis [W]
    Article Snippet: To analyze the expression of ISE2 mRNA in different tissues, total RNA was extracted from quick-frozen tissue using the RNeasy plant mini kit (Qiagen), followed by digestion with DNase I (DNA-free; Ambion). .. The C-terminal peptide fragment of ISE2 representing the last 320 amino acids was then expressed in Escherichia coli using the pDEST17 plasmid (Invitrogen), and overproduced protein was purified as inclusion bodies and inoculated into mice.

    Plasmid Preparation:

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: Paragraph title: Plasmid Constructs and Plant Transformation ... To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer.

    Article Title: INCREASED SIZE EXCLUSION LIMIT2 Encodes a Putative DEVH Box RNA Helicase Involved in Plasmodesmata Function during Arabidopsis Embryogenesis [W]
    Article Snippet: To analyze the expression of ISE2 mRNA in different tissues, total RNA was extracted from quick-frozen tissue using the RNeasy plant mini kit (Qiagen), followed by digestion with DNase I (DNA-free; Ambion). .. The C-terminal peptide fragment of ISE2 representing the last 320 amino acids was then expressed in Escherichia coli using the pDEST17 plasmid (Invitrogen), and overproduced protein was purified as inclusion bodies and inoculated into mice.

    RNA Extraction:

    Article Title: Genetic engineering of parthenocarpic tomato plants using transient SlIAA9 knockdown by novel tissue-specific promoters
    Article Snippet: .. DNA and RNA extraction and cDNA synthesis Genomic DNA and total RNA were extracted using a DNeasy or RNeasy plant mini kit (Qiagen) according to the manufacturer’s instructions. .. Total RNA was treated with a DNA-free RNA kit (Zymo Research) to eliminate DNA contamination.

    Article Title: Gibberellin Promotes Sweetpotato Root Vascular Lignification and Reduces Storage-Root Formation
    Article Snippet: .. RNA Extraction and Gene Expression Analysis Total RNA was extracted from sweetpotato ARs at 1W, 2W, and 5W after planting (5W sampled roots included both, ARs and SRs), using RNeasy Plant Mini Kit (Qiagen, Germany). .. The integrity and quantity of RNA was examined by gel-electrophoresis and nanodrop (ND 1000, Thermo Scientific, USA), respectively.

    Transgenic Assay:

    Article Title: A Stress-Associated Protein, PtSAP13, From Populus trichocarpa Provides Tolerance to Salt Stress
    Article Snippet: Paragraph title: 4.6. RNA-Seq Analysis of Transgenic Arabidopsis ... Total RNA was also extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and treated with DNase I (Qiagen, Hilden, Germany).

    Article Title: Arabidopsis Has Two Functional Orthologs of the Yeast V-ATPase Assembly Factor Vma21p
    Article Snippet: .. To amplify the cDNA of AtVMA21-GFP, RNA was isolated from transgenic seedlings expressing the genomic GFP-fusion described above using the RNeasy plant mini kit (Qiagen, Hilden, Germany). cDNA was generated from total RNA using MMLV-RTase (Fermentas, St. Leon-Rot, Germany) and oligo dT primer. .. AtVMA21∷GFP cDNA was amplified using the primers AtVMA21cds.FOR (5’- ATG GCT GGG GTT ATG CAC AAG-3’) and AtVMA21cds.REV (5’- CTC TTG TTT CTT CAG CGC AG-3’).

    Spectrophotometry:

    Article Title: A Stress-Associated Protein, PtSAP13, From Populus trichocarpa Provides Tolerance to Salt Stress
    Article Snippet: Total RNA was also extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and treated with DNase I (Qiagen, Hilden, Germany). .. The RNA purity and integrity were detected by the NanoPhotometer spectrophotometer and Agilent2100 Bioanalyzer, and the RNA quantity was measured by Qubit2.0 Fluorometer (Life Technologies, New York, USA).

    Article Title: Ectopic expression of a Citrus kinokuni β-carotene hydroxylase gene (chyb) promotes UV and oxidative stress resistance by metabolic engineering of zeaxanthin in tobacco
    Article Snippet: Total RNA was isolated from 100 mg of frozen tobacco leaves using the RNeasy® Plant Mini Kit [QIAGEN China (Shanghai) Co., Ltd, China]. .. Total RNA was then quantified using SMA1000 UV Spectrophotometer (Merinton Technology Co., Beijing, People’s Republic of China).

    Molecular Cloning:

    Article Title: PURIFICATION, CHARACTERIZATION AND CLONING OF A RICIN B-LIKE LECTIN FROM MUSHROOM Clitocybe nebularis WITH ANTIPROLIFERATIVE ACTIVITY AGAINST HUMAN LEUKEMIC T CELLS
    Article Snippet: Paragraph title: 2.7. Molecular cloning of the gene and cDNA encoding CNL ... Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol for isolation from plant tissues and filamentous fungi.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen rneasy plant mini kit
    Rneasy Plant Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1665 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy plant mini kit/product/Qiagen
    Average 90 stars, based on 1665 article reviews
    Price from $9.99 to $1999.99
    rneasy plant mini kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results