5x q5 buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs 5x q5 buffer
    5x Q5 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x q5 buffer/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x q5 buffer - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: mRNA structural elements immediately upstream of the start codon dictate dependence upon eIF4A helicase activity
    Article Snippet: Paragraph title: PCR ... Reactions were set up with 5 μl 5X Q5 buffer, 5 μl GC rich enhancer buffer, 0.5 μl dNTPs (10 mM each), 0.25 μl Q5 Hot Start High-Fidelity DNA Polymerase (2000 U/ml) (NEB M0493 L), 1 μl Truseq forward primer: 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGAACAGCGACTAGGCTCTTCA3′ (10 μM), 1 μl relevant Truseq reverse primer: 5′CAAGCAGAAGACGGCATACGAGAT BARCODE Reactions were activated at 98 °C for 30 s followed by cycling between 98 °C for 10 s and 72 °C for 45 s. It was determined that 17 cycles was optimal, as this was the first cycle where the product was visible on the gel.

    Purification:

    Article Title: mRNA structural elements immediately upstream of the start codon dictate dependence upon eIF4A helicase activity
    Article Snippet: Reactions were set up with 5 μl 5X Q5 buffer, 5 μl GC rich enhancer buffer, 0.5 μl dNTPs (10 mM each), 0.25 μl Q5 Hot Start High-Fidelity DNA Polymerase (2000 U/ml) (NEB M0493 L), 1 μl Truseq forward primer: 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGAACAGCGACTAGGCTCTTCA3′ (10 μM), 1 μl relevant Truseq reverse primer: 5′CAAGCAGAAGACGGCATACGAGAT BARCODE Reactions were activated at 98 °C for 30 s followed by cycling between 98 °C for 10 s and 72 °C for 45 s. It was determined that 17 cycles was optimal, as this was the first cycle where the product was visible on the gel. .. The remaining samples were amplified in 3 × 25 μl reactions as above, for 17 cycles plus a final extension time of 5 min at 72 °C, and then combined and gel purified on a 5% polyacrylamide, 1.5-mm-thick denaturing gel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs 5x q5 reaction buffer
    5x Q5 Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x q5 reaction buffer/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    5x q5 reaction buffer - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs 5x q5 buffer
    5x Q5 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x q5 buffer/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x q5 buffer - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    94
    New England Biolabs 5ul 5x q5 buffer
    5ul 5x Q5 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5ul 5x q5 buffer/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5ul 5x q5 buffer - by Bioz Stars, 2020-03
    94/100 stars
      Buy from Supplier

    Image Search Results