rneasy 96 kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    RNeasy 96 Kit
    Description:
    For 96 well purification of total RNA from cells Kit contents Qiagen RNeasy 96 Kit 4 preps 45 to 140L Elution Volume 5 x 10e5 Sample Cultured Cells Sample Total and Cytoplasmic RNA Purification Silica Technology Manual Processing 96 well Plate Format 30 to 40 min Time Run 1 3 to 3 1g Yield Ideal for PCR qPCR Real time PCR Includes 4 RNeasy 96 Plates Elution Microtubes CL Caps S Blocks AirPore Tape Sheets RNase free Reagents and Buffers Benefits High throughput RNA purification Fast and convenient sample processing Reproducible yields from 10 to 500 000 cells High quality RNA for any application No organic extraction or precipitation
    Catalog Number:
    74181
    Price:
    1590
    Category:
    RNeasy 96 Kit
    Buy from Supplier


    Structured Review

    Qiagen rneasy 96 kit
    RNeasy 96 Kit
    For 96 well purification of total RNA from cells Kit contents Qiagen RNeasy 96 Kit 4 preps 45 to 140L Elution Volume 5 x 10e5 Sample Cultured Cells Sample Total and Cytoplasmic RNA Purification Silica Technology Manual Processing 96 well Plate Format 30 to 40 min Time Run 1 3 to 3 1g Yield Ideal for PCR qPCR Real time PCR Includes 4 RNeasy 96 Plates Elution Microtubes CL Caps S Blocks AirPore Tape Sheets RNase free Reagents and Buffers Benefits High throughput RNA purification Fast and convenient sample processing Reproducible yields from 10 to 500 000 cells High quality RNA for any application No organic extraction or precipitation
    https://www.bioz.com/result/rneasy 96 kit/product/Qiagen
    Average 90 stars, based on 1893 article reviews
    Price from $9.99 to $1999.99
    rneasy 96 kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: KIFC1 is a novel potential therapeutic target for breast cancer
    Article Snippet: .. After overnight culture, the cells were treated with PJ34 for 24 h. Total RNA was extracted from 96-well cultured cells using RNeasy 96 kit (Qiagen), and One-step RT-PCR amplification was performed using QuantiFast SYBR Green RT-PCR kit (Qiagen) in 384-well format. ..

    Cycling Probe Technology:

    Article Title: Gene Expression Differences Between Offspring of Long-Lived Individuals and Controls in Candidate Longevity Regions: Evidence for PAPSS2 as a Longevity Gene
    Article Snippet: Lymphocytes were isolated by collecting whole blood directly into BD Vacutainer CPT Cell Preparation Tubes (Becton, Dickinson and Company, Franklin Lakes, NJ) and following the manufacturer recommended protocol. .. Total RNA was isolated from lymphocyte pellets using the QIAGEN RNeasy 96 kit (QIAGEN, Valencia, CA) following the spin technology protocol according to the manufacturer instructions.

    Polymerase Chain Reaction:

    Article Title: Independent combinatorial effect of antisense oligonucleotides and RNAi-mediated specific inhibition of the recombinant Rat P2X3 receptor
    Article Snippet: Total RNA was extracted and purified using RNeasy 96 kit (Qiagen). .. For the Q-PCR, 50 ng of total RNA was mixed with 5′ and 3′ primers (Table ; T-forward and T-reverse; 10 µM each), Taqman probe (Table ; Taqman; 5 µM), MuLV reverse transcriptase (6.25 U; PE Biosystems), RNase Out RNase inhibitor (10 U; Invitrogen) and the components of the TaqMan PCR reagent kit (Eurogentec) in a total volume of 25 µl following the TaqMan PCR reagent kit protocol (Eurogentec).

    Article Title: KIFC1 is a novel potential therapeutic target for breast cancer
    Article Snippet: These 48 cDNAs have been normalized against β-actin by RT-PCR, and arrayed onto PCR plates. .. After overnight culture, the cells were treated with PJ34 for 24 h. Total RNA was extracted from 96-well cultured cells using RNeasy 96 kit (Qiagen), and One-step RT-PCR amplification was performed using QuantiFast SYBR Green RT-PCR kit (Qiagen) in 384-well format.

    Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
    Article Snippet: .. After incubation, cells were either fixed with 0.05% glutaraldehyde for the detection of HCV protein with an enzyme-linked immunosorbent assay (ELISA) or processed for total RNA (RNeasy 96 kit; QIAGEN), from which HCV replicon RNA was quantified with Taqman reverse transcriptase PCR (RT-PCR). .. HCV-specific ELISA was carried out by using mouse anti-NS5A monoclonal antibody (Virostat) at a 1:400 dilution and goat anti-mouse-horseradish peroxidase-conjugated monoclonal antibody at a 1:500 dilution.

    Quantitative RT-PCR:

    Article Title: The Proangiogenic Effect of Iroquois Homeobox Transcription Factor Irx3 in Human Microvascular Endothelial Cells *
    Article Snippet: RNA was reverse-transcribed using the RNeasy-96 kit (Qiagen). .. Quantitative RT-PCR for the Irx3 , Hey1 , and 18s genes (see primer sequences above) was performed using the LC480 Lightcycler thermocycler (Roche).

    Article Title: Enhancing the cellular uptake of Py-Im polyamides through next-generation aryl turns
    Article Snippet: After 6 h, cells were harvested and mRNA was isolated (RNEasy 96 kit—Qiagen) and reverse transcribed (Transcriptor First Strand cDNA Synthesis Kit—Roche). .. Quantitative real-time PCR (qRT-PCR) was performed with FastStart Universal SYBR Green Master Mix (Roche) on an ABI 7300 qPCR instrument (Applied Biosystems) following the manufacturer's protocol.

    Article Title: Fluocinolone acetonide is a potent synergistic factor of TGF-β3-associated chondrogenesis of bone marrow-derived mesenchymal stem cells for articular surface regeneration
    Article Snippet: For the second screening step, total cellular RNA was extracted using the RNeasy 96 kit after ATDC5 cells were stimulated with drugs for 24 h. For other experiments, RNeasy mini kit (QIAGEN, Hilden, Germany) or Purelink (Invitrogen) was used, according to the manufacturer’s instructions. .. Real time RT-PCR was used for mRNA quantitation as described ( ).

    Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿
    Article Snippet: The antiviral activity and cytotoxicity of compounds were determined with various HCV replicon cell lines in a quantitative RT-PCR (qRT-PCR)-based assay as described previously ( ). .. After the cells were treated for 48 h, total RNA was extracted using an RNeasy 96 kit (Qiagen, Valencia, CA).

    Article Title: Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing
    Article Snippet: .. Ten microliters of lysate were used to isolate RNA with the RNeasy 96 Kit (Qiagen), and real-time RT-PCR was performed as described above. .. The SMN2 expression level was normalized to that of the mouse gene Gapdh, and this was further normalized to the level in PBS-treated mice.

    SYBR Green Assay:

    Article Title: Enhancing the cellular uptake of Py-Im polyamides through next-generation aryl turns
    Article Snippet: After 6 h, cells were harvested and mRNA was isolated (RNEasy 96 kit—Qiagen) and reverse transcribed (Transcriptor First Strand cDNA Synthesis Kit—Roche). .. Quantitative real-time PCR (qRT-PCR) was performed with FastStart Universal SYBR Green Master Mix (Roche) on an ABI 7300 qPCR instrument (Applied Biosystems) following the manufacturer's protocol.

    Article Title: KIFC1 is a novel potential therapeutic target for breast cancer
    Article Snippet: .. After overnight culture, the cells were treated with PJ34 for 24 h. Total RNA was extracted from 96-well cultured cells using RNeasy 96 kit (Qiagen), and One-step RT-PCR amplification was performed using QuantiFast SYBR Green RT-PCR kit (Qiagen) in 384-well format. ..

    Article Title: Establishment of keratinocyte cell lines from human hair follicles
    Article Snippet: RNA isolation, cDNA synthesis and real-time PCR RNA was isolated using RNeasy 96 Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. For cDNA synthesis RNA was reverse-transcribed with iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) and real-time PCR was carried out with LightCycler480 SYBR Green I Master (Roche Applied Science, Penzberg, Germany) according to the manufacturer’s instructions.

    Quantitation Assay:

    Article Title: Fluocinolone acetonide is a potent synergistic factor of TGF-β3-associated chondrogenesis of bone marrow-derived mesenchymal stem cells for articular surface regeneration
    Article Snippet: For the second screening step, total cellular RNA was extracted using the RNeasy 96 kit after ATDC5 cells were stimulated with drugs for 24 h. For other experiments, RNeasy mini kit (QIAGEN, Hilden, Germany) or Purelink (Invitrogen) was used, according to the manufacturer’s instructions. .. Real time RT-PCR was used for mRNA quantitation as described ( ).

    Activity Assay:

    Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿
    Article Snippet: The antiviral activity and cytotoxicity of compounds were determined with various HCV replicon cell lines in a quantitative RT-PCR (qRT-PCR)-based assay as described previously ( ). .. After the cells were treated for 48 h, total RNA was extracted using an RNeasy 96 kit (Qiagen, Valencia, CA).

    Cell Culture:

    Article Title: KIFC1 is a novel potential therapeutic target for breast cancer
    Article Snippet: .. After overnight culture, the cells were treated with PJ34 for 24 h. Total RNA was extracted from 96-well cultured cells using RNeasy 96 kit (Qiagen), and One-step RT-PCR amplification was performed using QuantiFast SYBR Green RT-PCR kit (Qiagen) in 384-well format. ..

    Article Title: Activity and the Metabolic Activation Pathway of the Potent and Selective Hepatitis C Virus Pronucleotide Inhibitor PSI-353661
    Article Snippet: After 2 weeks, cells were passaged into culture medium containing 0.25 mg/mL G418 without inhibitor and cultured for an additional 2 weeks without passaging. .. At the end of the experiment, total RNA was extracted from all cell samples using the RNeasy-96 kit (Qiagen).

    Expressing:

    Article Title: Enhancing the cellular uptake of Py-Im polyamides through next-generation aryl turns
    Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction analysis of nuclear receptor-mediated gene expression ... After 6 h, cells were harvested and mRNA was isolated (RNEasy 96 kit—Qiagen) and reverse transcribed (Transcriptor First Strand cDNA Synthesis Kit—Roche).

    Article Title: KIFC1 is a novel potential therapeutic target for breast cancer
    Article Snippet: KIFC1 expression was quantitatively measured by real-time PCR using SYBR Green (Qiagen) in 96-well format in a total volume of 30 µl over 42 2-step cycles using the following temperature protocol: 95°C for 15 seconds and 55°C for 60 seconds. .. After overnight culture, the cells were treated with PJ34 for 24 h. Total RNA was extracted from 96-well cultured cells using RNeasy 96 kit (Qiagen), and One-step RT-PCR amplification was performed using QuantiFast SYBR Green RT-PCR kit (Qiagen) in 384-well format.

    Article Title: Establishment of keratinocyte cell lines from human hair follicles
    Article Snippet: RNA isolation, cDNA synthesis and real-time PCR RNA was isolated using RNeasy 96 Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. The primers used are listed in Table , the relative expression of the target genes was calculated by comparing with the housekeeping gene Gapdh and experiments were performed in triplicate.

    Article Title: Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing
    Article Snippet: The ILF3 or SMN1 and SMN2 expression level was normalized to that of total RNA, and this was further normalized to the level in controls that had not been treated with siRNA, ASO or both. .. Ten microliters of lysate were used to isolate RNA with the RNeasy 96 Kit (Qiagen), and real-time RT-PCR was performed as described above.

    Activated Clotting Time Assay:

    Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿
    Article Snippet: After the cells were treated for 48 h, total RNA was extracted using an RNeasy 96 kit (Qiagen, Valencia, CA). .. The level of HCV RNA was measured by real-time quantitative PCR (TaqMan assay; Applied Biosystems, Foster City, CA) using HCV-specific primers (5′-TCT TCA CGC AGA AAG CGT CTA-3′ and 5′-CTG GCA ATT CCG GTG TAC T-3′) and probe (5′-6-carboxyfluorescein [FAM]-TCC TGG AGG CTG CAC GAC ACT CAT A-6-carboxytetramethylrhodamine [TAMRA]-3′).

    Infection:

    Article Title: Targeting HIV Reservoir in Infected CD4 T Cells by Dual-Affinity Re-targeting Molecules (DARTs) that Bind HIV Envelope and Recruit Cytotoxic T Cells
    Article Snippet: Total RNA was isolated using the RNeasy 96 kit (Qiagen) and cell-associated vRNA levels in these samples were analyzed by a robotic COBAS Ampliprep/Taqman system (Roche Diagnostics), which extracts total nucleic acid and quantifies HIV RNA in copies per milliliter using the HIV Test, v2.0 kit (Roche Diagnostics). .. Maximum vRNA copies/mL detected in these samples ranged from 30,000 to 60,000 for IN and BaL infected samples respectively.

    Article Title: The anti-genomic (negative) strand of Hepatitis C Virus is not targetable by shRNA
    Article Snippet: .. Real-time PCR RNA was extracted from infected cells using RNeasy 96 kit (Qiagen) according to the manufacturer’s protocol. .. Real-time PCR was performed with 5 µl of extracted RNA using AgPath ID RT-PCR Master Mix (Applied Biosystems, Foster City, CA), primers AGAGCCATAGTGGTCT and CCAAATCTCCAGGCATTGAGC, and probe 6-carboxyfluorescein-CACCGGAATTGCCAGGACGACCGG-6-carboxytetramethylrhodamine.

    Article Title: Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease
    Article Snippet: Paragraph title: RSV infection in vitro ... Total RNA was prepared using the RNeasy 96 kit (Qiagen).

    Allele-specific Oligonucleotide:

    Article Title: Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing
    Article Snippet: The ILF3 or SMN1 and SMN2 expression level was normalized to that of total RNA, and this was further normalized to the level in controls that had not been treated with siRNA, ASO or both. .. Ten microliters of lysate were used to isolate RNA with the RNeasy 96 Kit (Qiagen), and real-time RT-PCR was performed as described above.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Fluocinolone acetonide is a potent synergistic factor of TGF-β3-associated chondrogenesis of bone marrow-derived mesenchymal stem cells for articular surface regeneration
    Article Snippet: Paragraph title: 2.6. Real time reverse-transcription polymerase chain reaction (RT-PCR) analysis ... For the second screening step, total cellular RNA was extracted using the RNeasy 96 kit after ATDC5 cells were stimulated with drugs for 24 h. For other experiments, RNeasy mini kit (QIAGEN, Hilden, Germany) or Purelink (Invitrogen) was used, according to the manufacturer’s instructions.

    Article Title: KIFC1 is a novel potential therapeutic target for breast cancer
    Article Snippet: .. After overnight culture, the cells were treated with PJ34 for 24 h. Total RNA was extracted from 96-well cultured cells using RNeasy 96 kit (Qiagen), and One-step RT-PCR amplification was performed using QuantiFast SYBR Green RT-PCR kit (Qiagen) in 384-well format. ..

    Article Title: The anti-genomic (negative) strand of Hepatitis C Virus is not targetable by shRNA
    Article Snippet: Real-time PCR RNA was extracted from infected cells using RNeasy 96 kit (Qiagen) according to the manufacturer’s protocol. .. Real-time PCR was performed with 5 µl of extracted RNA using AgPath ID RT-PCR Master Mix (Applied Biosystems, Foster City, CA), primers AGAGCCATAGTGGTCT and CCAAATCTCCAGGCATTGAGC, and probe 6-carboxyfluorescein-CACCGGAATTGCCAGGACGACCGG-6-carboxytetramethylrhodamine.

    Article Title: Activity and the Metabolic Activation Pathway of the Potent and Selective Hepatitis C Virus Pronucleotide Inhibitor PSI-353661
    Article Snippet: At the end of the experiment, total RNA was extracted from all cell samples using the RNeasy-96 kit (Qiagen). .. Levels of HCV RNA and ribosomal RNA (rRNA) were determined using RT-PCR as described above.

    Article Title: Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing
    Article Snippet: Paragraph title: RT-PCR ... Ten microliters of lysate were used to isolate RNA with the RNeasy 96 Kit (Qiagen), and real-time RT-PCR was performed as described above.

    Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
    Article Snippet: .. After incubation, cells were either fixed with 0.05% glutaraldehyde for the detection of HCV protein with an enzyme-linked immunosorbent assay (ELISA) or processed for total RNA (RNeasy 96 kit; QIAGEN), from which HCV replicon RNA was quantified with Taqman reverse transcriptase PCR (RT-PCR). .. HCV-specific ELISA was carried out by using mouse anti-NS5A monoclonal antibody (Virostat) at a 1:400 dilution and goat anti-mouse-horseradish peroxidase-conjugated monoclonal antibody at a 1:500 dilution.

    Software:

    Article Title: The Proangiogenic Effect of Iroquois Homeobox Transcription Factor Irx3 in Human Microvascular Endothelial Cells *
    Article Snippet: RNA was reverse-transcribed using the RNeasy-96 kit (Qiagen). .. Data were analyzed using the provided array analysis software template for all Biology-on-Array siRNA plates using comparative ΔΔ Ct analysis (SABiosciences).

    Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
    Article Snippet: After incubation, cells were either fixed with 0.05% glutaraldehyde for the detection of HCV protein with an enzyme-linked immunosorbent assay (ELISA) or processed for total RNA (RNeasy 96 kit; QIAGEN), from which HCV replicon RNA was quantified with Taqman reverse transcriptase PCR (RT-PCR). .. The HCV primers (5′-CGTTGGCTACCCGTGATATTG-3′ and 5′-AATCGGGAGCGGCGAT-3′) and probe (5′-[6-car-boxyfluorescein]-TGACCGCTTCCTCGTGCTTTACGG-[6-carboxytetrameth-ylrhodamine]-3′), which encompass the neomycin region of the replicon, were designed with the Primer Express software provided by Applied Biosystems.

    Passaging:

    Article Title: Activity and the Metabolic Activation Pathway of the Potent and Selective Hepatitis C Virus Pronucleotide Inhibitor PSI-353661
    Article Snippet: After 2 weeks, cells were passaged into culture medium containing 0.25 mg/mL G418 without inhibitor and cultured for an additional 2 weeks without passaging. .. At the end of the experiment, total RNA was extracted from all cell samples using the RNeasy-96 kit (Qiagen).

    Isolation:

    Article Title: The Proangiogenic Effect of Iroquois Homeobox Transcription Factor Irx3 in Human Microvascular Endothelial Cells *
    Article Snippet: HMVECs were reverse-transfected in a 96-well siRNA plate for 6 h in normal growth medium and then made quiescent in EBM-2MV for 12 h. Following quiescence, cells were treated with EBM-2MV, 0.4% FBS, and 20 ng/ml VEGF for 12 h. Total RNA isolation was performed using a 96-well RNA isolation system (Qiagen). .. RNA was reverse-transcribed using the RNeasy-96 kit (Qiagen).

    Article Title: Independent combinatorial effect of antisense oligonucleotides and RNAi-mediated specific inhibition of the recombinant Rat P2X3 receptor
    Article Snippet: Paragraph title: Total RNA isolation and assay by quantitative real-time PCR (Q-PCR) ... Total RNA was extracted and purified using RNeasy 96 kit (Qiagen).

    Article Title: Enhancing the cellular uptake of Py-Im polyamides through next-generation aryl turns
    Article Snippet: .. After 6 h, cells were harvested and mRNA was isolated (RNEasy 96 kit—Qiagen) and reverse transcribed (Transcriptor First Strand cDNA Synthesis Kit—Roche). .. Quantitative real-time PCR (qRT-PCR) was performed with FastStart Universal SYBR Green Master Mix (Roche) on an ABI 7300 qPCR instrument (Applied Biosystems) following the manufacturer's protocol.

    Article Title: Targeting HIV Reservoir in Infected CD4 T Cells by Dual-Affinity Re-targeting Molecules (DARTs) that Bind HIV Envelope and Recruit Cytotoxic T Cells
    Article Snippet: .. Total RNA was isolated using the RNeasy 96 kit (Qiagen) and cell-associated vRNA levels in these samples were analyzed by a robotic COBAS Ampliprep/Taqman system (Roche Diagnostics), which extracts total nucleic acid and quantifies HIV RNA in copies per milliliter using the HIV Test, v2.0 kit (Roche Diagnostics). ..

    Article Title: Establishment of keratinocyte cell lines from human hair follicles
    Article Snippet: .. RNA isolation, cDNA synthesis and real-time PCR RNA was isolated using RNeasy 96 Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. For cDNA synthesis RNA was reverse-transcribed with iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) and real-time PCR was carried out with LightCycler480 SYBR Green I Master (Roche Applied Science, Penzberg, Germany) according to the manufacturer’s instructions.

    Article Title: Gene Expression Differences Between Offspring of Long-Lived Individuals and Controls in Candidate Longevity Regions: Evidence for PAPSS2 as a Longevity Gene
    Article Snippet: .. Total RNA was isolated from lymphocyte pellets using the QIAGEN RNeasy 96 kit (QIAGEN, Valencia, CA) following the spin technology protocol according to the manufacturer instructions. .. RNA amplification and expression profiling were performed on Illumina Sentrix Human Whole Genome (WG-6) Series I BeadChips (San Diego, CA) following the method of Göring and colleagues ( ).

    Mouse Assay:

    Article Title: Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing
    Article Snippet: Ten microliters of lysate were used to isolate RNA with the RNeasy 96 Kit (Qiagen), and real-time RT-PCR was performed as described above. .. The SMN2 expression level was normalized to that of the mouse gene Gapdh, and this was further normalized to the level in PBS-treated mice.

    Sequencing:

    Article Title: Independent combinatorial effect of antisense oligonucleotides and RNAi-mediated specific inhibition of the recombinant Rat P2X3 receptor
    Article Snippet: Total RNA was extracted and purified using RNeasy 96 kit (Qiagen). .. Reverse transcription and Q-PCR were performed in a GeneAmp Sequence Detector 5700 (PE Biosystems) as follows: 2 min reverse transcription at 50°C, 10 min denaturation at 95°C followed by 50 cycles of denaturation for 15 s at 95°C and annealing and elongation for 1 min at 60°C.

    Co-Culture Assay:

    Article Title: Targeting HIV Reservoir in Infected CD4 T Cells by Dual-Affinity Re-targeting Molecules (DARTs) that Bind HIV Envelope and Recruit Cytotoxic T Cells
    Article Snippet: Cell-associated vRNA After 3 days of co-culture, plates were spun at 500 ×g for 5 min, culture media discarded and the cell pellets were resuspended in RLT buffer containing B2M and were stored at -80°C until RNA isolation. .. Total RNA was isolated using the RNeasy 96 kit (Qiagen) and cell-associated vRNA levels in these samples were analyzed by a robotic COBAS Ampliprep/Taqman system (Roche Diagnostics), which extracts total nucleic acid and quantifies HIV RNA in copies per milliliter using the HIV Test, v2.0 kit (Roche Diagnostics).

    High Throughput Screening Assay:

    Article Title: The Proangiogenic Effect of Iroquois Homeobox Transcription Factor Irx3 in Human Microvascular Endothelial Cells *
    Article Snippet: Paragraph title: High-throughput siRNA Screen ... RNA was reverse-transcribed using the RNeasy-96 kit (Qiagen).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿
    Article Snippet: After the cells were treated for 48 h, total RNA was extracted using an RNeasy 96 kit (Qiagen, Valencia, CA). .. The level of HCV RNA was measured by real-time quantitative PCR (TaqMan assay; Applied Biosystems, Foster City, CA) using HCV-specific primers (5′-TCT TCA CGC AGA AAG CGT CTA-3′ and 5′-CTG GCA ATT CCG GTG TAC T-3′) and probe (5′-6-carboxyfluorescein [FAM]-TCC TGG AGG CTG CAC GAC ACT CAT A-6-carboxytetramethylrhodamine [TAMRA]-3′).

    Purification:

    Article Title: Independent combinatorial effect of antisense oligonucleotides and RNAi-mediated specific inhibition of the recombinant Rat P2X3 receptor
    Article Snippet: .. Total RNA was extracted and purified using RNeasy 96 kit (Qiagen). ..

    TaqMan Assay:

    Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿
    Article Snippet: After the cells were treated for 48 h, total RNA was extracted using an RNeasy 96 kit (Qiagen, Valencia, CA). .. The level of HCV RNA was measured by real-time quantitative PCR (TaqMan assay; Applied Biosystems, Foster City, CA) using HCV-specific primers (5′-TCT TCA CGC AGA AAG CGT CTA-3′ and 5′-CTG GCA ATT CCG GTG TAC T-3′) and probe (5′-6-carboxyfluorescein [FAM]-TCC TGG AGG CTG CAC GAC ACT CAT A-6-carboxytetramethylrhodamine [TAMRA]-3′).

    Real-time Polymerase Chain Reaction:

    Article Title: Independent combinatorial effect of antisense oligonucleotides and RNAi-mediated specific inhibition of the recombinant Rat P2X3 receptor
    Article Snippet: Paragraph title: Total RNA isolation and assay by quantitative real-time PCR (Q-PCR) ... Total RNA was extracted and purified using RNeasy 96 kit (Qiagen).

    Article Title: Enhancing the cellular uptake of Py-Im polyamides through next-generation aryl turns
    Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction analysis of nuclear receptor-mediated gene expression ... After 6 h, cells were harvested and mRNA was isolated (RNEasy 96 kit—Qiagen) and reverse transcribed (Transcriptor First Strand cDNA Synthesis Kit—Roche).

    Article Title: KIFC1 is a novel potential therapeutic target for breast cancer
    Article Snippet: Paragraph title: Quantitative Real-Time PCR ... After overnight culture, the cells were treated with PJ34 for 24 h. Total RNA was extracted from 96-well cultured cells using RNeasy 96 kit (Qiagen), and One-step RT-PCR amplification was performed using QuantiFast SYBR Green RT-PCR kit (Qiagen) in 384-well format.

    Article Title: The anti-genomic (negative) strand of Hepatitis C Virus is not targetable by shRNA
    Article Snippet: .. Real-time PCR RNA was extracted from infected cells using RNeasy 96 kit (Qiagen) according to the manufacturer’s protocol. .. Real-time PCR was performed with 5 µl of extracted RNA using AgPath ID RT-PCR Master Mix (Applied Biosystems, Foster City, CA), primers AGAGCCATAGTGGTCT and CCAAATCTCCAGGCATTGAGC, and probe 6-carboxyfluorescein-CACCGGAATTGCCAGGACGACCGG-6-carboxytetramethylrhodamine.

    Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿
    Article Snippet: After the cells were treated for 48 h, total RNA was extracted using an RNeasy 96 kit (Qiagen, Valencia, CA). .. The level of HCV RNA was measured by real-time quantitative PCR (TaqMan assay; Applied Biosystems, Foster City, CA) using HCV-specific primers (5′-TCT TCA CGC AGA AAG CGT CTA-3′ and 5′-CTG GCA ATT CCG GTG TAC T-3′) and probe (5′-6-carboxyfluorescein [FAM]-TCC TGG AGG CTG CAC GAC ACT CAT A-6-carboxytetramethylrhodamine [TAMRA]-3′).

    Article Title: Inflammation, Immunity, Fibrosis, and Infection: Molecular characterization of a precision-cut rat liver slice model for the evaluation of antifibrotic compounds
    Article Snippet: Paragraph title: Real-time quantitative PCR. ... Total RNA was prepared from PCLSs or liver using the RNeasy 96 kit (Qiagen) according to the manufacturer's instructions. cDNA synthesis was performed with high-capacity RNA to cDNA kit (Life Technologies, Carlsbad, CA).

    Article Title: Establishment of keratinocyte cell lines from human hair follicles
    Article Snippet: .. RNA isolation, cDNA synthesis and real-time PCR RNA was isolated using RNeasy 96 Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. .. For cDNA synthesis RNA was reverse-transcribed with iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) and real-time PCR was carried out with LightCycler480 SYBR Green I Master (Roche Applied Science, Penzberg, Germany) according to the manufacturer’s instructions.

    Article Title: Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease
    Article Snippet: Total RNA was prepared using the RNeasy 96 kit (Qiagen). .. RSV strand-specific QPCR was performed as described above.

    Negative Control:

    Article Title: The Proangiogenic Effect of Iroquois Homeobox Transcription Factor Irx3 in Human Microvascular Endothelial Cells *
    Article Snippet: RNA was reverse-transcribed using the RNeasy-96 kit (Qiagen). .. Data are expressed as -fold change in transcript abundance versus VEGF-treated negative control siRNA wells.

    shRNA:

    Article Title: The anti-genomic (negative) strand of Hepatitis C Virus is not targetable by shRNA
    Article Snippet: Real-time PCR RNA was extracted from infected cells using RNeasy 96 kit (Qiagen) according to the manufacturer’s protocol. .. The relative amount of HCV RNA was adjusted to GAPDH RNA and normalized to scrambled shRNA-treated sample.

    In Vitro:

    Article Title: Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease
    Article Snippet: Paragraph title: RSV infection in vitro ... Total RNA was prepared using the RNeasy 96 kit (Qiagen).

    Homogenization:

    Article Title: Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing
    Article Snippet: Homogenization was performed for 20 s at 6,000 r.p.m. using a FastPrep Automated Homogenizer (MP Biomedicals). .. Ten microliters of lysate were used to isolate RNA with the RNeasy 96 Kit (Qiagen), and real-time RT-PCR was performed as described above.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
    Article Snippet: .. After incubation, cells were either fixed with 0.05% glutaraldehyde for the detection of HCV protein with an enzyme-linked immunosorbent assay (ELISA) or processed for total RNA (RNeasy 96 kit; QIAGEN), from which HCV replicon RNA was quantified with Taqman reverse transcriptase PCR (RT-PCR). .. HCV-specific ELISA was carried out by using mouse anti-NS5A monoclonal antibody (Virostat) at a 1:400 dilution and goat anti-mouse-horseradish peroxidase-conjugated monoclonal antibody at a 1:500 dilution.

    Incubation:

    Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
    Article Snippet: .. After incubation, cells were either fixed with 0.05% glutaraldehyde for the detection of HCV protein with an enzyme-linked immunosorbent assay (ELISA) or processed for total RNA (RNeasy 96 kit; QIAGEN), from which HCV replicon RNA was quantified with Taqman reverse transcriptase PCR (RT-PCR). .. HCV-specific ELISA was carried out by using mouse anti-NS5A monoclonal antibody (Virostat) at a 1:400 dilution and goat anti-mouse-horseradish peroxidase-conjugated monoclonal antibody at a 1:500 dilution.

    Concentration Assay:

    Article Title: Activity and the Metabolic Activation Pathway of the Potent and Selective Hepatitis C Virus Pronucleotide Inhibitor PSI-353661
    Article Snippet: PSI-353661 was added to cells at 0, 2, 5, 10 and 20-fold over its EC50 value (4 nM) so that the final DMSO concentration was 0.5% in each well. .. At the end of the experiment, total RNA was extracted from all cell samples using the RNeasy-96 kit (Qiagen).

    Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
    Article Snippet: The final concentration of DMSO in the medium was 0.5%. .. After incubation, cells were either fixed with 0.05% glutaraldehyde for the detection of HCV protein with an enzyme-linked immunosorbent assay (ELISA) or processed for total RNA (RNeasy 96 kit; QIAGEN), from which HCV replicon RNA was quantified with Taqman reverse transcriptase PCR (RT-PCR).

    CTG Assay:

    Article Title: Mechanism of Resistance of Hepatitis C Virus Replicons to Structurally Distinct Cyclophilin Inhibitors ▿
    Article Snippet: After the cells were treated for 48 h, total RNA was extracted using an RNeasy 96 kit (Qiagen, Valencia, CA). .. The level of HCV RNA was measured by real-time quantitative PCR (TaqMan assay; Applied Biosystems, Foster City, CA) using HCV-specific primers (5′-TCT TCA CGC AGA AAG CGT CTA-3′ and 5′-CTG GCA ATT CCG GTG TAC T-3′) and probe (5′-6-carboxyfluorescein [FAM]-TCC TGG AGG CTG CAC GAC ACT CAT A-6-carboxytetramethylrhodamine [TAMRA]-3′).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen rneasy 96 kit
    Rneasy 96 Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy 96 kit/product/Qiagen
    Average 90 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    rneasy 96 kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results