5x phusion dna polymerase buffer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Phusion HF Buffer Pack
    Description:
    Two optimized buffers are available for Thermo Scientific Phusion High Fidelity DNA Polymerases • 5X Phusion HF Buffer F 518L F 538L Phusion Green F 520L Detergent free • 5X Phusion GC Buffer F 519L F 539L Phusion Green F 521L Detergent free The error rate of Phusion DNA Polymerase in HF Buffer 4 4 × 10 7 is lower than that in GC Buffer 9 5 × 10 7 Therefore the HF Buffer should be used as the default buffer for high fidelity amplification However GC Buffer can improve the performance of Phusion DNA Polymerase on some difficult or long templates such as GC rich templates or those with complex secondary structures For applications such as microarray or DHPLC where the DNA templates need to be free of detergents we recommend using detergent free reaction buffers 5X Phusion Green Buffers include a density reagent and two tracking dyes for direct loading of PCR products on a gel The colored buffers do not interfere with the enzyme performance and are compatible with downstream applications such as DNA sequencing ligation and restriction digestion Related ProductsPhusion HF Buffer Pack detergent freePhusion GC Buffer PackPhusion GC Buffer Pack detergent freePhusion Green GC Buffer PackPhusion Green HF Buffer Pack
    Catalog Number:
    f518l
    Price:
    None
    Applications:
    High Fidelity PCR|PCR|PCR & Real-Time PCR
    Category:
    Lab Reagents and Chemicals
    Buy from Supplier


    Structured Review

    Thermo Fisher 5x phusion dna polymerase buffer
    Two optimized buffers are available for Thermo Scientific Phusion High Fidelity DNA Polymerases • 5X Phusion HF Buffer F 518L F 538L Phusion Green F 520L Detergent free • 5X Phusion GC Buffer F 519L F 539L Phusion Green F 521L Detergent free The error rate of Phusion DNA Polymerase in HF Buffer 4 4 × 10 7 is lower than that in GC Buffer 9 5 × 10 7 Therefore the HF Buffer should be used as the default buffer for high fidelity amplification However GC Buffer can improve the performance of Phusion DNA Polymerase on some difficult or long templates such as GC rich templates or those with complex secondary structures For applications such as microarray or DHPLC where the DNA templates need to be free of detergents we recommend using detergent free reaction buffers 5X Phusion Green Buffers include a density reagent and two tracking dyes for direct loading of PCR products on a gel The colored buffers do not interfere with the enzyme performance and are compatible with downstream applications such as DNA sequencing ligation and restriction digestion Related ProductsPhusion HF Buffer Pack detergent freePhusion GC Buffer PackPhusion GC Buffer Pack detergent freePhusion Green GC Buffer PackPhusion Green HF Buffer Pack
    https://www.bioz.com/result/5x phusion dna polymerase buffer/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5x phusion dna polymerase buffer - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    pcr amplifications

    Images

    Related Articles

    Clone Assay:

    Article Title: Modular 5′-UTR hexamers for context-independent tuning of protein expression in eukaryotes
    Article Snippet: Plasmid and strain construction Yeast integrative plasmids were created by USER cloning ( ) and propagated in E. coli DH5a. .. Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs).

    Article Title: The fester locus in Botryllus schlosseri experiences selection
    Article Snippet: Cycling conditions were 39x (95C for 30 sec, 55C for 30 sec, 72C for 1 min 30 sec), 72C for 5 min. PCR amplification was performed in a 20-μl total reaction volume with 13.6μl of H20, 4μl of 5x HF Buffer (Finnzymes), 0.2 mM dNTPs, 0.6 μl of 100% DMSO, 0.3333 μM of each primer, 0.02U/μl of Phusion Polymerase (Finnzymes) and 2 μl of template DNA. .. PCR products were cloned using the pGEM®-T kit and at least 12 clones per colony were sequenced in order to find alleles from all allele types: many colonies have more than 1 allele type.

    Centrifugation:

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: 250 µl supernatant after centrifugation was taken for the Maxwell 16 Tissue LEV Total RNA Purification Kit, and the DNA was eluted in 50 µl DNAse-free water. .. The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA.

    Amplification:

    Article Title: Engineering a branching sucrase for flavonoid glucoside diversification
    Article Snippet: Inverse PCR amplifications were carried out using the high fidelity Phusion DNA polymerase (Thermo Scientific) according to the following protocol: Template DNA, 0.12 ng.µL−1 ; forward and reverse primers, 200 nM; dNTP, 200 µM each; Phusion DNA polymerase, 0.02 U/µL; in 50 µL of HF Buffer 1× (thermo Scientific). .. Amplified DNA was digested by DpnI endonuclease (20 U, 37 °C, 2 h) to eliminate the methylated parental template and loaded on a 0,8% agarose, Tris-acetate, EDTA (tris-base, 24,2 g.L−1 ; acetic acid, 5,7%; EDTA, 50 mM) gel for separation.

    Article Title: Modular 5′-UTR hexamers for context-independent tuning of protein expression in eukaryotes
    Article Snippet: .. Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs). .. Oligos, duplex oligos and gBlocks were purchased from Integrated DNA Technologies (IDT).

    Article Title: Artifactual mutations resulting from DNA lesions limit detection levels in ultrasensitive sequencing applications
    Article Snippet: .. Single-molecule PCR For single-molecule PCR (smPCR) of HSI_insert constructs, PCR was performed with the ‘SMA Inserts’ primers ( Supplementary Table S1 ) in 20 µL reactions containing vector-insert construct DNA (diluted to 0.2 molecules per reaction that rendered on average ∼20% smPCR reactions with an amplification product), 0.33 ng E. coli DNA, 0.25 µM of the appropriate forward and reverse primer, 0.16 mM dNTPs, 0.5× EvaGreen (Jena Bioscience), 1× Phusion HF Buffer (ThermoFisher Scientific) and 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase. .. The reactions were carried out with an initial heating step of 94 °C for 2 min, followed by 55 cycles at 94 °C for 15 s, 65 °C for 15 s, and 72 °C for 20 s. Given that none of the steps during the HSI_insert construction were 100% efficient, we used several control passes to ensure that we are analyzing the HSI_insert construct: (1) we placed our primers such that only an insert ligated within the vector was amplified during smPCR, and (2) amplifiable vectors without the synthetic insert (present at ∼10% as circular vectors with the original sequence) were distinguished by a dinucleotide unique to the insert identified by genotyping before sequencing ( Supplementary Methods ).

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: Twenty nanograms of DNA were used for the amplification of the 16S rRNA gene with primers 27F-DegS and 338R I + 338R II for 25 cycles as described before , only primers had a Universal Tag (UniTag) linkers attached; UniTag I (forward) and II (reverses) (I—GAGCCGTAGCCAGTCTGC; II—GCCGTGACCGTGACATCG). .. The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA.

    Article Title: Bacterial communities on classroom surfaces vary with human contact
    Article Snippet: All extracted samples were amplified in triplicate for PCR1 and triplicates were pooled before PCR2. .. PCR1 (25 μL total volume per reaction) consisted of the following steps: 5 μL 5× HF buffer (Thermo Fisher Scientific, Waltham, MA, USA), 0.5 μL deoxyribonucleotide triphosphates (10 mM, Invitrogen, Life Technologies, Grand Island, NY, USA), 0.25 μL Phusion Hotstart II polymerase (0.5 units; Thermo Fisher Scientific), 13.25 μL certified nucleic-acid free water, 0.5 μL (10 μM) forward primer, 0.5 μL (10 μM) reverse primer, and 5 μL template DNA.

    Article Title: Analysis of transcript and protein overlap in a human osteosarcoma cell line
    Article Snippet: .. An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes). .. 23 μl amplification master mix and 2 μl beads were mixed denatured at 95°C for 30 seconds and cycled as follows: 30 seconds at 95°C, 30 seconds at 55°C, 30 seconds at 72°C for 16 cycles.

    Article Title: Biology and clinical implications of the 19q13 aggressive prostate cancer susceptibility locus
    Article Snippet: The rs11672691 centered fragment 235 bp was amplified by primers (F: CCAGCGATTAAGGGTCTCGT1, R: TCCCATAAAATGGCCACGCTC). .. The 2 x Phusion Master Mix with HF Buffer (F531, Thermo) were applied for PCR reactions.

    Article Title: Variation in the OC Locus of Acinetobacter baumannii Genomes Predicts Extensive Structural Diversity in the Lipooligosaccharide
    Article Snippet: Primers (Integrated DNA Technologies Inc., San Diego), their targets, and expected amplicon sizes are listed in . .. Thermocycling conditions were as follows: 94°C for 3 min (initial denaturation cycle), followed by 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 60 s to 3 min, then a final cycle of 72°C for 5 min. For long-range PCR, the reaction mix (20 µL) included 4 µL of HF buffer (Finnzymes, Thermo Fisher Scientific, Australia), 1 µmol of each primer, 200 µM of each deoxynucleoside triphosphate, 40 ng of template DNA and 1 unit of Phusion polymerase (Finnzymes, Thermo Fisher Scientific, Australia).

    Article Title: A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library
    Article Snippet: Paragraph title: PCR amplification conditions ... Briefly, the PCR mix (total volume, 15ul) consisted of limiting DNA template (approximately 2,500 copies in 5 ul), 1x HF buffer (Thermo Scientific), 200uM dNTP (NEB), 400nM of each barcoded primer and 0.3U of Phusion DNA polymerase (Thermo Scientific).

    Article Title: The fester locus in Botryllus schlosseri experiences selection
    Article Snippet: .. Cycling conditions were 39x (95C for 30 sec, 55C for 30 sec, 72C for 1 min 30 sec), 72C for 5 min. PCR amplification was performed in a 20-μl total reaction volume with 13.6μl of H20, 4μl of 5x HF Buffer (Finnzymes), 0.2 mM dNTPs, 0.6 μl of 100% DMSO, 0.3333 μM of each primer, 0.02U/μl of Phusion Polymerase (Finnzymes) and 2 μl of template DNA. .. PCR products were cloned using the pGEM®-T kit and at least 12 clones per colony were sequenced in order to find alleles from all allele types: many colonies have more than 1 allele type.

    Article Title: Fifteen to Twenty Percent of HIV Substitution Mutations Are Associated with Recombination
    Article Snippet: With amplicon generation for next-generation sequencing, PCR conditions were optimized to reduce the formation of artificial recombinants by using a method outlined by Smyth et al. ( ). .. PCR mixtures were titrated to contain 2,500 copies of template DNA, 1× HF buffer (Finnzymes), 200 μM deoxynucleoside triphosphate (dNTP), 1 μM each primer, and 0.3 U of Phusion DNA polymerase (Finnzymes) in a 15-μl total reaction mixture volume.

    Construct:

    Article Title: Artifactual mutations resulting from DNA lesions limit detection levels in ultrasensitive sequencing applications
    Article Snippet: .. Single-molecule PCR For single-molecule PCR (smPCR) of HSI_insert constructs, PCR was performed with the ‘SMA Inserts’ primers ( Supplementary Table S1 ) in 20 µL reactions containing vector-insert construct DNA (diluted to 0.2 molecules per reaction that rendered on average ∼20% smPCR reactions with an amplification product), 0.33 ng E. coli DNA, 0.25 µM of the appropriate forward and reverse primer, 0.16 mM dNTPs, 0.5× EvaGreen (Jena Bioscience), 1× Phusion HF Buffer (ThermoFisher Scientific) and 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase. .. The reactions were carried out with an initial heating step of 94 °C for 2 min, followed by 55 cycles at 94 °C for 15 s, 65 °C for 15 s, and 72 °C for 20 s. Given that none of the steps during the HSI_insert construction were 100% efficient, we used several control passes to ensure that we are analyzing the HSI_insert construct: (1) we placed our primers such that only an insert ligated within the vector was amplified during smPCR, and (2) amplifiable vectors without the synthetic insert (present at ∼10% as circular vectors with the original sequence) were distinguished by a dinucleotide unique to the insert identified by genotyping before sequencing ( Supplementary Methods ).

    Real-time Polymerase Chain Reaction:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL. .. A subset of samples was run on a real-time PCR instrument (Bio-Rad MiniOpticon) to estimate the required number of cycles; the remaining samples were run without real-time monitoring (Bio-Rad DNA Engine Tetrad 2).

    Article Title: A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library
    Article Snippet: Briefly, the PCR mix (total volume, 15ul) consisted of limiting DNA template (approximately 2,500 copies in 5 ul), 1x HF buffer (Thermo Scientific), 200uM dNTP (NEB), 400nM of each barcoded primer and 0.3U of Phusion DNA polymerase (Thermo Scientific). .. Additionally, to enable monitoring of the reaction using qPCR, duplicates were included containing 0.5x SYBR Green 1 (Life Technologies).

    Incubation:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: For the probe hybridization phase, these mixtures were incubated in a thermocycler (Bio-Rad) with a heated lid at 98°C for 3 min, 85°C for 30 min, 60°C for 60 min, and 56°C for 120 min. For the gap-fill and ligation phase, we added 300 picomoles each dNTPs (NEB), 7.5 micromoles betaine (Sigma), 20 nanomoles NAD+ (NEB), 1 μL of 10× Ampligase buffer, 5 units of Ampligase DNA ligase (Epicentre), 3.2 units of Phusion DNA polymerase (NEB), and molecular biology grade water to 10 mL for a total reaction volume of 20 μL. .. For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL.

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: .. The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL. ..

    Article Title: Analysis of transcript and protein overlap in a human osteosarcoma cell line
    Article Snippet: The reaction was incubated for 16 hours on a RotaMix at room temperature. .. An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes).

    Article Title: The fester locus in Botryllus schlosseri experiences selection
    Article Snippet: Cycling conditions were 39x (95C for 30 sec, 55C for 30 sec, 72C for 1 min 30 sec), 72C for 5 min. PCR amplification was performed in a 20-μl total reaction volume with 13.6μl of H20, 4μl of 5x HF Buffer (Finnzymes), 0.2 mM dNTPs, 0.6 μl of 100% DMSO, 0.3333 μM of each primer, 0.02U/μl of Phusion Polymerase (Finnzymes) and 2 μl of template DNA. .. Colony PCR products were incubated with 0.25μl each of Exonuclease I and Shrimp Antarctic Phosphatase at 37°C for 30 min, followed by 90°C for 10 min prior to sequencing.

    In Silico:

    Article Title: Bacterial communities on classroom surfaces vary with human contact
    Article Snippet: The remaining ends of the Illumina adapters were attached during PCR2, and barcodes were recombined in silico using paired-end reads. .. PCR1 (25 μL total volume per reaction) consisted of the following steps: 5 μL 5× HF buffer (Thermo Fisher Scientific, Waltham, MA, USA), 0.5 μL deoxyribonucleotide triphosphates (10 mM, Invitrogen, Life Technologies, Grand Island, NY, USA), 0.25 μL Phusion Hotstart II polymerase (0.5 units; Thermo Fisher Scientific), 13.25 μL certified nucleic-acid free water, 0.5 μL (10 μM) forward primer, 0.5 μL (10 μM) reverse primer, and 5 μL template DNA.

    Modification:

    Article Title: A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library
    Article Snippet: PCR amplification conditions Modified PCR cycling conditions were used as described previously [ ] to reduce chimera formation during PCR amplification. .. Briefly, the PCR mix (total volume, 15ul) consisted of limiting DNA template (approximately 2,500 copies in 5 ul), 1x HF buffer (Thermo Scientific), 200uM dNTP (NEB), 400nM of each barcoded primer and 0.3U of Phusion DNA polymerase (Thermo Scientific).

    Transformation Assay:

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL. .. After PCR, the methylated template DNA was degraded by digestion with 10 U of DpnI at 37°C for at least 3 h. The remaining PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Vienna, Austria) and 5 μL of each purified PCR product were transformed into electro-competent E. coli TOP10 F′ cells.

    Article Title: Modular 5′-UTR hexamers for context-independent tuning of protein expression in eukaryotes
    Article Snippet: .. Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs). .. Oligos, duplex oligos and gBlocks were purchased from Integrated DNA Technologies (IDT).

    Article Title: The fester locus in Botryllus schlosseri experiences selection
    Article Snippet: Cycling conditions were 39x (95C for 30 sec, 55C for 30 sec, 72C for 1 min 30 sec), 72C for 5 min. PCR amplification was performed in a 20-μl total reaction volume with 13.6μl of H20, 4μl of 5x HF Buffer (Finnzymes), 0.2 mM dNTPs, 0.6 μl of 100% DMSO, 0.3333 μM of each primer, 0.02U/μl of Phusion Polymerase (Finnzymes) and 2 μl of template DNA. .. When an A/A, B1/B2/B1/B2 or C/C homozygote was found, we religated and transformed the original PCR product and sequenced additional clones to ensure that the colony was indeed a homozygote.

    Hybridization:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: For the probe hybridization phase, these mixtures were incubated in a thermocycler (Bio-Rad) with a heated lid at 98°C for 3 min, 85°C for 30 min, 60°C for 60 min, and 56°C for 120 min. For the gap-fill and ligation phase, we added 300 picomoles each dNTPs (NEB), 7.5 micromoles betaine (Sigma), 20 nanomoles NAD+ (NEB), 1 μL of 10× Ampligase buffer, 5 units of Ampligase DNA ligase (Epicentre), 3.2 units of Phusion DNA polymerase (NEB), and molecular biology grade water to 10 mL for a total reaction volume of 20 μL. .. For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL.

    Inverse PCR:

    Article Title: Engineering a branching sucrase for flavonoid glucoside diversification
    Article Snippet: .. Inverse PCR amplifications were carried out using the high fidelity Phusion DNA polymerase (Thermo Scientific) according to the following protocol: Template DNA, 0.12 ng.µL−1 ; forward and reverse primers, 200 nM; dNTP, 200 µM each; Phusion DNA polymerase, 0.02 U/µL; in 50 µL of HF Buffer 1× (thermo Scientific). .. The PCR conditions were: 1 min start at 98 °C followed by 16 cycles of 98 °C −10s, 75 °C −15 s, 62 °C or 66 °C −30 s (degenerated oligos melting temperatures for library 2135–2136 and 2163–2166, respectively), 72 °C −10 min, and final extension of 10 min at 72 °C.

    Ligation:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: Following the gap-fill and ligation phase, the reactions were cooled to 37°C, and to each reaction we added 20 units of Exonuclease I (NEB) and 100 units of Exonuclease III (NEB) to degrade uncircularized probe and genomic DNA. .. For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL.

    Article Title: Analysis of transcript and protein overlap in a human osteosarcoma cell line
    Article Snippet: The ligation reaction was washed three times in sterile deionised water and the beads were resuspended in 20 μl of sterile deionised water. .. An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes).

    Generated:

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: These samples were used for 16S rRNA gene analysis for microbiota profiling with barcoded amplicons from the V1–V2 region of 16S rRNA genes generated using a 2-step PCR strategy that reduces the impact of barcoded primers on the outcome of microbial profiling ( ). .. The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA.

    DNA Sequencing:

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL. .. The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL.

    Article Title: Analysis of transcript and protein overlap in a human osteosarcoma cell line
    Article Snippet: Paragraph title: Enrichment and SOLiD DNA sequencing ... An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes).

    Sequencing:

    Article Title: Artifactual mutations resulting from DNA lesions limit detection levels in ultrasensitive sequencing applications
    Article Snippet: Single-molecule PCR For single-molecule PCR (smPCR) of HSI_insert constructs, PCR was performed with the ‘SMA Inserts’ primers ( Supplementary Table S1 ) in 20 µL reactions containing vector-insert construct DNA (diluted to 0.2 molecules per reaction that rendered on average ∼20% smPCR reactions with an amplification product), 0.33 ng E. coli DNA, 0.25 µM of the appropriate forward and reverse primer, 0.16 mM dNTPs, 0.5× EvaGreen (Jena Bioscience), 1× Phusion HF Buffer (ThermoFisher Scientific) and 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase. .. The reactions were carried out with an initial heating step of 94 °C for 2 min, followed by 55 cycles at 94 °C for 15 s, 65 °C for 15 s, and 72 °C for 20 s. Given that none of the steps during the HSI_insert construction were 100% efficient, we used several control passes to ensure that we are analyzing the HSI_insert construct: (1) we placed our primers such that only an insert ligated within the vector was amplified during smPCR, and (2) amplifiable vectors without the synthetic insert (present at ∼10% as circular vectors with the original sequence) were distinguished by a dinucleotide unique to the insert identified by genotyping before sequencing ( Supplementary Methods ).

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA. .. The sequence of the UniTags were selected to have a GC content of ~66% and a minimal tendency to form secondary structures, including hairpin loops, heterodimers, and homodimers as assessed by the IDTDNA Oligoanalyzer 3.1 (Integrated DNA Technologies).

    Article Title: Analysis of transcript and protein overlap in a human osteosarcoma cell line
    Article Snippet: To create a blunt-ended dsDNA adapter sequence suitable for ligation to the beads, a mixture consisting of 440 μl sterile deionised water, 5 μl 100 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 5 μl 100 pmol/μl aRDV primer (AGAGAATGAGGAACCCGGGGCAGTT, MWG-Biotech) and 50 μl PNK buffer (Invitrogen) was assembled and incubated at 95°C for 3 minutes and allowed to cool to room temperature on a lab bench for 30 minutes. .. An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes).

    Article Title: Biology and clinical implications of the 19q13 aggressive prostate cancer susceptibility locus
    Article Snippet: The 2 x Phusion Master Mix with HF Buffer (F531, Thermo) were applied for PCR reactions. .. Then the cleaned products with forward primer in a total volume of 6 ul were sent for Sanger Sequencing.

    Article Title: A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library
    Article Snippet: Briefly, the PCR mix (total volume, 15ul) consisted of limiting DNA template (approximately 2,500 copies in 5 ul), 1x HF buffer (Thermo Scientific), 200uM dNTP (NEB), 400nM of each barcoded primer and 0.3U of Phusion DNA polymerase (Thermo Scientific). .. Five to ten replicates were performed to produce sufficient DNA product for library generation and sequencing.

    Article Title: Amplification and Re-Generation of LNA-Modified Libraries
    Article Snippet: Polymerase Chain Reaction (PCR) 5 nM template and 0.5 µM of each primer was combined in 1× Phusion HF buffer with 200 µM of each deoxyribonucleotide triphosphate and 0.02 units/µL Phusion DNA polymerase (Finnzymes, Espoo, Finland). .. Sanger sequencing experiments used 0.5 nM template and 0.04 units/µL Phusion DNA polymerase over 20 cycles.

    Article Title: Dechlorination of three tetrachlorobenzene isomers by contaminated harbor sludge-derived enrichment cultures follows thermodynamically favorable reactions
    Article Snippet: Paragraph title: Illumina MiSeq sequencing and data analysis ... The first PCR (50 μl) contained 1× HF buffer (Thermo Scientific™, The Netherlands), 1 μl dNTP Mix (10 mM; Promega, The Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Thermo Scientific™), 500 nM of 27F–DegS forward primer, 500 nM of 338R I and II reverse primers (Table ), and 1 μL template DNA (15–20 ng/μl).

    Article Title: The fester locus in Botryllus schlosseri experiences selection
    Article Snippet: Cycling conditions were 39x (95C for 30 sec, 55C for 30 sec, 72C for 1 min 30 sec), 72C for 5 min. PCR amplification was performed in a 20-μl total reaction volume with 13.6μl of H20, 4μl of 5x HF Buffer (Finnzymes), 0.2 mM dNTPs, 0.6 μl of 100% DMSO, 0.3333 μM of each primer, 0.02U/μl of Phusion Polymerase (Finnzymes) and 2 μl of template DNA. .. Colony PCR products were incubated with 0.25μl each of Exonuclease I and Shrimp Antarctic Phosphatase at 37°C for 30 min, followed by 90°C for 10 min prior to sequencing.

    DNA Extraction:

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: DNA extraction was performed using a combination of the bead-beating-plus column method and the Maxwell 16 Tissue LEV Total RNA purification kit (Promega, Leiden, the Netherlands). .. The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA.

    Nucleic Acid Electrophoresis:

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA. .. The size of the PCR products (~375 bp) was confirmed by gel electrophoresis using 5 µl of the amplification reaction mixture on a 1% (w/v) agarose gel containing 1× SYBR® Safe (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA).

    Methylation:

    Article Title: Engineering a branching sucrase for flavonoid glucoside diversification
    Article Snippet: Inverse PCR amplifications were carried out using the high fidelity Phusion DNA polymerase (Thermo Scientific) according to the following protocol: Template DNA, 0.12 ng.µL−1 ; forward and reverse primers, 200 nM; dNTP, 200 µM each; Phusion DNA polymerase, 0.02 U/µL; in 50 µL of HF Buffer 1× (thermo Scientific). .. Amplified DNA was digested by DpnI endonuclease (20 U, 37 °C, 2 h) to eliminate the methylated parental template and loaded on a 0,8% agarose, Tris-acetate, EDTA (tris-base, 24,2 g.L−1 ; acetic acid, 5,7%; EDTA, 50 mM) gel for separation.

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL. .. After PCR, the methylated template DNA was degraded by digestion with 10 U of DpnI at 37°C for at least 3 h. The remaining PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Vienna, Austria) and 5 μL of each purified PCR product were transformed into electro-competent E. coli TOP10 F′ cells.

    Mutagenesis:

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: Paragraph title: Site-directed mutagenesis ... The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL.

    Size-exclusion Chromatography:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL. .. PCR cycling conditions were an initial denaturation step for 2 min at 95°C, followed by 26 cycles of: 15 sec at 98°C, 15 sec at 65°C, and 45 sec at 72°C.

    Article Title: The fester locus in Botryllus schlosseri experiences selection
    Article Snippet: .. Cycling conditions were 39x (95C for 30 sec, 55C for 30 sec, 72C for 1 min 30 sec), 72C for 5 min. PCR amplification was performed in a 20-μl total reaction volume with 13.6μl of H20, 4μl of 5x HF Buffer (Finnzymes), 0.2 mM dNTPs, 0.6 μl of 100% DMSO, 0.3333 μM of each primer, 0.02U/μl of Phusion Polymerase (Finnzymes) and 2 μl of template DNA. .. PCR products were cloned using the pGEM®-T kit and at least 12 clones per colony were sequenced in order to find alleles from all allele types: many colonies have more than 1 allele type.

    Purification:

    Article Title: Engineering a branching sucrase for flavonoid glucoside diversification
    Article Snippet: Inverse PCR amplifications were carried out using the high fidelity Phusion DNA polymerase (Thermo Scientific) according to the following protocol: Template DNA, 0.12 ng.µL−1 ; forward and reverse primers, 200 nM; dNTP, 200 µM each; Phusion DNA polymerase, 0.02 U/µL; in 50 µL of HF Buffer 1× (thermo Scientific). .. The 8 kb bands, corresponding to pET53-δn 123 -gbd-cd2 plasmids, were taken and purified using a Qiaquick Gel extraction kit (Qiagen® ) and following the manufacturer recommendations.

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL. .. After PCR, the methylated template DNA was degraded by digestion with 10 U of DpnI at 37°C for at least 3 h. The remaining PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Vienna, Austria) and 5 μL of each purified PCR product were transformed into electro-competent E. coli TOP10 F′ cells.

    Article Title: Modular 5′-UTR hexamers for context-independent tuning of protein expression in eukaryotes
    Article Snippet: Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs). .. Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs).

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: 250 µl supernatant after centrifugation was taken for the Maxwell 16 Tissue LEV Total RNA Purification Kit, and the DNA was eluted in 50 µl DNAse-free water. .. The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA.

    Article Title: Bacterial communities on classroom surfaces vary with human contact
    Article Snippet: PCR1 (25 μL total volume per reaction) consisted of the following steps: 5 μL 5× HF buffer (Thermo Fisher Scientific, Waltham, MA, USA), 0.5 μL deoxyribonucleotide triphosphates (10 mM, Invitrogen, Life Technologies, Grand Island, NY, USA), 0.25 μL Phusion Hotstart II polymerase (0.5 units; Thermo Fisher Scientific), 13.25 μL certified nucleic-acid free water, 0.5 μL (10 μM) forward primer, 0.5 μL (10 μM) reverse primer, and 5 μL template DNA. .. After PCR1, the triplicate reactions were pooled and cleaned with the Qiagen MinElute PCR Purification Kit according to the manufacturer’s protocol (Qiagen, Germantown, MD, USA).

    Article Title: Analysis of transcript and protein overlap in a human osteosarcoma cell line
    Article Snippet: An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes). .. After a final extension at 72°C for 10 minutes, the PCR product was purified using a MinElute column, following the manufacturers instructions with the elution step as described earlier.

    Article Title: Biology and clinical implications of the 19q13 aggressive prostate cancer susceptibility locus
    Article Snippet: The 2 x Phusion Master Mix with HF Buffer (F531, Thermo) were applied for PCR reactions. .. The sequencing reactions were carried out using BigDyeTerminator v1.1 cycle sequencing kit (Applied Biosystems) and ethanol precipitation purification.

    Polymerase Chain Reaction:

    Article Title: Engineering a branching sucrase for flavonoid glucoside diversification
    Article Snippet: Inverse PCR amplifications were carried out using the high fidelity Phusion DNA polymerase (Thermo Scientific) according to the following protocol: Template DNA, 0.12 ng.µL−1 ; forward and reverse primers, 200 nM; dNTP, 200 µM each; Phusion DNA polymerase, 0.02 U/µL; in 50 µL of HF Buffer 1× (thermo Scientific). .. The PCR conditions were: 1 min start at 98 °C followed by 16 cycles of 98 °C −10s, 75 °C −15 s, 62 °C or 66 °C −30 s (degenerated oligos melting temperatures for library 2135–2136 and 2163–2166, respectively), 72 °C −10 min, and final extension of 10 min at 72 °C.

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: .. For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL. .. PCR cycling conditions were an initial denaturation step for 2 min at 95°C, followed by 26 cycles of: 15 sec at 98°C, 15 sec at 65°C, and 45 sec at 72°C.

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: .. The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL. ..

    Article Title: Modular 5′-UTR hexamers for context-independent tuning of protein expression in eukaryotes
    Article Snippet: .. Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs). .. Oligos, duplex oligos and gBlocks were purchased from Integrated DNA Technologies (IDT).

    Article Title: Artifactual mutations resulting from DNA lesions limit detection levels in ultrasensitive sequencing applications
    Article Snippet: .. Single-molecule PCR For single-molecule PCR (smPCR) of HSI_insert constructs, PCR was performed with the ‘SMA Inserts’ primers ( Supplementary Table S1 ) in 20 µL reactions containing vector-insert construct DNA (diluted to 0.2 molecules per reaction that rendered on average ∼20% smPCR reactions with an amplification product), 0.33 ng E. coli DNA, 0.25 µM of the appropriate forward and reverse primer, 0.16 mM dNTPs, 0.5× EvaGreen (Jena Bioscience), 1× Phusion HF Buffer (ThermoFisher Scientific) and 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase. .. The reactions were carried out with an initial heating step of 94 °C for 2 min, followed by 55 cycles at 94 °C for 15 s, 65 °C for 15 s, and 72 °C for 20 s. Given that none of the steps during the HSI_insert construction were 100% efficient, we used several control passes to ensure that we are analyzing the HSI_insert construct: (1) we placed our primers such that only an insert ligated within the vector was amplified during smPCR, and (2) amplifiable vectors without the synthetic insert (present at ∼10% as circular vectors with the original sequence) were distinguished by a dinucleotide unique to the insert identified by genotyping before sequencing ( Supplementary Methods ).

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: .. The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA. .. The sequence of the UniTags were selected to have a GC content of ~66% and a minimal tendency to form secondary structures, including hairpin loops, heterodimers, and homodimers as assessed by the IDTDNA Oligoanalyzer 3.1 (Integrated DNA Technologies).

    Article Title: Bacterial communities on classroom surfaces vary with human contact
    Article Snippet: PCR1 (25 μL total volume per reaction) consisted of the following steps: 5 μL 5× HF buffer (Thermo Fisher Scientific, Waltham, MA, USA), 0.5 μL deoxyribonucleotide triphosphates (10 mM, Invitrogen, Life Technologies, Grand Island, NY, USA), 0.25 μL Phusion Hotstart II polymerase (0.5 units; Thermo Fisher Scientific), 13.25 μL certified nucleic-acid free water, 0.5 μL (10 μM) forward primer, 0.5 μL (10 μM) reverse primer, and 5 μL template DNA. .. After PCR1, the triplicate reactions were pooled and cleaned with the Qiagen MinElute PCR Purification Kit according to the manufacturer’s protocol (Qiagen, Germantown, MD, USA).

    Article Title: Analysis of transcript and protein overlap in a human osteosarcoma cell line
    Article Snippet: An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes). .. After a final extension at 72°C for 10 minutes, the PCR product was purified using a MinElute column, following the manufacturers instructions with the elution step as described earlier.

    Article Title: Biology and clinical implications of the 19q13 aggressive prostate cancer susceptibility locus
    Article Snippet: .. The 2 x Phusion Master Mix with HF Buffer (F531, Thermo) were applied for PCR reactions. .. PCR products were cleaned with Exonuclease I and FastAP (# EF0651, Thermo) to remove unincorporated primers and degrade unincorporated nucleotides.

    Article Title: Variation in the OC Locus of Acinetobacter baumannii Genomes Predicts Extensive Structural Diversity in the Lipooligosaccharide
    Article Snippet: .. Thermocycling conditions were as follows: 94°C for 3 min (initial denaturation cycle), followed by 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 60 s to 3 min, then a final cycle of 72°C for 5 min. For long-range PCR, the reaction mix (20 µL) included 4 µL of HF buffer (Finnzymes, Thermo Fisher Scientific, Australia), 1 µmol of each primer, 200 µM of each deoxynucleoside triphosphate, 40 ng of template DNA and 1 unit of Phusion polymerase (Finnzymes, Thermo Fisher Scientific, Australia). .. Cycling conditions were 98°C for 30 s (initial denaturation cycle), followed by 35 cycles of 98°C for 10 s, 60°C for 30 s and 72°C for 30 s per 1 kb of expected product size, then a final cycle of 72°C for 10 min. PCR products were separated by electrophoresis on 1% (w/v) agarose gels and stained with 5 mg/L ethidium bromide.

    Article Title: A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library
    Article Snippet: .. Briefly, the PCR mix (total volume, 15ul) consisted of limiting DNA template (approximately 2,500 copies in 5 ul), 1x HF buffer (Thermo Scientific), 200uM dNTP (NEB), 400nM of each barcoded primer and 0.3U of Phusion DNA polymerase (Thermo Scientific). .. Five to ten replicates were performed to produce sufficient DNA product for library generation and sequencing.

    Article Title: Amplification and Re-Generation of LNA-Modified Libraries
    Article Snippet: .. Polymerase Chain Reaction (PCR) 5 nM template and 0.5 µM of each primer was combined in 1× Phusion HF buffer with 200 µM of each deoxyribonucleotide triphosphate and 0.02 units/µL Phusion DNA polymerase (Finnzymes, Espoo, Finland). .. Typical PCR conditions were: 98 °C/5 min, 24 cycles (98 °C/5 s, 53 °C/10 s, 72 °C/5 min), 4 °C/hold.

    Article Title: Dechlorination of three tetrachlorobenzene isomers by contaminated harbor sludge-derived enrichment cultures follows thermodynamically favorable reactions
    Article Snippet: .. The first PCR (50 μl) contained 1× HF buffer (Thermo Scientific™, The Netherlands), 1 μl dNTP Mix (10 mM; Promega, The Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Thermo Scientific™), 500 nM of 27F–DegS forward primer, 500 nM of 338R I and II reverse primers (Table ), and 1 μL template DNA (15–20 ng/μl). ..

    Article Title: The fester locus in Botryllus schlosseri experiences selection
    Article Snippet: .. Cycling conditions were 39x (95C for 30 sec, 55C for 30 sec, 72C for 1 min 30 sec), 72C for 5 min. PCR amplification was performed in a 20-μl total reaction volume with 13.6μl of H20, 4μl of 5x HF Buffer (Finnzymes), 0.2 mM dNTPs, 0.6 μl of 100% DMSO, 0.3333 μM of each primer, 0.02U/μl of Phusion Polymerase (Finnzymes) and 2 μl of template DNA. .. PCR products were cloned using the pGEM®-T kit and at least 12 clones per colony were sequenced in order to find alleles from all allele types: many colonies have more than 1 allele type.

    Article Title: Fifteen to Twenty Percent of HIV Substitution Mutations Are Associated with Recombination
    Article Snippet: .. PCR mixtures were titrated to contain 2,500 copies of template DNA, 1× HF buffer (Finnzymes), 200 μM deoxynucleoside triphosphate (dNTP), 1 μM each primer, and 0.3 U of Phusion DNA polymerase (Finnzymes) in a 15-μl total reaction mixture volume. .. Plasmid DNA was titrated in cellular lysates from uninfected PBLs so that the DNA complexity of the control PCRs faithfully represented the experimental samples.

    Gel Extraction:

    Article Title: Engineering a branching sucrase for flavonoid glucoside diversification
    Article Snippet: Inverse PCR amplifications were carried out using the high fidelity Phusion DNA polymerase (Thermo Scientific) according to the following protocol: Template DNA, 0.12 ng.µL−1 ; forward and reverse primers, 200 nM; dNTP, 200 µM each; Phusion DNA polymerase, 0.02 U/µL; in 50 µL of HF Buffer 1× (thermo Scientific). .. The 8 kb bands, corresponding to pET53-δn 123 -gbd-cd2 plasmids, were taken and purified using a Qiaquick Gel extraction kit (Qiagen® ) and following the manufacturer recommendations.

    Hot Start PCR:

    Article Title: Modular 5′-UTR hexamers for context-independent tuning of protein expression in eukaryotes
    Article Snippet: .. Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs). .. Oligos, duplex oligos and gBlocks were purchased from Integrated DNA Technologies (IDT).

    Plasmid Preparation:

    Article Title: Glyco-variant library of the versatile enzyme horseradish peroxidase
    Article Snippet: .. The mutagenic PCR was performed as: 98°C for 30 s; then 10 cycles of 98°C for 10 s, 57°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 1 min—10 cycles of 98°C for 10 s, 63°C for 20 s, 72°C for 1 min; with a final incubation at 72°C for 10 min. Each reaction contained 1× HF buffer (Fermentas), 0.1 μg of plasmid DNA, 2.5 U Phusion DNA polymerase (Fermentas), 10 μm of each dNTP and 5 pmol of each primer in a total volume of 50 µL. ..

    Article Title: Modular 5′-UTR hexamers for context-independent tuning of protein expression in eukaryotes
    Article Snippet: Paragraph title: Plasmid and strain construction ... Biobricks for USER assembly were amplified using Phusion U Hot Start PCR Master Mix (ThermoFisher), parts for transformation by Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher), whereas colony PCRs were performed using 2xOneTaq Quick-Load Master Mix with Standard Buffer (New England Biolabs).

    Article Title: Artifactual mutations resulting from DNA lesions limit detection levels in ultrasensitive sequencing applications
    Article Snippet: .. Single-molecule PCR For single-molecule PCR (smPCR) of HSI_insert constructs, PCR was performed with the ‘SMA Inserts’ primers ( Supplementary Table S1 ) in 20 µL reactions containing vector-insert construct DNA (diluted to 0.2 molecules per reaction that rendered on average ∼20% smPCR reactions with an amplification product), 0.33 ng E. coli DNA, 0.25 µM of the appropriate forward and reverse primer, 0.16 mM dNTPs, 0.5× EvaGreen (Jena Bioscience), 1× Phusion HF Buffer (ThermoFisher Scientific) and 0.1 U Phusion Hot Start II High-Fidelity DNA Polymerase. .. The reactions were carried out with an initial heating step of 94 °C for 2 min, followed by 55 cycles at 94 °C for 15 s, 65 °C for 15 s, and 72 °C for 20 s. Given that none of the steps during the HSI_insert construction were 100% efficient, we used several control passes to ensure that we are analyzing the HSI_insert construct: (1) we placed our primers such that only an insert ligated within the vector was amplified during smPCR, and (2) amplifiable vectors without the synthetic insert (present at ∼10% as circular vectors with the original sequence) were distinguished by a dinucleotide unique to the insert identified by genotyping before sequencing ( Supplementary Methods ).

    Article Title: Fifteen to Twenty Percent of HIV Substitution Mutations Are Associated with Recombination
    Article Snippet: PCR mixtures were titrated to contain 2,500 copies of template DNA, 1× HF buffer (Finnzymes), 200 μM deoxynucleoside triphosphate (dNTP), 1 μM each primer, and 0.3 U of Phusion DNA polymerase (Finnzymes) in a 15-μl total reaction mixture volume. .. Plasmid DNA was titrated in cellular lysates from uninfected PBLs so that the DNA complexity of the control PCRs faithfully represented the experimental samples.

    SYBR Green Assay:

    Article Title: Single molecule molecular inversion probes for targeted, high-accuracy detection of low-frequency variation
    Article Snippet: .. For each capture reaction, two PCR reactions were prepared, each with Phusion HF buffer to 1× (Fermentas), forward primer and indexed reverse PCR primers to 500 nM, SYBR green (Invitrogen) to 0.5×, dNTPs to 200 μm each (NEB), 2 units of Phusion Hot-Start II polymerase, 10 μL of capture reaction, and nuclease-free water to 50 μL. .. PCR cycling conditions were an initial denaturation step for 2 min at 95°C, followed by 26 cycles of: 15 sec at 98°C, 15 sec at 65°C, and 45 sec at 72°C.

    Article Title: A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library
    Article Snippet: Briefly, the PCR mix (total volume, 15ul) consisted of limiting DNA template (approximately 2,500 copies in 5 ul), 1x HF buffer (Thermo Scientific), 200uM dNTP (NEB), 400nM of each barcoded primer and 0.3U of Phusion DNA polymerase (Thermo Scientific). .. Additionally, to enable monitoring of the reaction using qPCR, duplicates were included containing 0.5x SYBR Green 1 (Life Technologies).

    Agarose Gel Electrophoresis:

    Article Title: The Impact of Gut Microbiota on Gender-Specific Differences in Immunity
    Article Snippet: The first PCR was performed in a total volume of 50 µl containing 1× HF buffer (Finnzymes, Vantaa, Finland), 1 µl dNTP Mix (10 mM; Promega, Leiden, the Netherlands), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (Finnzymes Vantaa, Finland), 500 nM of the 27F-DegS primer ( , ) that was appended with UniTag 1 at the 5′ end, 500 nM of an equimolar mix of two reverse primers, 338R I and II ( ) based on three previously published probes EUB 338 I, II, and III , that were 5′-extended with UniTag 2, and 0.2–0.4 ng/µl of template DNA. .. The size of the PCR products (~375 bp) was confirmed by gel electrophoresis using 5 µl of the amplification reaction mixture on a 1% (w/v) agarose gel containing 1× SYBR® Safe (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA).

    Electrophoresis:

    Article Title: Variation in the OC Locus of Acinetobacter baumannii Genomes Predicts Extensive Structural Diversity in the Lipooligosaccharide
    Article Snippet: Thermocycling conditions were as follows: 94°C for 3 min (initial denaturation cycle), followed by 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 60 s to 3 min, then a final cycle of 72°C for 5 min. For long-range PCR, the reaction mix (20 µL) included 4 µL of HF buffer (Finnzymes, Thermo Fisher Scientific, Australia), 1 µmol of each primer, 200 µM of each deoxynucleoside triphosphate, 40 ng of template DNA and 1 unit of Phusion polymerase (Finnzymes, Thermo Fisher Scientific, Australia). .. Cycling conditions were 98°C for 30 s (initial denaturation cycle), followed by 35 cycles of 98°C for 10 s, 60°C for 30 s and 72°C for 30 s per 1 kb of expected product size, then a final cycle of 72°C for 10 min. PCR products were separated by electrophoresis on 1% (w/v) agarose gels and stained with 5 mg/L ethidium bromide.

    Ethanol Precipitation:

    Article Title: Biology and clinical implications of the 19q13 aggressive prostate cancer susceptibility locus
    Article Snippet: The 2 x Phusion Master Mix with HF Buffer (F531, Thermo) were applied for PCR reactions. .. The sequencing reactions were carried out using BigDyeTerminator v1.1 cycle sequencing kit (Applied Biosystems) and ethanol precipitation purification.

    Next-Generation Sequencing:

    Article Title: Fifteen to Twenty Percent of HIV Substitution Mutations Are Associated with Recombination
    Article Snippet: With amplicon generation for next-generation sequencing, PCR conditions were optimized to reduce the formation of artificial recombinants by using a method outlined by Smyth et al. ( ). .. PCR mixtures were titrated to contain 2,500 copies of template DNA, 1× HF buffer (Finnzymes), 200 μM deoxynucleoside triphosphate (dNTP), 1 μM each primer, and 0.3 U of Phusion DNA polymerase (Finnzymes) in a 15-μl total reaction mixture volume.

    Marker:

    Article Title: Variation in the OC Locus of Acinetobacter baumannii Genomes Predicts Extensive Structural Diversity in the Lipooligosaccharide
    Article Snippet: Thermocycling conditions were as follows: 94°C for 3 min (initial denaturation cycle), followed by 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 60 s to 3 min, then a final cycle of 72°C for 5 min. For long-range PCR, the reaction mix (20 µL) included 4 µL of HF buffer (Finnzymes, Thermo Fisher Scientific, Australia), 1 µmol of each primer, 200 µM of each deoxynucleoside triphosphate, 40 ng of template DNA and 1 unit of Phusion polymerase (Finnzymes, Thermo Fisher Scientific, Australia). .. A 1 kb DNA ladder (New England BioLabs) was used for a molecular size marker.

    Staining:

    Article Title: Variation in the OC Locus of Acinetobacter baumannii Genomes Predicts Extensive Structural Diversity in the Lipooligosaccharide
    Article Snippet: Thermocycling conditions were as follows: 94°C for 3 min (initial denaturation cycle), followed by 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 60 s to 3 min, then a final cycle of 72°C for 5 min. For long-range PCR, the reaction mix (20 µL) included 4 µL of HF buffer (Finnzymes, Thermo Fisher Scientific, Australia), 1 µmol of each primer, 200 µM of each deoxynucleoside triphosphate, 40 ng of template DNA and 1 unit of Phusion polymerase (Finnzymes, Thermo Fisher Scientific, Australia). .. Cycling conditions were 98°C for 30 s (initial denaturation cycle), followed by 35 cycles of 98°C for 10 s, 60°C for 30 s and 72°C for 30 s per 1 kb of expected product size, then a final cycle of 72°C for 10 min. PCR products were separated by electrophoresis on 1% (w/v) agarose gels and stained with 5 mg/L ethidium bromide.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 5x t4 ligase buffer
    5x T4 Ligase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x t4 ligase buffer/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    5x t4 ligase buffer - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher phusion hf buffer
    Phusion Hf Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 146 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion hf buffer/product/Thermo Fisher
    Average 99 stars, based on 146 article reviews
    Price from $9.99 to $1999.99
    phusion hf buffer - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results