dneasy plant mini kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    DNeasy Plant Mini Kit
    Description:

    Catalog Number:
    69104/69106
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen dneasy plant mini kit

    https://www.bioz.com/result/dneasy plant mini kit/product/Qiagen
    Average 99 stars, based on 1188 article reviews
    Price from $9.99 to $1999.99
    dneasy plant mini kit - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: Paragraph title: DNA isolation, PCR amplification, cloning and sequencing ... Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol.

    Article Title: Carnation I locus contains two chalcone isomerase genes involved in orange flower coloration
    Article Snippet: Paragraph title: Cloning of chalcone isomerase genomic and cDNA sequences from orange and red flowered carnations ... Genomic DNAs and total RNAs were isolated from ‘4-94-1 MR’ and ‘120 MOR’, ‘129 MOR’ and ‘129 MOR-MOR1’ petals at developmental stage 3 using a DNeasy Plant Mini Kit and a RNeasy Plant Mini Kit (Qiagen), respectively.

    Amplification:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. Polymerase chain reaction was carried out using L5 and L6 primers previously described [ ] and HotStarTaq plus Master Mix (QIAGEN).

    Article Title: Deletion of biosynthetic genes, specific SNP patterns and differences in transcript accumulation cause variation in hydroxynitrile glucoside content in barley cultivars
    Article Snippet: Different amplification strategies were required in order to amplify and sequence the biosynthetic genes from the cvs. .. For DNA extraction and PCR, either the Extract-N-Amp Plant PCR Kit (Merck) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) were used.

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: The percentage composition of the samples was computed from the GC peak areas using the normalization method. .. Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol. .. The ITS region was amplified by primers ITS-1 (5’GTTTCCGTAGGTGAACCTGC3’) and ITS-4 (5’TCCTCCGCTTATTGATATGC3’).

    Article Title: Carnation I locus contains two chalcone isomerase genes involved in orange flower coloration
    Article Snippet: Genomic DNAs and total RNAs were isolated from ‘4-94-1 MR’ and ‘120 MOR’, ‘129 MOR’ and ‘129 MOR-MOR1’ petals at developmental stage 3 using a DNeasy Plant Mini Kit and a RNeasy Plant Mini Kit (Qiagen), respectively. .. PCR was performed using Prime Star GXL polymerase (Takara Bio) under the following conditions: 2 min denaturation at 94°C, then 35 cycles of 10 s denaturation at 98°C, 15 s annealing at 55°C, 20 s extension at 68°C, and a final 1 min extension at 68°C.

    Article Title: High gene flow in epiphytic ferns despite habitat loss and fragmentation
    Article Snippet: 20 mg) with the DNeasy 96 plant mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. .. 200 ng) was digested with 1 U Mse I (New England BioLabs, Ipswich, USA) and 5 U Eco RI (Promega, Madison, USA) and ligated (with 1.2 U of T4 DNA-Ligase; Promega) to double-stranded adapters in a thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Foster City, CA, USA) for 3 h at 37°C.

    Expressing:

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: Paragraph title: Plant expression vector and transformation of Crocus calli ... For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Ecological and Morphological Profile of Floating Spherical Cladophora socialis Aggregations in Central Thailand
    Article Snippet: Samples were frozen in liquid nitrogen until use and DNA was extracted with a DNeasy Plant Mini Kit (Qiagen Sciences, Germantown, MD, USA) according to the manufacturer’s instructions. .. The isolated DNA was used for PCR amplification of ribosomal RNA genes using the 18S rDNA specific primers SR-1f (5′-TACCTGGTTGATCCTGCCAG-3′) and 18S-C2r (5′-TCCGCAGGTTCACCTACGGAG-3′) [ ] and the 28S rDNA specific primers C1FL (5′-ACCCGCTGAACTTAAGCATATC-3′) and D2FL (5′-GGTCCGTGTTTCAAGACGG-3′) [ ].

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. Polymerase chain reaction was carried out using L5 and L6 primers previously described [ ] and HotStarTaq plus Master Mix (QIAGEN).

    Article Title: A Multifunctional and Possible Skin UV Protectant, (3R)-5-Hydroxymellein, Produced by an Endolichenic Fungus Isolated from Parmotrema austrosinense
    Article Snippet: The total DNA of ELF was extracted using a DNeasy Plant Mini Kit according to the manufacturer’s protocols (Qiagen, Hilden, Germany). .. The total DNA of ELF was extracted using a DNeasy Plant Mini Kit according to the manufacturer’s protocols (Qiagen, Hilden, Germany).

    Article Title: The Potential of Dark Septate Endophytes to Form Root Symbioses with Ectomycorrhizal and Ericoid Mycorrhizal Middle European Forest Plants
    Article Snippet: DNA was extracted using the DNeasy Plant Mini kit (QIAGEN, Germany) following manufacturer´s instructions. .. Isolated DNA was 10x diluted in dd H2 O and amplified in 4 independent PCR reactions using primers ITS1F and ITS4.

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: The transgenic calli were screened by genomic PCR. .. For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    Article Title: Deletion of biosynthetic genes, specific SNP patterns and differences in transcript accumulation cause variation in hydroxynitrile glucoside content in barley cultivars
    Article Snippet: Genomic DNA was isolated from leaf tissue. .. For DNA extraction and PCR, either the Extract-N-Amp Plant PCR Kit (Merck) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) were used. .. The primer sequences are shown in Supplementary Table , annealing temperatures and amplification strategies used can be found in Supplementary Table .

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: The percentage composition of the samples was computed from the GC peak areas using the normalization method. .. Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol. .. The ITS region was amplified by primers ITS-1 (5’GTTTCCGTAGGTGAACCTGC3’) and ITS-4 (5’TCCTCCGCTTATTGATATGC3’).

    Article Title: Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana
    Article Snippet: Genomic DNA was purified from the isolated mutant and wild-type plants four weeks after germination using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. The purified DNAs were subjected to HRM analysis using primers specific for the putative mutated genes (HY1, HY2, HY3 , and HY4 for the hy mutants; GL1, GL2 , and TTG1 for the gl mutants; see Additional file ).

    Article Title: Degeneration of the Nonrecombining Regions in the Mating-Type Chromosomes of the Anther-Smut Fungi
    Article Snippet: Mating types of the haploid cultures were identified by pairing with cultures of known mating types and examining the conjugation response elicited by the alternate mating pheromone ( ). .. Also, PCR primers that discriminate between a1 and a2 pheromone receptors ( ) were used to test extracted DNA for mating type with the DNeasy Plant Mini Kit (QIAGEN). .. The extracted DNA from the Microbotryum species was also used to obtain shotgun sequence libraries using the Titanium version 454 technology (performed at the University of Virginia, Genomics Core Facility) with a coverage of 2–2.5 × .

    Article Title: Carnation I locus contains two chalcone isomerase genes involved in orange flower coloration
    Article Snippet: Genomic DNAs and total RNAs were isolated from ‘4-94-1 MR’ and ‘120 MOR’, ‘129 MOR’ and ‘129 MOR-MOR1’ petals at developmental stage 3 using a DNeasy Plant Mini Kit and a RNeasy Plant Mini Kit (Qiagen), respectively. .. Genomic DNAs and total RNAs were isolated from ‘4-94-1 MR’ and ‘120 MOR’, ‘129 MOR’ and ‘129 MOR-MOR1’ petals at developmental stage 3 using a DNeasy Plant Mini Kit and a RNeasy Plant Mini Kit (Qiagen), respectively.

    Article Title: High gene flow in epiphytic ferns despite habitat loss and fragmentation
    Article Snippet: 20 mg) with the DNeasy 96 plant mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. .. 20 mg) with the DNeasy 96 plant mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol.

    TA Cloning:

    Article Title: Ecological and Morphological Profile of Floating Spherical Cladophora socialis Aggregations in Central Thailand
    Article Snippet: Samples were frozen in liquid nitrogen until use and DNA was extracted with a DNeasy Plant Mini Kit (Qiagen Sciences, Germantown, MD, USA) according to the manufacturer’s instructions. .. The isolated DNA was used for PCR amplification of ribosomal RNA genes using the 18S rDNA specific primers SR-1f (5′-TACCTGGTTGATCCTGCCAG-3′) and 18S-C2r (5′-TCCGCAGGTTCACCTACGGAG-3′) [ ] and the 28S rDNA specific primers C1FL (5′-ACCCGCTGAACTTAAGCATATC-3′) and D2FL (5′-GGTCCGTGTTTCAAGACGG-3′) [ ].

    Construct:

    Article Title: QTLs maintaining grain fertility under salt stress detected by exome QTL-seq and interval mapping in barley
    Article Snippet: Total DNA was extracted from each RIL (96 lines) using a DNeasy Plant Mini Kit (Qiagen). .. The DNA was analyzed via an Illumina GoldenGate® Assay (Illumina), and 146 SNPs that were evenly distributed throughout the genome were selected ( ).

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: After 10 days, the calli which did not harbour the CsULT1 -pCAMBIA construct turned blackish whereas the ones with the gene construct looked fresh and were used for further experimental studies. .. For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    SYBR Green Assay:

    Article Title: Site-specific manipulation of Arabidopsis loci using CRISPR-Cas9 SunTag systems
    Article Snippet: To detect differences in methylation using the endonuclease McrBC (NEB), genomic DNA was first extracted using either a CTAB-based method or the DNeasy Plant Mini Kit (Qiagen). .. To detect differences in methylation using the endonuclease McrBC (NEB), genomic DNA was first extracted using either a CTAB-based method or the DNeasy Plant Mini Kit (Qiagen).

    Mass Spectrometry:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: LC-MS was measured on a 1100 series LC/MSD mass spectrometer (capillary voltage 3.5 kV; corona current 4 μA; capillary exit voltage (fragmentor) 90 V; drying temperature 330 °C; drying flow 9 L/min; nebulizer pressure 50 psig) (Agilent, Santa Clara, CA, USA) with 5C18-MS-II (COSMOSIL; 4.6 mm × 150 mm; 5 μm octadecyl column (Nakarai, Kyoto, Japan)) using gradient system (MeOH/H2 O; 0 min (7:3)—20 min (10:0)—35 min (10:0)—40 min (7:3)—45 min (7:3); 0.5 mL/min) as eluent. .. DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

    Article Title: Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana
    Article Snippet: From the M2 generation, elongated hypocotyl (hy ) and glabrous (gl ) mutants were screened by germination of the M2 seeds on MS agar medium. .. Genomic DNA was purified from the isolated mutant and wild-type plants four weeks after germination using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

    Transformation Assay:

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: Paragraph title: Plant expression vector and transformation of Crocus calli ... For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    Over Expression:

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: The transgenic calli were screened by genomic PCR. .. For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen). .. The presence of CsULT1 was confirmed by genomic PCR using gene specific primer and reverse primer corresponding to GFP.

    High Performance Liquid Chromatography:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: HPLC with a Mightysil Si60 (10 mm × 250 mm) column (Kanto) was carried out on either an LC-20AT pump with a SPD-20A Prominence UV/VIS detector (Shimadzu, Kyoto, Japan) or a GL-7410 pump with a GL-7450 UV detector (GL Sciences, Tokyo, Japan), and with a D-2500 Chromato-Integrator (Hitachi, Tokyo, Japan) or a C-R8A Chromatopac recorder (Shimadzu). .. DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

    Conjugation Assay:

    Article Title: Degeneration of the Nonrecombining Regions in the Mating-Type Chromosomes of the Anther-Smut Fungi
    Article Snippet: Also, PCR primers that discriminate between a1 and a2 pheromone receptors ( ) were used to test extracted DNA for mating type with the DNeasy Plant Mini Kit (QIAGEN). .. Also, PCR primers that discriminate between a1 and a2 pheromone receptors ( ) were used to test extracted DNA for mating type with the DNeasy Plant Mini Kit (QIAGEN).

    Flow Cytometry:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: LC-MS was measured on a 1100 series LC/MSD mass spectrometer (capillary voltage 3.5 kV; corona current 4 μA; capillary exit voltage (fragmentor) 90 V; drying temperature 330 °C; drying flow 9 L/min; nebulizer pressure 50 psig) (Agilent, Santa Clara, CA, USA) with 5C18-MS-II (COSMOSIL; 4.6 mm × 150 mm; 5 μm octadecyl column (Nakarai, Kyoto, Japan)) using gradient system (MeOH/H2 O; 0 min (7:3)—20 min (10:0)—35 min (10:0)—40 min (7:3)—45 min (7:3); 0.5 mL/min) as eluent. .. DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

    Micromanipulation:

    Article Title: Degeneration of the Nonrecombining Regions in the Mating-Type Chromosomes of the Anther-Smut Fungi
    Article Snippet: Haploid cultures of the 11 Microbotryum species were obtained by micromanipulation of the postmeiotic yeast-like sporidial cells, which were grown on potato dextrose agar (Difco). .. Also, PCR primers that discriminate between a1 and a2 pheromone receptors ( ) were used to test extracted DNA for mating type with the DNeasy Plant Mini Kit (QIAGEN).

    Concentration Assay:

    Article Title: The Potential of Dark Septate Endophytes to Form Root Symbioses with Ectomycorrhizal and Ericoid Mycorrhizal Middle European Forest Plants
    Article Snippet: DNA was extracted using the DNeasy Plant Mini kit (QIAGEN, Germany) following manufacturer´s instructions. .. Each PCR mix consisted of 16.75 μl ddH2 O, 2.5 μl 10x Taq PCR buffer with KCl (Thermo Scientific, USA), 2 μl MgCl2 (25 mM), 0.5 μl dNTP mixture (2 mM each), 0.5 μl of each primer (10 μM), 1 μl BSA (20 mg/ml; Sigma, USA), 1U Taq DNA polymerase (Thermo Scientific, USA) and 2 μl of diluted DNA template.

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: Plasmid DNA (at the concentration of 1 μg/μL) was coated on the surface of gold particles and bombarded on to the calli. .. For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    Transferring:

    Article Title: Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave, et al. Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave
    Article Snippet: Coral fragments were transferred into sterile ziplock bags and mucus and tissues subsequently air‐blasted using airflow from a sterile pipette tip (1,000 µl filter barrier tips; Neptune, USA) into 5 ml PBS‐EDTA. .. DNA was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions.

    DNA Sequencing:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. The amplification products were separated by agarose gel electrophoresis and purified with High Pure PCR Product Purification Kit (Roche Diagnostics, Basel, Switzerland).

    Sequencing:

    Article Title: Ecological and Morphological Profile of Floating Spherical Cladophora socialis Aggregations in Central Thailand
    Article Snippet: Paragraph title: Molecular sequencing ... Samples were frozen in liquid nitrogen until use and DNA was extracted with a DNeasy Plant Mini Kit (Qiagen Sciences, Germantown, MD, USA) according to the manufacturer’s instructions.

    Article Title: Functional and evolutionary genomic inferences in Populus through genome and population sequencing of American and European aspen
    Article Snippet: P. tremula genome sequencing was performed on DNA extracted from propagated root cuttings of a single wild tree growing on the Umeå University campus (63° 49′17′′N, 20° 18′40′′E). .. All DNA was extracted using a DNeasy Plant Mini Kit (Qiagen).

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. The amplification products were separated by agarose gel electrophoresis and purified with High Pure PCR Product Purification Kit (Roche Diagnostics, Basel, Switzerland).

    Article Title: A Multifunctional and Possible Skin UV Protectant, (3R)-5-Hydroxymellein, Produced by an Endolichenic Fungus Isolated from Parmotrema austrosinense
    Article Snippet: Paragraph title: 4.2. Fungus ITS Sequencing ... The total DNA of ELF was extracted using a DNeasy Plant Mini Kit according to the manufacturer’s protocols (Qiagen, Hilden, Germany).

    Article Title: Deletion of biosynthetic genes, specific SNP patterns and differences in transcript accumulation cause variation in hydroxynitrile glucoside content in barley cultivars
    Article Snippet: Paragraph title: Bioinformatics, sequencing, and sequence alignments ... For DNA extraction and PCR, either the Extract-N-Amp Plant PCR Kit (Merck) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) were used.

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: Paragraph title: DNA isolation, PCR amplification, cloning and sequencing ... Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol.

    Article Title: Degeneration of the Nonrecombining Regions in the Mating-Type Chromosomes of the Anther-Smut Fungi
    Article Snippet: Paragraph title: Genome Sequencing of Additional Microbotryum Species and Mapping against the Reference ... Also, PCR primers that discriminate between a1 and a2 pheromone receptors ( ) were used to test extracted DNA for mating type with the DNeasy Plant Mini Kit (QIAGEN).

    Molecular Weight:

    Article Title: Next generation haplotyping to decipher nuclear genomic interspecific admixture in Citrus species: analysis of chromosome 2
    Article Snippet: One Citrus genus relative (Severinia buxifolia ) was added as an out-group. .. High molecular weight genomic DNA was extracted from leaf samples using the DNeasy Plant Mini Kit (Qiagen S.A.; Madrid, Spain) according to the manufacturer’s instructions. .. The reference citrus whole genome sequence, released in Phytozome [ ] by the International Citrus Genome Consortium (ICGC), was used to select gene fragments in this study.

    DNA Extraction:

    Article Title: Next generation haplotyping to decipher nuclear genomic interspecific admixture in Citrus species: analysis of chromosome 2
    Article Snippet: Paragraph title: DNA extraction ... High molecular weight genomic DNA was extracted from leaf samples using the DNeasy Plant Mini Kit (Qiagen S.A.; Madrid, Spain) according to the manufacturer’s instructions.

    Article Title: Flexible Symbiotic Associations of Symbiodinium With Five Typical Coral Species in Tropical and Subtropical Reef Regions of the Northern South China Sea
    Article Snippet: Paragraph title: DNA Extraction ... Total DNA of each coral sample was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol.

    Article Title: Deletion of biosynthetic genes, specific SNP patterns and differences in transcript accumulation cause variation in hydroxynitrile glucoside content in barley cultivars
    Article Snippet: Genomic DNA was isolated from leaf tissue. .. For DNA extraction and PCR, either the Extract-N-Amp Plant PCR Kit (Merck) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) were used. .. The primer sequences are shown in Supplementary Table , annealing temperatures and amplification strategies used can be found in Supplementary Table .

    Article Title: The Promise of Molecular and Genomic Techniques for Biodiversity Research and DNA Barcoding of the Arabian Peninsula Flora
    Article Snippet: It is also highlighted that the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, specimen drying methods, and the chemical treatment of specimens ( ). .. Thus far, many methods have been developed for the extraction of DNA from herbarium specimens, with the most frequently used being either the traditional CTAB protocol , sometimes with modifications ( ; ; ) or DNA extraction kits such as the DNeasy Plant Mini Kit (Qiagen) ( ). outlined the major challenges of molecular studies using herbarium DNA and emphasized that despite the large number of specimens housed in herbaria worldwide, currently only a small fraction is being used for DNA-based research, mainly due to the poor success and difficulties in obtaining amplifiable DNA. .. The authors proposed that more systematic studies are needed to optimize methods and their efficiency in obtaining good quality DNA from herbarium specimens for the success of a molecular study.

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: The percentage composition of the samples was computed from the GC peak areas using the normalization method. .. Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol. .. The ITS region was amplified by primers ITS-1 (5’GTTTCCGTAGGTGAACCTGC3’) and ITS-4 (5’TCCTCCGCTTATTGATATGC3’).

    Article Title: Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave, et al. Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave
    Article Snippet: Paragraph title: Microbiome sampling and DNA extraction ... DNA was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions.

    Article Title: Accurate authentication of Dendrobium officinale and its closely related species by comparative analysis of complete plastomes
    Article Snippet: Paragraph title: Plant materials and DNA extraction ... Total genomic DNA of each sample was extracted from 2 g fresh leaves using Dneasy Plant Mini Kits (QIAGEN, Germany).

    Article Title: High gene flow in epiphytic ferns despite habitat loss and fragmentation
    Article Snippet: Paragraph title: DNA extraction and AFLP fingerprinting ... 20 mg) with the DNeasy 96 plant mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol.

    Methylation:

    Article Title: Site-specific manipulation of Arabidopsis loci using CRISPR-Cas9 SunTag systems
    Article Snippet: IPP2 transcripts were detected using oligos 5′-GTATGAGTTGCTTCTCCAGCAAAG-3′ and 5′-GAGGATGGCTGCAACAAGTGT-3′. .. To detect differences in methylation using the endonuclease McrBC (NEB), genomic DNA was first extracted using either a CTAB-based method or the DNeasy Plant Mini Kit (Qiagen). .. 100 ng of genomic DNA was then digested for 4 h at 37 °C.

    Mutagenesis:

    Article Title: Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana
    Article Snippet: M2 plants that showed the hy and gl phenotypes were isolated. .. Genomic DNA was purified from the isolated mutant and wild-type plants four weeks after germination using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. The purified DNAs were subjected to HRM analysis using primers specific for the putative mutated genes (HY1, HY2, HY3 , and HY4 for the hy mutants; GL1, GL2 , and TTG1 for the gl mutants; see Additional file ).

    Isolation:

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: The transgenic calli were screened by genomic PCR. .. For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen). .. The presence of CsULT1 was confirmed by genomic PCR using gene specific primer and reverse primer corresponding to GFP.

    Article Title: Deletion of biosynthetic genes, specific SNP patterns and differences in transcript accumulation cause variation in hydroxynitrile glucoside content in barley cultivars
    Article Snippet: Genomic DNA was isolated from leaf tissue. .. For DNA extraction and PCR, either the Extract-N-Amp Plant PCR Kit (Merck) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) were used.

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: The percentage composition of the samples was computed from the GC peak areas using the normalization method. .. Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol. .. The ITS region was amplified by primers ITS-1 (5’GTTTCCGTAGGTGAACCTGC3’) and ITS-4 (5’TCCTCCGCTTATTGATATGC3’).

    Article Title: Temporal and spatial detection of Candidatus Liberibacter asiaticus putative effector transcripts during interaction with Huanglongbing-susceptible, −tolerant, and -resistant citrus hosts
    Article Snippet: Fibrous roots were sampled peripherally from the root mass of each plant, rinsed and stored at − 80 °C for analysis. .. L. asiaticus in citrus leaves, DNA was isolated from midrib of leaves or fibrous roots using DNeasy plant mini kit (Qiagen, Gaithersburg, MD, USA), and the quantity and quality were determined by a NanoDrop Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. For each sample, 100 ng of DNA was used for qPCR of Ca.

    Article Title: Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana
    Article Snippet: M2 plants that showed the hy and gl phenotypes were isolated. .. Genomic DNA was purified from the isolated mutant and wild-type plants four weeks after germination using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. The purified DNAs were subjected to HRM analysis using primers specific for the putative mutated genes (HY1, HY2, HY3 , and HY4 for the hy mutants; GL1, GL2 , and TTG1 for the gl mutants; see Additional file ).

    Article Title: Carnation I locus contains two chalcone isomerase genes involved in orange flower coloration
    Article Snippet: FPKM (fragments per kilobase of transcript per million mapped reads) values were obtained for genes involved in anthocyanin biosynthesis: CHI (Carnation DB gene ID: Dca60978 and Dca60979 (accession no. AF250367)), dihydroflavonol 4-reductase (DFR ) (Dca4324), anthocyanidin synthase (ANS ) (Dca23371), UDP-glucose: anthocyanin 3-glucosyltransferase (3GT ) (Dic3GT1 : accession no. AB191245, 3GT1 : Dca47835 and 3GT2: Dca17573) , glutathione S-transferase (GST ) (DcGSTF2 : AB688111: Dca57804) ( ) ( , ). .. Genomic DNAs and total RNAs were isolated from ‘4-94-1 MR’ and ‘120 MOR’, ‘129 MOR’ and ‘129 MOR-MOR1’ petals at developmental stage 3 using a DNeasy Plant Mini Kit and a RNeasy Plant Mini Kit (Qiagen), respectively. .. First-strand cDNA was synthesized from 1 μg total RNA using oligo(dT)s and PrimeScript reverse transcriptase (Takara Bio).

    Size-exclusion Chromatography:

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol. .. PCR amplification was carried out in a 20 μL reaction containing 5-10 ng of DNA, 0.5 μM of each primer, 200 μM dNTPs 1.5 mM MgCl2 , 1x Taq buffer + (NH4 )2 SO4 – MgCl2 (Invitrogen) and 2 U Taq DNA polymerase (Invitrogen).

    Microscopy:

    Article Title: The Potential of Dark Septate Endophytes to Form Root Symbioses with Ectomycorrhizal and Ericoid Mycorrhizal Middle European Forest Plants
    Article Snippet: The samples were then washed with tap water, Ericaceae and pine roots were separated and the pine roots were observed under a dissecting microscope for presence of the P . sclerotia morphotype. .. DNA was extracted using the DNeasy Plant Mini kit (QIAGEN, Germany) following manufacturer´s instructions.

    Purification:

    Article Title: Ecological and Morphological Profile of Floating Spherical Cladophora socialis Aggregations in Central Thailand
    Article Snippet: Samples were frozen in liquid nitrogen until use and DNA was extracted with a DNeasy Plant Mini Kit (Qiagen Sciences, Germantown, MD, USA) according to the manufacturer’s instructions. .. The isolated DNA was used for PCR amplification of ribosomal RNA genes using the 18S rDNA specific primers SR-1f (5′-TACCTGGTTGATCCTGCCAG-3′) and 18S-C2r (5′-TCCGCAGGTTCACCTACGGAG-3′) [ ] and the 28S rDNA specific primers C1FL (5′-ACCCGCTGAACTTAAGCATATC-3′) and D2FL (5′-GGTCCGTGTTTCAAGACGG-3′) [ ].

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: LC-MS was measured on a 1100 series LC/MSD mass spectrometer (capillary voltage 3.5 kV; corona current 4 μA; capillary exit voltage (fragmentor) 90 V; drying temperature 330 °C; drying flow 9 L/min; nebulizer pressure 50 psig) (Agilent, Santa Clara, CA, USA) with 5C18-MS-II (COSMOSIL; 4.6 mm × 150 mm; 5 μm octadecyl column (Nakarai, Kyoto, Japan)) using gradient system (MeOH/H2 O; 0 min (7:3)—20 min (10:0)—35 min (10:0)—40 min (7:3)—45 min (7:3); 0.5 mL/min) as eluent. .. DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. Polymerase chain reaction was carried out using L5 and L6 primers previously described [ ] and HotStarTaq plus Master Mix (QIAGEN).

    Article Title: A Multifunctional and Possible Skin UV Protectant, (3R)-5-Hydroxymellein, Produced by an Endolichenic Fungus Isolated from Parmotrema austrosinense
    Article Snippet: The total DNA of ELF was extracted using a DNeasy Plant Mini Kit according to the manufacturer’s protocols (Qiagen, Hilden, Germany). .. The total DNA of ELF was extracted using a DNeasy Plant Mini Kit according to the manufacturer’s protocols (Qiagen, Hilden, Germany).

    Article Title: The Potential of Dark Septate Endophytes to Form Root Symbioses with Ectomycorrhizal and Ericoid Mycorrhizal Middle European Forest Plants
    Article Snippet: DNA was extracted using the DNeasy Plant Mini kit (QIAGEN, Germany) following manufacturer´s instructions. .. DNA was extracted using the DNeasy Plant Mini kit (QIAGEN, Germany) following manufacturer´s instructions.

    Article Title: Deletion of biosynthetic genes, specific SNP patterns and differences in transcript accumulation cause variation in hydroxynitrile glucoside content in barley cultivars
    Article Snippet: For DNA extraction and PCR, either the Extract-N-Amp Plant PCR Kit (Merck) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) were used. .. The primer sequences are shown in Supplementary Table , annealing temperatures and amplification strategies used can be found in Supplementary Table .

    Article Title: Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana
    Article Snippet: M2 plants that showed the hy and gl phenotypes were isolated. .. Genomic DNA was purified from the isolated mutant and wild-type plants four weeks after germination using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. The purified DNAs were subjected to HRM analysis using primers specific for the putative mutated genes (HY1, HY2, HY3 , and HY4 for the hy mutants; GL1, GL2 , and TTG1 for the gl mutants; see Additional file ).

    Transgenic Assay:

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: The transgenic calli were screened by genomic PCR. .. For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    Plasmid Preparation:

    Article Title: Ecological and Morphological Profile of Floating Spherical Cladophora socialis Aggregations in Central Thailand
    Article Snippet: Samples were frozen in liquid nitrogen until use and DNA was extracted with a DNeasy Plant Mini Kit (Qiagen Sciences, Germantown, MD, USA) according to the manufacturer’s instructions. .. The isolated DNA was used for PCR amplification of ribosomal RNA genes using the 18S rDNA specific primers SR-1f (5′-TACCTGGTTGATCCTGCCAG-3′) and 18S-C2r (5′-TCCGCAGGTTCACCTACGGAG-3′) [ ] and the 28S rDNA specific primers C1FL (5′-ACCCGCTGAACTTAAGCATATC-3′) and D2FL (5′-GGTCCGTGTTTCAAGACGG-3′) [ ].

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: Paragraph title: Plant expression vector and transformation of Crocus calli ... For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    Software:

    Article Title: Deletion of biosynthetic genes, specific SNP patterns and differences in transcript accumulation cause variation in hydroxynitrile glucoside content in barley cultivars
    Article Snippet: For DNA extraction and PCR, either the Extract-N-Amp Plant PCR Kit (Merck) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and Phusion® High-Fidelity PCR Master Mix with HF Buffer (Thermo Fisher Scientific) were used. .. The purified products were Sanger sequenced by Eurofins (Eurofins Scientific, Ebersberg, Germany) or StarSEQ (StarSEQ GmbH, Mainz, Germany).

    Real-time Polymerase Chain Reaction:

    Article Title: Site-specific manipulation of Arabidopsis loci using CRISPR-Cas9 SunTag systems
    Article Snippet: To detect differences in methylation using the endonuclease McrBC (NEB), genomic DNA was first extracted using either a CTAB-based method or the DNeasy Plant Mini Kit (Qiagen). .. To detect differences in methylation using the endonuclease McrBC (NEB), genomic DNA was first extracted using either a CTAB-based method or the DNeasy Plant Mini Kit (Qiagen).

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen). .. Transgenic and control calli were used for measuring the transcript levels of few carotenoid pathway genes including PSY (GenBank accession: AJ888514), PDS (GenBank accession: AY183118), BCH (GenBank accession: AJ937791).

    Selection:

    Article Title: Identification, cloning and characterization of an ultrapetala transcription factor CsULT1 from Crocus: a novel regulator of apocarotenoid biosynthesis
    Article Snippet: After bombardment, the calli were transferred to fresh media and after five days they were again transferred to media containing hygromycin for selection of transgenic structures. .. For this, genomic DNA was isolated from independent CsULT1 overexpression and empty control calli using the DNeasy Plant mini kit (Qiagen).

    Article Title: Degeneration of the Nonrecombining Regions in the Mating-Type Chromosomes of the Anther-Smut Fungi
    Article Snippet: Also, PCR primers that discriminate between a1 and a2 pheromone receptors ( ) were used to test extracted DNA for mating type with the DNeasy Plant Mini Kit (QIAGEN). .. Sequence libraries for each of the 11 Microbotryum species were assembled individually by mapping against the M. lychnidis-dioicae reference genome using Newbler.

    Agarose Gel Electrophoresis:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. Polymerase chain reaction was carried out using L5 and L6 primers previously described [ ] and HotStarTaq plus Master Mix (QIAGEN).

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol. .. PCR amplification was carried out in a 20 μL reaction containing 5-10 ng of DNA, 0.5 μM of each primer, 200 μM dNTPs 1.5 mM MgCl2 , 1x Taq buffer + (NH4 )2 SO4 – MgCl2 (Invitrogen) and 2 U Taq DNA polymerase (Invitrogen).

    Column Chromatography:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: Open column chromatography (CC) was carried out on silica gel (Wakogel C-200 (Wako, Kyoto, Japan) or silica gel 60 N (Kanto, Tokyo, Japan)). .. DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

    Spectrophotometry:

    Article Title: Flexible Symbiotic Associations of Symbiodinium With Five Typical Coral Species in Tropical and Subtropical Reef Regions of the Northern South China Sea
    Article Snippet: Total DNA of each coral sample was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. .. Total DNA of each coral sample was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol.

    Article Title: Temporal and spatial detection of Candidatus Liberibacter asiaticus putative effector transcripts during interaction with Huanglongbing-susceptible, −tolerant, and -resistant citrus hosts
    Article Snippet: Fibrous roots were sampled peripherally from the root mass of each plant, rinsed and stored at − 80 °C for analysis. .. L. asiaticus in citrus leaves, DNA was isolated from midrib of leaves or fibrous roots using DNeasy plant mini kit (Qiagen, Gaithersburg, MD, USA), and the quantity and quality were determined by a NanoDrop Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. For each sample, 100 ng of DNA was used for qPCR of Ca.

    Article Title: Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave, et al. Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave
    Article Snippet: DNA was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. .. Mock samples (i.e., empty) were used for DNA extraction to account for kit contaminants (Pogoreutz et al., ; Salter et al. ).

    Sampling:

    Article Title: Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave, et al. Coral microbiome diversity reflects mass coral bleaching susceptibility during the 2016 El Niño heat wave
    Article Snippet: Paragraph title: Microbiome sampling and DNA extraction ... DNA was extracted using the Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions.

    Activation Assay:

    Article Title: Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana
    Article Snippet: Genomic DNA was purified from the isolated mutant and wild-type plants four weeks after germination using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). .. HRM analysis was performed on a LightCycler 480s (Roche Diagnostics, Penzberg, Germany) in a reaction mixture that contained 10 ng wild-type DNA, 10 ng mutant DNA, 0.5 mM of each primer, and 3 mM MgCl2 in the LightCycler 480 High Resolution Melting Master containing ResoLight dye (Roche Diagnostics) adjusted to a total volume of 10 μl with PCR-grade water.

    Thin Layer Chromatography:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: Kieselgel 60 F254, 0.2 mm thickness (Merck, Darmstadt, Germany) was used for analytic TLC, with either Ehrlich’s reagent (p -dimethylaminobenzaldehyde and HCl) [ , ] or p -anisaldehyde/AcOH/H2 SO4 as visualizing agents. .. DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

    Liquid Chromatography with Mass Spectroscopy:

    Article Title: Terpenoids and Phenylpropanoids in Ligularia duciformis, L. kongkalingensis, L. nelumbifolia, and L. limprichtii
    Article Snippet: LC-MS was measured on a 1100 series LC/MSD mass spectrometer (capillary voltage 3.5 kV; corona current 4 μA; capillary exit voltage (fragmentor) 90 V; drying temperature 330 °C; drying flow 9 L/min; nebulizer pressure 50 psig) (Agilent, Santa Clara, CA, USA) with 5C18-MS-II (COSMOSIL; 4.6 mm × 150 mm; 5 μm octadecyl column (Nakarai, Kyoto, Japan)) using gradient system (MeOH/H2 O; 0 min (7:3)—20 min (10:0)—35 min (10:0)—40 min (7:3)—45 min (7:3); 0.5 mL/min) as eluent. .. DNA was purified from dried leaves using DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany).

    Marker:

    Article Title: QTLs maintaining grain fertility under salt stress detected by exome QTL-seq and interval mapping in barley
    Article Snippet: Paragraph title: DNA marker analysis and QTL mapping ... Total DNA was extracted from each RIL (96 lines) using a DNeasy Plant Mini Kit (Qiagen).

    Gel Extraction:

    Article Title: Essential Oil Composition and Internal Transcribed Spacer (ITS) Sequence Variability of Four South-Croatian Satureja Species (Lamiaceae)
    Article Snippet: Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol. .. Since the DNA obtained by standard methods for plant genomic DNA isolation based on CTAB buffer gave no PCR amplification, we isolated DNA using DNeasy Plant Mini Kit (Quiagen) followed by an additional step of purifying with phenol:chlorophorm:isoamylalcohol (25:24:1) and DNA precipitation with isopropanol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen dna extraction kit
    Electropherograms of PCR products amplified using 12 representative <t>DNA</t> samples species extracted using our <t>KCl</t> method, and the commercial kit. Comparison of DNA samples extracted with our KCl method (on left) and commercial kit (on right). PCR amplifications were as follows: A, large subunit RNA (LSU) region; B, small subunit RNA (SSU) region; and C, internal transcribed spacer (ITS) specific fungal and algal primer region; upper and lower gel sections show fungi and algae, respectively. Asterisks: Five amplified PCR products generated by our KCl method were selected for sequencing fungal and algal ITS regions. These sequences were registered in GenBank. Representative lichen species: 007293, Flavoparmelia carperata ; 007742, Heterodermia diadermata ; 000978, Heterodermia hypoleuca ; 009659, Lobaria discolor ; 008278, Lobaria retigera ; 001899, Peltigera praetextata ; 011648, Myelochroa entotheiochroa ; 011592, Myelochroa irrugans ; 016180, Parmotrema tinctorum ; 010394, Peltigera polydactylon ; 007637, Punctelia subflava ; 007349, Umbilicaria esculenta .
    Dna Extraction Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2056 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna extraction kit/product/Qiagen
    Average 99 stars, based on 2056 article reviews
    Price from $9.99 to $1999.99
    dna extraction kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Electropherograms of PCR products amplified using 12 representative DNA samples species extracted using our KCl method, and the commercial kit. Comparison of DNA samples extracted with our KCl method (on left) and commercial kit (on right). PCR amplifications were as follows: A, large subunit RNA (LSU) region; B, small subunit RNA (SSU) region; and C, internal transcribed spacer (ITS) specific fungal and algal primer region; upper and lower gel sections show fungi and algae, respectively. Asterisks: Five amplified PCR products generated by our KCl method were selected for sequencing fungal and algal ITS regions. These sequences were registered in GenBank. Representative lichen species: 007293, Flavoparmelia carperata ; 007742, Heterodermia diadermata ; 000978, Heterodermia hypoleuca ; 009659, Lobaria discolor ; 008278, Lobaria retigera ; 001899, Peltigera praetextata ; 011648, Myelochroa entotheiochroa ; 011592, Myelochroa irrugans ; 016180, Parmotrema tinctorum ; 010394, Peltigera polydactylon ; 007637, Punctelia subflava ; 007349, Umbilicaria esculenta .

    Journal: Mycobiology

    Article Title: An Easy, Rapid, and Cost-Effective Method for DNA Extraction from Various Lichen Taxa and Specimens Suitable for Analysis of Fungal and Algal Strains

    doi: 10.5941/MYCO.2014.42.4.311

    Figure Lengend Snippet: Electropherograms of PCR products amplified using 12 representative DNA samples species extracted using our KCl method, and the commercial kit. Comparison of DNA samples extracted with our KCl method (on left) and commercial kit (on right). PCR amplifications were as follows: A, large subunit RNA (LSU) region; B, small subunit RNA (SSU) region; and C, internal transcribed spacer (ITS) specific fungal and algal primer region; upper and lower gel sections show fungi and algae, respectively. Asterisks: Five amplified PCR products generated by our KCl method were selected for sequencing fungal and algal ITS regions. These sequences were registered in GenBank. Representative lichen species: 007293, Flavoparmelia carperata ; 007742, Heterodermia diadermata ; 000978, Heterodermia hypoleuca ; 009659, Lobaria discolor ; 008278, Lobaria retigera ; 001899, Peltigera praetextata ; 011648, Myelochroa entotheiochroa ; 011592, Myelochroa irrugans ; 016180, Parmotrema tinctorum ; 010394, Peltigera polydactylon ; 007637, Punctelia subflava ; 007349, Umbilicaria esculenta .

    Article Snippet: Twelve lichen species were selected as representatives to compare DNA yield and quality between the KCl method we developed for lichens, and a general commercial DNA extraction kit (DNeasy Plant Mini Kit; Qiagen, Valencia, CA, USA).

    Techniques: Polymerase Chain Reaction, Amplification, Generated, Sequencing

    PCR product electropherograms of the full-length internal transcribed spacer regions and 26S rRNA ( > 1.0 kb) amplified from representative 26 DNA samples derived from taxa at different taxonomic levels (i.e., genus to subspecies) extracted with our KCl method.

    Journal: Mycobiology

    Article Title: An Easy, Rapid, and Cost-Effective Method for DNA Extraction from Various Lichen Taxa and Specimens Suitable for Analysis of Fungal and Algal Strains

    doi: 10.5941/MYCO.2014.42.4.311

    Figure Lengend Snippet: PCR product electropherograms of the full-length internal transcribed spacer regions and 26S rRNA ( > 1.0 kb) amplified from representative 26 DNA samples derived from taxa at different taxonomic levels (i.e., genus to subspecies) extracted with our KCl method.

    Article Snippet: Twelve lichen species were selected as representatives to compare DNA yield and quality between the KCl method we developed for lichens, and a general commercial DNA extraction kit (DNeasy Plant Mini Kit; Qiagen, Valencia, CA, USA).

    Techniques: Polymerase Chain Reaction, Amplification, Derivative Assay

    The efficiency of filter paper for purification of nucleic acids from various sources using respective Qiagen kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen RNeasy plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.

    Journal: PLoS ONE

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification

    doi: 10.1371/journal.pone.0203011

    Figure Lengend Snippet: The efficiency of filter paper for purification of nucleic acids from various sources using respective Qiagen kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen RNeasy plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.

    Article Snippet: Plant genomic DNAs were purified using filter paper-based spin columns following the modified protocol of the Qiagen DNeasy Plant mini kit (Qiagen DNeasy plant handbook, March 2018 version) or an in-house protocol using homemade buffers described by Lemke et al [ ].

    Techniques: Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Gel Extraction, Plasmid Preparation

    Evaluation of purification of tobacco genomic DNA and total RNA using filter paper-based spin columns with respective Qiagen kit buffers and homemade buffers. (A) Agarose gel electrophoresis for 2.5 μl tobacco genomic DNAs elution from purification experiments using Qiagen DNeasy plant mini kit buffers with Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and filter paper-based homemade spin column (Lane Q/H*), followed by tobacco genomic DNAs purified using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (B) UV spectrum curve of tobacco DNAs purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin columns with Qiagen kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve) from the same amount leaf tissue. Y-axis is UV absorbance, and X-axis is wavelength (nM). (C) Amplification plots for three duplicated qPCR reactions contain 20 ng DNA purified using Qiagen kit (Q/Q, Blue curves) or DNA purified from filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. The x-axis is PCR cycle numbers, Y-axis is the level of SYBR fluorescence, and the green line is an arbitrary threshold to determine the Cq value (the fractional cycle number at which amplification curve meet threshold level). (D) MOPS-formaldehyde denaturing agarose gel electrophoresis separated 5 μl RNA purified using Qiagen RNeasy plant mini kit buffers with a Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and homemade filter paper-based spin column (Lane Q/H*), followed total tobacco RNAs purified by using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (E) UV spectrum of tobacco total RNA purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin column with Qiagen RNeasy plant mini kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve). Y-axis is UV absorbance, and the X-axis is wavelength. (F) Amplification plots of three duplicated qRT-PCR reactions for 2.5 ng RNA purified using Qiagen kit (Q/Q, Blue curves) or RNA purified using filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. Note: * The starting material amount is 100 mg tobacco leaf tissue for experiments using a Qiagen spin column or filter paper recharged spin column, and half amount of plant sample (50 mg) used for homemade spin column purification. All DNAs or RNAs were eluted using 100 ul elution solution.

    Journal: PLoS ONE

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification

    doi: 10.1371/journal.pone.0203011

    Figure Lengend Snippet: Evaluation of purification of tobacco genomic DNA and total RNA using filter paper-based spin columns with respective Qiagen kit buffers and homemade buffers. (A) Agarose gel electrophoresis for 2.5 μl tobacco genomic DNAs elution from purification experiments using Qiagen DNeasy plant mini kit buffers with Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and filter paper-based homemade spin column (Lane Q/H*), followed by tobacco genomic DNAs purified using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (B) UV spectrum curve of tobacco DNAs purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin columns with Qiagen kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve) from the same amount leaf tissue. Y-axis is UV absorbance, and X-axis is wavelength (nM). (C) Amplification plots for three duplicated qPCR reactions contain 20 ng DNA purified using Qiagen kit (Q/Q, Blue curves) or DNA purified from filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. The x-axis is PCR cycle numbers, Y-axis is the level of SYBR fluorescence, and the green line is an arbitrary threshold to determine the Cq value (the fractional cycle number at which amplification curve meet threshold level). (D) MOPS-formaldehyde denaturing agarose gel electrophoresis separated 5 μl RNA purified using Qiagen RNeasy plant mini kit buffers with a Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and homemade filter paper-based spin column (Lane Q/H*), followed total tobacco RNAs purified by using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (E) UV spectrum of tobacco total RNA purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin column with Qiagen RNeasy plant mini kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve). Y-axis is UV absorbance, and the X-axis is wavelength. (F) Amplification plots of three duplicated qRT-PCR reactions for 2.5 ng RNA purified using Qiagen kit (Q/Q, Blue curves) or RNA purified using filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. Note: * The starting material amount is 100 mg tobacco leaf tissue for experiments using a Qiagen spin column or filter paper recharged spin column, and half amount of plant sample (50 mg) used for homemade spin column purification. All DNAs or RNAs were eluted using 100 ul elution solution.

    Article Snippet: Plant genomic DNAs were purified using filter paper-based spin columns following the modified protocol of the Qiagen DNeasy Plant mini kit (Qiagen DNeasy plant handbook, March 2018 version) or an in-house protocol using homemade buffers described by Lemke et al [ ].

    Techniques: Purification, Agarose Gel Electrophoresis, Amplification, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Fluorescence, Quantitative RT-PCR

    (A) DNA yields (ng/μL) obtained via PMC isolation plotted against those obtained via DNeasy isolation. Each point represents the mean yields via PMC vs. DNeasy for an individual species. Error bars indicate standard errors associated with replicate isolations via PMC (vertical bars) and DNeasy (horizontal bars). Solid line indicates linear regression between PMC and DNeasy DNA yields; dashed line indicates line y = x. (B) DNA yields via PMC isolation vs. CTAB isolation. Points, error bars, and solid and dashed lines are as in part A, but representing yields via PMC vs. CTAB.

    Journal: Applications in Plant Sciences

    Article Title: Paramagnetic cellulose DNA isolation improves DNA yield and quality among diverse plant taxa

    doi: 10.3732/apps.1400048

    Figure Lengend Snippet: (A) DNA yields (ng/μL) obtained via PMC isolation plotted against those obtained via DNeasy isolation. Each point represents the mean yields via PMC vs. DNeasy for an individual species. Error bars indicate standard errors associated with replicate isolations via PMC (vertical bars) and DNeasy (horizontal bars). Solid line indicates linear regression between PMC and DNeasy DNA yields; dashed line indicates line y = x. (B) DNA yields via PMC isolation vs. CTAB isolation. Points, error bars, and solid and dashed lines are as in part A, but representing yields via PMC vs. CTAB.

    Article Snippet: We compared the DNA yield and purity across a wide range of flowering plants among PMC, the silica-based DNeasy Plant Mini kit (QIAGEN, Dusseldorf, Germany), and a CTAB-based method (adapted from ).

    Techniques: Isolation

    Mean ± SE of yields of amplifiable DNA based on qPCR of matched DNA extractions obtained using PMC, DNeasy, and CTAB protocols. Species are indicated by four-letter codes determined by the first two letters of the generic name and specific epithet, respectively (refer to Table 1 ). Each protocol is marked with letters (a, b, c) indicating statistically significant differences in amplifiable yield under repeated-measures ANOVA with Holm-Bonferroni post hoc tests (see Table 2 ).

    Journal: Applications in Plant Sciences

    Article Title: Paramagnetic cellulose DNA isolation improves DNA yield and quality among diverse plant taxa

    doi: 10.3732/apps.1400048

    Figure Lengend Snippet: Mean ± SE of yields of amplifiable DNA based on qPCR of matched DNA extractions obtained using PMC, DNeasy, and CTAB protocols. Species are indicated by four-letter codes determined by the first two letters of the generic name and specific epithet, respectively (refer to Table 1 ). Each protocol is marked with letters (a, b, c) indicating statistically significant differences in amplifiable yield under repeated-measures ANOVA with Holm-Bonferroni post hoc tests (see Table 2 ).

    Article Snippet: We compared the DNA yield and purity across a wide range of flowering plants among PMC, the silica-based DNeasy Plant Mini kit (QIAGEN, Dusseldorf, Germany), and a CTAB-based method (adapted from ).

    Techniques: Real-time Polymerase Chain Reaction

    Schematic design of the methods adapted to extract genomic DNA from light or dark-adapted pin oak ( Q. palustris ) leaves or leaves of other species rich in polysaccharides and secondary metabolites: ( a ) M1, using CTAB (based on Qiagen DNeasy Plant DNA extraction kit) and ( b ) M2, using phenol (based on MoBio Power Plant DNA extraction kit) for contaminant removal. Red box framing indicates steps specifically modified within this work, differing from kit manufacturer recommendations.

    Journal: Plants

    Article Title: In Situ Dark Adaptation Enhances the Efficiency of DNA Extraction from Mature Pin Oak (Quercus palustris) Leaves, Facilitating the Identification of Partial Sequences of the 18S rRNA and Isoprene Synthase (IspS) Genes

    doi: 10.3390/plants6040052

    Figure Lengend Snippet: Schematic design of the methods adapted to extract genomic DNA from light or dark-adapted pin oak ( Q. palustris ) leaves or leaves of other species rich in polysaccharides and secondary metabolites: ( a ) M1, using CTAB (based on Qiagen DNeasy Plant DNA extraction kit) and ( b ) M2, using phenol (based on MoBio Power Plant DNA extraction kit) for contaminant removal. Red box framing indicates steps specifically modified within this work, differing from kit manufacturer recommendations.

    Article Snippet: The homogenates were further processed using modified steps from the standard protocols developed for the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and MoBio Power Plant Kit (MoBio, Carlsbad, CA, USA), as specified: Method # 1 (M1)—modified method based on the Qiagen DNeasy Plant Mini Kit: following sample disruption using the Mini-Beadbeater-24, samples were incubated at 75 °C for 10 min, instead of 65 °C as recommended by the manufacturer, mixing the sample thoroughly every 2 min using a vortex.

    Techniques: DNA Extraction, Modification