rneasy kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNeasy Plus Kit
    Description:

    Catalog Number:
    74104
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen rneasy kit

    https://www.bioz.com/result/rneasy kit/product/Qiagen
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rneasy kit - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: The fragment was then cloned into a binary vector, pJP3416, at a Psp OMI site. pJP3416 contained the constitutively-expressed Streptomyces viridochromogenes phosphinothricin-N-acetyltransferase gene to confer phosphinothricin (PPT) resistance. .. Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN).

    Centrifugation:

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: The culture-RNAlater mixture was thawed on ice, and a suitable amount of cells was sedimented by centrifugation. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    Amplification:

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA).

    Article Title: Early girl is a novel component of the Fat signaling pathway
    Article Snippet: For dsRNA synthesis for EGFP, a fragment was amplified with the EGFP-T7 forward 5’TAATACGACTCACTATAGGGACGTAAACGGCCACAAGTTC 3’ and EGFP-T7 reverse 5’ TAATACGACTCACTATAGGGTGTTCTGCTGGTAGTGGTCG 3’ primers. dsRNA synthesis was carried out using MEGAscript T7 transcription Kit (Invitrogen), following manufacturer’s instruction. .. After synthesis the dsRNA was purified using RNAeasy mini Kit (Quiagen).

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    Mass Spectrometry:

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: A. thaliana ecotype Columbia and a fad2 mutant were transformed by Agrobacterium -mediated floral dip and seeds selected for PPT resistance by germination and establishment on MS media plates containing 3.5 mg/L PPT. .. Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN).

    Quantitative RT-PCR:

    Article Title: Protease-Activated Receptor 2 Promotes Pro-Atherogenic Effects through Transactivation of the VEGF Receptor 2 in Human Vascular Smooth Muscle Cells
    Article Snippet: Paragraph title: qRT-PCR ... Murine aortas were lysed in 1 ml Tripure (Roche, Mannheim, Germany) by a tissuelyser II (Qiagen, Hilden, Germany) for 5 min at 29 s−1 for mRNA isolation. mRNA purification of cells and aortas was done with an RNeasy Kit (Qiagen, Hilden, Germany) and content of mRNA was measured with a NanoDrop2000 (Thermo Scientific, Schwerte, Germany).

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Article Title: The Oxysterol 7-Ketocholesterol Reduces Zika Virus Titers in Vero Cells and Human Neurons
    Article Snippet: Paragraph title: 2.11. qRT-PCR ... Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany).

    Article Title: Senecavirus A 3C Protease Mediates Host Cell Apoptosis Late in Infection
    Article Snippet: Paragraph title: RNA Extraction and Quantitative Reverse-Transcription-PCR (RT-qPCR) ... RNA samples were treated with DNase (Ambion) and further cleaned using the RNeasy® Mini kit (QIAGEN).

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: Paragraph title: qRT-PCR. ... RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    Article Title: The impact of exercise on mitochondrial dynamics and the role of Drp1 in exercise performance and training adaptations in skeletal muscle
    Article Snippet: Paragraph title: DNA & RNA extraction, cDNA synthesis, quantitative RT-PCR, and microarrays ... 2.5 DNA and RNA were extracted from a homogenous portion of frozen quadriceps muscle homogenate using DNeasy/RNeasy Isolation kits (Qiagen) as described by the manufacturer.

    Article Title: Transmembrane Protease TMPRSS11B Promotes Lung Cancer Growth by Enhancing Lactate Export and Glycolytic Metabolism
    Article Snippet: Paragraph title: RT-qPCR ... RNA was then extracted according to the RNeasy protocol (QIAGEN) with on-column DNase digest and resuspended in 50 mL nuclease-free H2 O. RNA (1 mg) served as template for reverse transcription with SuperScript IV VILO (Invitrogen, Cat. No. 11756050).

    Real-time Polymerase Chain Reaction:

    Article Title: The Oxysterol 7-Ketocholesterol Reduces Zika Virus Titers in Vero Cells and Human Neurons
    Article Snippet: Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany). .. Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany).

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. Gene-specific cDNA was amplified by PCR using mouse specific primer pairs (IFN-γ sense: 5′-GCT TTG CAG CTC TTC CTC AT-3′ and IFN-γ anti-sense: 5′-GTC ACC ATC CTT TTG CCA GT-3′ ; IL-17A sense: 5′-GTG GCG GCT ACA GTG AAG GCA-3′ , and IL-17A antisense: 5′-GAC AAT CGA GGC CAC GCA GGT-3′ ; HIF-α1 sense: 5′-TCC ATG TGA CCA TGA GGA AA-3′ and HIF-α1 anti-sense: 5′-CTT CCA CGT TGC TGA CTT GA-3′ ; VEGF sense: 5′-AGC ACA GCA GAT GTG AAT GC-3′ and VEGF anti-sense: 5′-AAT GCT TTC TCC GCT CTG AA-3′ ; Foxp3 sense: 5′-CCC CTA GTT CCA ACC TAG CC-3′ , and Foxp3 antisense: 5′-TAC CAA GGC AGG CTC TTC AT-3′ ; IL-10 sense: 5′-CCA AGC CTT ATC GGA AAT GA-3′ , and IL-10 antisense: 5′-TTT TCA CAG GGG AGA AAT CG-3′ ; TGF-β1 sense: 5′-TGG AGC AAC ATG TGG AAC TC-3′ , and TGF-β1 antisense: 5′-AGC CCT GTA TTC CGT CTC CT-3′ ; β-actin sense, 5′-ATG CCA ACA CAG TGC TGT CT-3′ , and β-actin antisense, 5′-AAG CAC TTG CGG TGC ACG AT- 3′ ).

    Article Title: Direct reprogramming of human fibroblasts into dopaminergic neuron-like cells
    Article Snippet: Paragraph title: Real-time PCR and PCR ... Total RNA was extracted using RNAeasy Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    Article Title: The impact of exercise on mitochondrial dynamics and the role of Drp1 in exercise performance and training adaptations in skeletal muscle
    Article Snippet: 2.5 DNA and RNA were extracted from a homogenous portion of frozen quadriceps muscle homogenate using DNeasy/RNeasy Isolation kits (Qiagen) as described by the manufacturer. .. 2.5 DNA and RNA were extracted from a homogenous portion of frozen quadriceps muscle homogenate using DNeasy/RNeasy Isolation kits (Qiagen) as described by the manufacturer.

    Microarray:

    Article Title: Prdm4 induction by the small molecule butein promotes white adipose tissue browning
    Article Snippet: Mice were placed in metabolic cages and were acclimated in the metabolic chambers for 1 day before the measuring energy expenditure, O2 consumption, and CO2 production. .. Microarray analysis Total RNA from fully differentiated C3H10T1/2 adipocytes treated with 20μM of butein, sulfurein or resveratrol for 6 hours were prepared using TRIzol and further purified using RNAeasy columns (QIAGEN). cDNA preparation and hybridization to Affymetrix Mouse Genome Arrays (430 version 2.0) were performed by Genochek. .. The data were analyzed using GeneSpring GX 7.3 software (Agilent Technologies).

    Quantitation Assay:

    Article Title: Tumor Angiogenesis in the Absence of Fibronectin or Its Cognate Integrin Receptors
    Article Snippet: Paragraph title: RNA isolation and quantitation ... RNA was extracted using the Qiagen RNAeasy mini-column kit, after combining the chloroform extract from Trizol 1:1 with 70% ethanol.

    Cell Culture:

    Article Title: Senecavirus A 3C Protease Mediates Host Cell Apoptosis Late in Infection
    Article Snippet: STu cells cultured in 6-well plates were infected with SVA (MOI = 5), collected at 2, 4, 8, and 12 h p.i., and cellular RNA extracted using TRIzol reagent (Invitrogen) according to manufacturer's protocol. .. RNA samples were treated with DNase (Ambion) and further cleaned using the RNeasy® Mini kit (QIAGEN).

    Article Title: Transmembrane Protease TMPRSS11B Promotes Lung Cancer Growth by Enhancing Lactate Export and Glycolytic Metabolism
    Article Snippet: Cells with inducible shRNA were cultured in 2 mg/mL dox for > 3 days with fresh dox added every 2 days. .. RNA was then extracted according to the RNeasy protocol (QIAGEN) with on-column DNase digest and resuspended in 50 mL nuclease-free H2 O. RNA (1 mg) served as template for reverse transcription with SuperScript IV VILO (Invitrogen, Cat. No. 11756050).

    Expressing:

    Article Title: Renal Klotho is Reduced in Septic Patients and Pretreatment With Recombinant Klotho Attenuates Organ Injury in Lipopolysaccharide-Challenged Mice
    Article Snippet: Organs were harvested and either snap frozen on liquid nitrogen and stored at –80°C until further analysis, or fixed in formalin for histological analysis. .. Gene Expression Analysis by Quantitative Reverse Transcription Polymerase Chain Reaction Total RNA was isolated from mouse kidney and brain cryosections using a RNAeasy Mini Plus Kit (Qiagen, Leusden, The Netherlands), according to the manufacturer’s instructions. .. RNA integrity was analyzed, complementary DNA synthesized and quantitative reverse transcription polymerase chain reaction performed as described in detail ( ) and briefly in the supplemental methods (Supplemental Digital Content 1, http://links.lww.com/CCM/E2 ).

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Article Title: The Oxysterol 7-Ketocholesterol Reduces Zika Virus Titers in Vero Cells and Human Neurons
    Article Snippet: Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany). .. Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany).

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Finally, the mRNA expression levels of different lysosomal proteases were determined by PCR, quantified using ImageJ (imagej. nih.gov) and normalised using β-actin or Tubulin 5 as loading control. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Article Title: Senecavirus A 3C Protease Mediates Host Cell Apoptosis Late in Infection
    Article Snippet: RNA samples were treated with DNase (Ambion) and further cleaned using the RNeasy® Mini kit (QIAGEN). .. Mock infected cells were used as a negative control.

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: The vector was constructed by synthesising (Geneart, Regensburg, Germany) the seven fatty acid biosynthesis expression cassettes with MAR spacers – and tobacco mosaic virus 5′ untranslated enhancer leader sequences as a single 19.75 kb fragment flanked by Not I restriction sites. .. Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN).

    Article Title: Stat3 is indispensable for damage-induced crypt regeneration but not for Wnt-driven intestinal tumorigenesis
    Article Snippet: Paragraph title: Expression analyses ... Total RNA was extracted from isolated crypts using an RNeasy Plus Micro Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Amplification was carried out using an ABI PRISM 7300 real-time PCR system, and fluorescence data were processed using SDS software (ABI).

    Article Title: Prdm4 induction by the small molecule butein promotes white adipose tissue browning
    Article Snippet: Microarray analysis Total RNA from fully differentiated C3H10T1/2 adipocytes treated with 20μM of butein, sulfurein or resveratrol for 6 hours were prepared using TRIzol and further purified using RNAeasy columns (QIAGEN). cDNA preparation and hybridization to Affymetrix Mouse Genome Arrays (430 version 2.0) were performed by Genochek. .. The data were analyzed using GeneSpring GX 7.3 software (Agilent Technologies).

    Modification:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The effect of MASP-3 siRNA by duplex 1 (duplex 3) and duplex 2 (duplex 4) was initially characterized in 8-wk-old naive C57BL/6J mice (Charles River Laboratories), and later on, these duplexes were further chemically modified. .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Transformation Assay:

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: Paragraph title: Binary Vector Construction and A. thaliana Transformation ... Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN).

    Hybridization:

    Article Title: Prdm4 induction by the small molecule butein promotes white adipose tissue browning
    Article Snippet: Mice were placed in metabolic cages and were acclimated in the metabolic chambers for 1 day before the measuring energy expenditure, O2 consumption, and CO2 production. .. Microarray analysis Total RNA from fully differentiated C3H10T1/2 adipocytes treated with 20μM of butein, sulfurein or resveratrol for 6 hours were prepared using TRIzol and further purified using RNAeasy columns (QIAGEN). cDNA preparation and hybridization to Affymetrix Mouse Genome Arrays (430 version 2.0) were performed by Genochek. .. The data were analyzed using GeneSpring GX 7.3 software (Agilent Technologies).

    Gas Chromatography:

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA).

    Immunoprecipitation:

    Article Title: A reciprocal role of prostate cancer on stromal DNA damage
    Article Snippet: RNA was extracted using the RNAeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. .. ChIP analysis of the GSTP1 promoter in Tgfbr2-flox and Tgfbr2-KO prostate stromal cells were performed as described previously ( ).

    Infection:

    Article Title: The Oxysterol 7-Ketocholesterol Reduces Zika Virus Titers in Vero Cells and Human Neurons
    Article Snippet: Vero cells were infected with ZIKV SPH and treated with compounds in the same manner as the time-of-addition experiment. .. Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany).

    Article Title: Senecavirus A 3C Protease Mediates Host Cell Apoptosis Late in Infection
    Article Snippet: STu cells cultured in 6-well plates were infected with SVA (MOI = 5), collected at 2, 4, 8, and 12 h p.i., and cellular RNA extracted using TRIzol reagent (Invitrogen) according to manufacturer's protocol. .. RNA samples were treated with DNase (Ambion) and further cleaned using the RNeasy® Mini kit (QIAGEN).

    Generated:

    Article Title: The Oxysterol 7-Ketocholesterol Reduces Zika Virus Titers in Vero Cells and Human Neurons
    Article Snippet: Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany). .. Each sample was analyzed in duplicate, and each plate contained a DNA plasmid standard curve (ZIKV molecular clone), no template, and no primer controls.

    Negative Control:

    Article Title: A reciprocal role of prostate cancer on stromal DNA damage
    Article Snippet: RNA was extracted using the RNAeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. .. ChIP analysis of the GSTP1 promoter in Tgfbr2-flox and Tgfbr2-KO prostate stromal cells were performed as described previously ( ).

    Polymerase Chain Reaction:

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA).

    Article Title: A reciprocal role of prostate cancer on stromal DNA damage
    Article Snippet: Paragraph title: Quantitative Reverse Transcription–PCR, ChIP Analysis, and Methylation Specific PCR ... RNA was extracted using the RNAeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol.

    Article Title: Direct reprogramming of human fibroblasts into dopaminergic neuron-like cells
    Article Snippet: Paragraph title: Real-time PCR and PCR ... Total RNA was extracted using RNAeasy Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Finally, the mRNA expression levels of different lysosomal proteases were determined by PCR, quantified using ImageJ (imagej. nih.gov) and normalised using β-actin or Tubulin 5 as loading control. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    Injection:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    TaqMan Assay:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. Levels of MASP3 expression were analyzed using qRT-PCR reagents compatible with Roche Lightcycler 480.

    Cellular Antioxidant Activity Assay:

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA).

    In Vivo:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: Paragraph title: In vivo selection of active GalNAc–MASP-3–siRNA duplexes ... The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    RNA Sequencing Assay:

    Article Title: Proteome Analysis of Human Neutrophil Granulocytes From Patients With Monogenic Disease Using Data-independent Acquisition *
    Article Snippet: Paragraph title: RNA Sequencing ... RNA was isolated with the RNAeasy plus mini-kit from Qiagen (catalog number 74134) according to the vendor protocol.

    Fluorescence:

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    Methylation:

    Article Title: A reciprocal role of prostate cancer on stromal DNA damage
    Article Snippet: Paragraph title: Quantitative Reverse Transcription–PCR, ChIP Analysis, and Methylation Specific PCR ... RNA was extracted using the RNAeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol.

    Mutagenesis:

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: A. thaliana ecotype Columbia and a fad2 mutant were transformed by Agrobacterium -mediated floral dip and seeds selected for PPT resistance by germination and establishment on MS media plates containing 3.5 mg/L PPT. .. Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN).

    Isolation:

    Article Title: Surface L-type Ca2+ channel expression levels are increased in aged hippocampus
    Article Snippet: CA1, CA3, and DG regions were isolated from young and aged rats in pairs, homogenized in RPLT-Plus Lysis Buffer (Qiagen, Valencia, CA, USA) and stored at −80 °C until RNA isolation. .. Samples were further dissociated with QiaShredder columns, and the total RNA was isolated via Qiagen RNEasy Plus Kit according to manufacturer’s directions. .. RNA was dissolved into 60 μl RNAse-free water, stored on ice, and the yield was determined with a nanodrop spectrophotometer (Thermo-Scientific, Rockford, IL, USA).

    Article Title: Renal Klotho is Reduced in Septic Patients and Pretreatment With Recombinant Klotho Attenuates Organ Injury in Lipopolysaccharide-Challenged Mice
    Article Snippet: Organs were harvested and either snap frozen on liquid nitrogen and stored at –80°C until further analysis, or fixed in formalin for histological analysis. .. Gene Expression Analysis by Quantitative Reverse Transcription Polymerase Chain Reaction Total RNA was isolated from mouse kidney and brain cryosections using a RNAeasy Mini Plus Kit (Qiagen, Leusden, The Netherlands), according to the manufacturer’s instructions. .. RNA integrity was analyzed, complementary DNA synthesized and quantitative reverse transcription polymerase chain reaction performed as described in detail ( ) and briefly in the supplemental methods (Supplemental Digital Content 1, http://links.lww.com/CCM/E2 ).

    Article Title: Proteome Analysis of Human Neutrophil Granulocytes From Patients With Monogenic Disease Using Data-independent Acquisition *
    Article Snippet: Neutrophils from 22 healthy donors were isolated using the same approach as for the proteomics samples. .. RNA was isolated with the RNAeasy plus mini-kit from Qiagen (catalog number 74134) according to the vendor protocol. .. Magnetic oligo-dT beads (NEB) were used for mRNA enrichment starting with 1 to 10 ng total RNA with RIN values above 9.

    Article Title: Protease-Activated Receptor 2 Promotes Pro-Atherogenic Effects through Transactivation of the VEGF Receptor 2 in Human Vascular Smooth Muscle Cells
    Article Snippet: qRT-PCR RNA isolation of human cells was performed in RLT lysis buffer working solution containing 1% β-mercaptoethanol according to manufacturer's protocols. .. Murine aortas were lysed in 1 ml Tripure (Roche, Mannheim, Germany) by a tissuelyser II (Qiagen, Hilden, Germany) for 5 min at 29 s−1 for mRNA isolation. mRNA purification of cells and aortas was done with an RNeasy Kit (Qiagen, Hilden, Germany) and content of mRNA was measured with a NanoDrop2000 (Thermo Scientific, Schwerte, Germany). .. All samples were reversely transcribed into 1 μg/μl of cDNA using an Omniscript RT Kit (Qiagen, Venlo, Netherlands) and mRNA levels were determined by StepOne Plus real-time PCR system (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: Single 1 or 10 mg/kg doses of duplex 1 and duplex 2 were administered s.c. Livers were collected on day 7 postinjection. .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) was used to convert the mRNA samples.

    Article Title: The Oxysterol 7-Ketocholesterol Reduces Zika Virus Titers in Vero Cells and Human Neurons
    Article Snippet: Supernatants and cellular lysates were collected at 24 hpi. .. Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany). .. Both total and viral RNA samples were reverse-transcribed (RT) to cDNA (High Capacity RNA-to-cDNA Kit, Applied Biosystems, Foster City, CA, USA).

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Ocular inflammation was assessed by light microscopy, and the severity of EAU was graded on a four-point scale based on inflammatory cell infiltration, retinal folding and destruction . .. Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. First-strand cDNA synthesis was accomplished with oligo (dT)-primed Omniscript reverse transcriptase kit (Qiagen).

    Article Title: Tumor Angiogenesis in the Absence of Fibronectin or Its Cognate Integrin Receptors
    Article Snippet: Paragraph title: RNA isolation and quantitation ... RNA was extracted using the Qiagen RNAeasy mini-column kit, after combining the chloroform extract from Trizol 1:1 with 70% ethanol.

    Article Title: The impact of exercise on mitochondrial dynamics and the role of Drp1 in exercise performance and training adaptations in skeletal muscle
    Article Snippet: In the interest of space, most representative immunoblots are presented in the supplement. .. 2.5 DNA and RNA were extracted from a homogenous portion of frozen quadriceps muscle homogenate using DNeasy/RNeasy Isolation kits (Qiagen) as described by the manufacturer. .. Isolated DNA and RNA was tested for concentration and purity using a NanoDrop Spectrophotometer (Thermo Scientific).

    Sequencing:

    Article Title: Proteome Analysis of Human Neutrophil Granulocytes From Patients With Monogenic Disease Using Data-independent Acquisition *
    Article Snippet: RNA was isolated with the RNAeasy plus mini-kit from Qiagen (catalog number 74134) according to the vendor protocol. .. RNA was isolated with the RNAeasy plus mini-kit from Qiagen (catalog number 74134) according to the vendor protocol.

    Article Title: Direct reprogramming of human fibroblasts into dopaminergic neuron-like cells
    Article Snippet: Total RNA was extracted using RNAeasy Mini Kit (Qiagen) according to the manufacturer's instructions. .. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Qiagen).

    Size-exclusion Chromatography:

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. Gene-specific cDNA was amplified by PCR using mouse specific primer pairs (IFN-γ sense: 5′-GCT TTG CAG CTC TTC CTC AT-3′ and IFN-γ anti-sense: 5′-GTC ACC ATC CTT TTG CCA GT-3′ ; IL-17A sense: 5′-GTG GCG GCT ACA GTG AAG GCA-3′ , and IL-17A antisense: 5′-GAC AAT CGA GGC CAC GCA GGT-3′ ; HIF-α1 sense: 5′-TCC ATG TGA CCA TGA GGA AA-3′ and HIF-α1 anti-sense: 5′-CTT CCA CGT TGC TGA CTT GA-3′ ; VEGF sense: 5′-AGC ACA GCA GAT GTG AAT GC-3′ and VEGF anti-sense: 5′-AAT GCT TTC TCC GCT CTG AA-3′ ; Foxp3 sense: 5′-CCC CTA GTT CCA ACC TAG CC-3′ , and Foxp3 antisense: 5′-TAC CAA GGC AGG CTC TTC AT-3′ ; IL-10 sense: 5′-CCA AGC CTT ATC GGA AAT GA-3′ , and IL-10 antisense: 5′-TTT TCA CAG GGG AGA AAT CG-3′ ; TGF-β1 sense: 5′-TGG AGC AAC ATG TGG AAC TC-3′ , and TGF-β1 antisense: 5′-AGC CCT GTA TTC CGT CTC CT-3′ ; β-actin sense, 5′-ATG CCA ACA CAG TGC TGT CT-3′ , and β-actin antisense, 5′-AAG CAC TTG CGG TGC ACG AT- 3′ ).

    Purification:

    Article Title: Protease-Activated Receptor 2 Promotes Pro-Atherogenic Effects through Transactivation of the VEGF Receptor 2 in Human Vascular Smooth Muscle Cells
    Article Snippet: qRT-PCR RNA isolation of human cells was performed in RLT lysis buffer working solution containing 1% β-mercaptoethanol according to manufacturer's protocols. .. Murine aortas were lysed in 1 ml Tripure (Roche, Mannheim, Germany) by a tissuelyser II (Qiagen, Hilden, Germany) for 5 min at 29 s−1 for mRNA isolation. mRNA purification of cells and aortas was done with an RNeasy Kit (Qiagen, Hilden, Germany) and content of mRNA was measured with a NanoDrop2000 (Thermo Scientific, Schwerte, Germany). .. All samples were reversely transcribed into 1 μg/μl of cDNA using an Omniscript RT Kit (Qiagen, Venlo, Netherlands) and mRNA levels were determined by StepOne Plus real-time PCR system (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Early girl is a novel component of the Fat signaling pathway
    Article Snippet: For dsRNA synthesis for EGFP, a fragment was amplified with the EGFP-T7 forward 5’TAATACGACTCACTATAGGGACGTAAACGGCCACAAGTTC 3’ and EGFP-T7 reverse 5’ TAATACGACTCACTATAGGGTGTTCTGCTGGTAGTGGTCG 3’ primers. dsRNA synthesis was carried out using MEGAscript T7 transcription Kit (Invitrogen), following manufacturer’s instruction. .. After synthesis the dsRNA was purified using RNAeasy mini Kit (Quiagen). .. S2 cells were grown in Schneider’s media and transfected with plasmids aw-GAL4, pUAST-D-:V5 [ ] pUAST-D-N:V5, pUAST-D-M:V5, pUAST-D-C:V5 [ ], pUAST-Vam-V5 [ ] along with pUAST-elgi-Myc-HA, using effectene transfection reagent (Quiagen) following the manufacturer’s instruction.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: The mean intensity of CellROX Orange per LysoTracker Green DND26 positive structure, normalised for lysosomal size (µm2 ) and per cell was calculated and the standard error calculated using 15 cells per experimental condition. .. Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: The following primers were used: β-actin: forward (ATCATGTTTGAGACCTTCAACA), reverse (CATCTCCTGCTCGAAGTCTA); Tubb5: forward (TGTACTATAATGAAGCCACAGGTGG), reverse (CAGTAGGTCTCATCCGTGTTCTCAA); AEP: forward (ATGACCTGGAGAGTGGCTG), reverse (CGTTGATGTCGTCGGGCA); CtsB: forward (GGGTACTTAGGAGTGCACGG), reverse (CCAAATGCCCAACAAGAGCC); CtsD: forward (TCAGGAAGCCTCTCTGGGTA), reverse (CTGCAGCTCCTTCACCTCTT); CtsH: forward (ATGACGAGGCTGCAATGGTT), reverse (TCCCTTGGTCTGCCAATCAG); CtsL: forward (ATGGCACGAATGAGGAAGAG), reverse (GAAAAAGCCTCCCCTTCTTG) and CtsZ: forward (CAGCGGATCTCCCCAAGAAT), reverse (GTCCTTGGCCTGGTAGTTGT). .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: The culture-RNAlater mixture was thawed on ice, and a suitable amount of cells was sedimented by centrifugation. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. The resulting RNA (200 ng) was used as a template for reverse transcription and conversion into cDNA using Superscript II reverse transcriptase (Invitrogen) by following the manufacturer's instructions.

    Article Title: Prdm4 induction by the small molecule butein promotes white adipose tissue browning
    Article Snippet: Mice were placed in metabolic cages and were acclimated in the metabolic chambers for 1 day before the measuring energy expenditure, O2 consumption, and CO2 production. .. Microarray analysis Total RNA from fully differentiated C3H10T1/2 adipocytes treated with 20μM of butein, sulfurein or resveratrol for 6 hours were prepared using TRIzol and further purified using RNAeasy columns (QIAGEN). cDNA preparation and hybridization to Affymetrix Mouse Genome Arrays (430 version 2.0) were performed by Genochek. .. The data were analyzed using GeneSpring GX 7.3 software (Agilent Technologies).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Renal Klotho is Reduced in Septic Patients and Pretreatment With Recombinant Klotho Attenuates Organ Injury in Lipopolysaccharide-Challenged Mice
    Article Snippet: Organs were harvested and either snap frozen on liquid nitrogen and stored at –80°C until further analysis, or fixed in formalin for histological analysis. .. Gene Expression Analysis by Quantitative Reverse Transcription Polymerase Chain Reaction Total RNA was isolated from mouse kidney and brain cryosections using a RNAeasy Mini Plus Kit (Qiagen, Leusden, The Netherlands), according to the manufacturer’s instructions. .. RNA integrity was analyzed, complementary DNA synthesized and quantitative reverse transcription polymerase chain reaction performed as described in detail ( ) and briefly in the supplemental methods (Supplemental Digital Content 1, http://links.lww.com/CCM/E2 ).

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Paragraph title: Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) ... Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: DNA was extracted and Southern blots performed according to established protocols . .. Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN). .. Fatty acid profiles were determined on batches of approximately 200 seeds.

    Selection:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: Paragraph title: In vivo selection of active GalNAc–MASP-3–siRNA duplexes ... The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Construct:

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: The vector was constructed by synthesising (Geneart, Regensburg, Germany) the seven fatty acid biosynthesis expression cassettes with MAR spacers – and tobacco mosaic virus 5′ untranslated enhancer leader sequences as a single 19.75 kb fragment flanked by Not I restriction sites. .. Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN).

    Mouse Assay:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The effect of MASP-3 siRNA by duplex 1 (duplex 3) and duplex 2 (duplex 4) was initially characterized in 8-wk-old naive C57BL/6J mice (Charles River Laboratories), and later on, these duplexes were further chemically modified. .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Chromatin Immunoprecipitation:

    Article Title: A reciprocal role of prostate cancer on stromal DNA damage
    Article Snippet: Paragraph title: Quantitative Reverse Transcription–PCR, ChIP Analysis, and Methylation Specific PCR ... RNA was extracted using the RNAeasy mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol.

    Plasmid Preparation:

    Article Title: The Oxysterol 7-Ketocholesterol Reduces Zika Virus Titers in Vero Cells and Human Neurons
    Article Snippet: Viral RNA was isolated using the ZR Viral RNA kit (Zymo, Irvine, CA, USA) and cellular RNA was isolated with the RNAeasy Mini kit (Qiagen, Hilden, Germany). .. To quantify the copies of ZIKV genomes we used the cDNA in a quantitative PCR (qPCR) reaction assay using TaqMan Gene Expression Master Mix (Applied Biosystems, ThermoFisher, Waltham, MA, USA), primers and probes (F: ZIKV 1086, R: ZIKV 1162c, ZIKV 1107-FAM; TaqMan MGB Probe; Invitrogen Custom Primers) [ ].

    Article Title: Metabolic Engineering Plant Seeds with Fish Oil-Like Levels of DHA
    Article Snippet: Paragraph title: Binary Vector Construction and A. thaliana Transformation ... Total RNA was extracted using an RNeasy mini-kit (QIAGEN, Doncaster, VIC, Australia) and RT-PCR performed using a OneStep RT-PCR Kit (QIAGEN).

    Software:

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    SYBR Green Assay:

    Article Title: Direct reprogramming of human fibroblasts into dopaminergic neuron-like cells
    Article Snippet: Total RNA was extracted using RNAeasy Mini Kit (Qiagen) according to the manufacturer's instructions. .. RNA was then subjected to complementary DNA synthesis with random hexamer primers using Superscript III reverse transcriptase (Invitrogen).

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    RNA Extraction:

    Article Title: Senecavirus A 3C Protease Mediates Host Cell Apoptosis Late in Infection
    Article Snippet: Paragraph title: RNA Extraction and Quantitative Reverse-Transcription-PCR (RT-qPCR) ... RNA samples were treated with DNase (Ambion) and further cleaned using the RNeasy® Mini kit (QIAGEN).

    Article Title: The impact of exercise on mitochondrial dynamics and the role of Drp1 in exercise performance and training adaptations in skeletal muscle
    Article Snippet: Paragraph title: DNA & RNA extraction, cDNA synthesis, quantitative RT-PCR, and microarrays ... 2.5 DNA and RNA were extracted from a homogenous portion of frozen quadriceps muscle homogenate using DNeasy/RNeasy Isolation kits (Qiagen) as described by the manufacturer.

    shRNA:

    Article Title: Transmembrane Protease TMPRSS11B Promotes Lung Cancer Growth by Enhancing Lactate Export and Glycolytic Metabolism
    Article Snippet: Cells with inducible shRNA were cultured in 2 mg/mL dox for > 3 days with fresh dox added every 2 days. .. RNA was then extracted according to the RNeasy protocol (QIAGEN) with on-column DNase digest and resuspended in 50 mL nuclease-free H2 O. RNA (1 mg) served as template for reverse transcription with SuperScript IV VILO (Invitrogen, Cat. No. 11756050).

    Spectrophotometry:

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Concentration Assay:

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    CTG Assay:

    Article Title: Low Dose Rapamycin Exacerbates Autoimmune Experimental Uveitis
    Article Snippet: Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA). .. Total RNA from whole eye tissue was isolated with RNAeasy Mini Kit (Qiagen, Valencia, CA).

    Lysis:

    Article Title: Surface L-type Ca2+ channel expression levels are increased in aged hippocampus
    Article Snippet: CA1, CA3, and DG regions were isolated from young and aged rats in pairs, homogenized in RPLT-Plus Lysis Buffer (Qiagen, Valencia, CA, USA) and stored at −80 °C until RNA isolation. .. Samples were further dissociated with QiaShredder columns, and the total RNA was isolated via Qiagen RNEasy Plus Kit according to manufacturer’s directions.

    Article Title: Protease-Activated Receptor 2 Promotes Pro-Atherogenic Effects through Transactivation of the VEGF Receptor 2 in Human Vascular Smooth Muscle Cells
    Article Snippet: qRT-PCR RNA isolation of human cells was performed in RLT lysis buffer working solution containing 1% β-mercaptoethanol according to manufacturer's protocols. .. Murine aortas were lysed in 1 ml Tripure (Roche, Mannheim, Germany) by a tissuelyser II (Qiagen, Hilden, Germany) for 5 min at 29 s−1 for mRNA isolation. mRNA purification of cells and aortas was done with an RNeasy Kit (Qiagen, Hilden, Germany) and content of mRNA was measured with a NanoDrop2000 (Thermo Scientific, Schwerte, Germany).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rneasy 96 kit
    Time- and dose-dependent reduction of HCV RNA in the replicon cells by VX-950. The replicon cells were incubated with various concentrations of VX-950 for 24, 48, 72, or 120 h. At the end of each incubation period, total RNA was extracted by <t>RNeasy-96,</t>
    Rneasy 96 Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy 96 kit/product/Qiagen
    Average 99 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    rneasy 96 kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Time- and dose-dependent reduction of HCV RNA in the replicon cells by VX-950. The replicon cells were incubated with various concentrations of VX-950 for 24, 48, 72, or 120 h. At the end of each incubation period, total RNA was extracted by RNeasy-96,

    Journal:

    Article Title: VX-950, a Novel Hepatitis C Virus (HCV) NS3-4A Protease Inhibitor, Exhibits Potent Antiviral Activities in HCV Replicon Cells

    doi: 10.1128/AAC.50.5.1813-1822.2006

    Figure Lengend Snippet: Time- and dose-dependent reduction of HCV RNA in the replicon cells by VX-950. The replicon cells were incubated with various concentrations of VX-950 for 24, 48, 72, or 120 h. At the end of each incubation period, total RNA was extracted by RNeasy-96,

    Article Snippet: Total cellular RNA was extracted using an RNeasy-96 kit (QIAGEN, Valencia, CA), and the copy number of HCV RNA was determined using a quantitative RT-PCR (QRT-PCR) assay ( ).

    Techniques: Incubation

    Dose-dependent inhibition of HCV replicon by PI-1 or IFN-α alone. HCV replicon cells were treated with PI-1 (A) or IFN-α (B) for 48 h. At the end of the 48-h treatment, total cellular RNA was extracted with the RNeasy-96 kit. The levels

    Journal:

    Article Title: Combination of a Hepatitis C Virus NS3-NS4A Protease Inhibitor and Alpha Interferon Synergistically Inhibits Viral RNA Replication and Facilitates Viral RNA Clearance in Replicon Cells

    doi: 10.1128/AAC.48.12.4784-4792.2004

    Figure Lengend Snippet: Dose-dependent inhibition of HCV replicon by PI-1 or IFN-α alone. HCV replicon cells were treated with PI-1 (A) or IFN-α (B) for 48 h. At the end of the 48-h treatment, total cellular RNA was extracted with the RNeasy-96 kit. The levels

    Article Snippet: After the cells were incubated with the compounds for 48 h, the intracellular RNA was extracted with an RNeasy 96 kit (Qiagen, Valencia, Calif.).

    Techniques: Inhibition