cat no 51604  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAamp Fast DNA Stool Mini Kit
    Description:

    Catalog Number:
    51604
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen cat no 51604

    https://www.bioz.com/result/cat no 51604/product/Qiagen
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    cat no 51604 - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles
    Article Snippet: DNA was extracted from a starting faecal quantity of 10–200 mg (depending on obtainable amount) using the QIAamp® Fast DNA Stool Mini Kit (Qiagen) under aseptic conditions using the manufacturer’s protocol alongside the following modifications. .. DNA was extracted from a starting faecal quantity of 10–200 mg (depending on obtainable amount) using the QIAamp® Fast DNA Stool Mini Kit (Qiagen) under aseptic conditions using the manufacturer’s protocol alongside the following modifications.

    Amplification:

    Article Title: Estimating the Population Size and Genetic Diversity of Amur Tigers in Northeast China
    Article Snippet: DNA was extracted from the scats using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Inc.) as described in Russello et al. [ ]. .. DNA was extracted from the scats using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Inc.) as described in Russello et al. [ ].

    Article Title: The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China. The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China
    Article Snippet: Paragraph title: DNA extraction and PCR amplification ... 2.2 DNA was extracted from fecal samples according to the manufacturer's instructions by the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany).

    Article Title: Butyrate Protects Mice Against Methionine–Choline-Deficient Diet-Induced Non-alcoholic Steatohepatitis by Improving Gut Barrier Function, Attenuating Inflammation and Reducing Endotoxin Levels
    Article Snippet: DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols. .. DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols.

    Article Title: Intestinal Inflammation in Chilean Infants Fed With Bovine Formula vs. Breast Milk and Its Association With Their Gut Microbiota
    Article Snippet: The mean of the ΔCT of the BM group was used as a reference for the fold expression changes in the BF group. .. Total DNA was extracted from stool samples using the QIAamp Fast DNA Stool Mini Kit (Qiagen) and stored at −20°C until PCR amplification. .. The 16S rRNA gene was amplified in a two-step process.

    Article Title: Western diet feeding influences gut microbiota profiles in apoE knockout mice
    Article Snippet: About each of 0.5 g cecal sample was used for DNA extraction with QIAamp Fast DNA Stool Mini kit (Qiagen) according to the manufacturer’s protocols. .. The extracted DNA was amplified with primers targeting V4-V5 hypervariable region of bacterial 16S rRNA genes (forward: 5-CCAGCAGCYGCGGTAAN-3; reverse: 5-CCGTCAATTCNTTTRAGT-3).

    Article Title: Differences in the Gut Microbiota Establishment and Metabolome Characteristics Between Low- and Normal-Birth-Weight Piglets During Early-Life
    Article Snippet: A total of 60 fecal samples from the rectum were collected on ice, immediately frozen in liquid nitrogen, and then stored at -80°C until microbiome and metabolome analysis. .. DNA Extraction, 16S rRNA Gene Amplification and Sequencing Total metagenomic DNA was extracted from 200 mg of each fecal specimen by using the QIAamp® Fast DNA Stool Mini Kit (Qiagen Ltd., Germany) in accordance with manufacturer’s instructions. .. The V3-V4 region of the 16S rRNA gene was amplified with universal primers 341F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT), as described by .

    Filtration:

    Article Title: Dynamic alterations in the gut microbiota and metabolome during the development of methionine-choline-deficient diet-induced nonalcoholic steatohepatitis
    Article Snippet: Total DNA was extracted from fecal samples with a QIAamp fast DNA stool mini kit (Qiagen, Valencia, CA, United States) following the manufacturer’s handbook. .. Total DNA was extracted from fecal samples with a QIAamp fast DNA stool mini kit (Qiagen, Valencia, CA, United States) following the manufacturer’s handbook.

    Recovery:

    Article Title: Differences in the Gut Microbiota Establishment and Metabolome Characteristics Between Low- and Normal-Birth-Weight Piglets During Early-Life
    Article Snippet: DNA Extraction, 16S rRNA Gene Amplification and Sequencing Total metagenomic DNA was extracted from 200 mg of each fecal specimen by using the QIAamp® Fast DNA Stool Mini Kit (Qiagen Ltd., Germany) in accordance with manufacturer’s instructions. .. The V3-V4 region of the 16S rRNA gene was amplified with universal primers 341F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT), as described by .

    Positive Control:

    Article Title: Protozoan parasites in irritable bowel syndrome: A case-control study
    Article Snippet: Genomic DNA was extracted from stool samples using QIAamp® Fast DNA Stool Mini Kit (Qiagen, Germany) following the manufacturer’s instructions. .. Each PCR reaction contained 12.5 μL of GoTaq® Green Master Mix solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers (Promega, United States), 0.5 μL of each primer, 5 μL of sample genomic DNA extract, and 5.5 μL of nuclease free water in a total volume of 25 μL.

    Quantitative RT-PCR:

    Article Title: Incidence, Etiology and Risk Factors for Travelers’ Diarrhea during a Hospital Ship-Based Military Humanitarian Mission: Continuing Promise 2011
    Article Snippet: Briefly, frozen stool samples were diluted to a 20% solution with phosphate-buffered saline and subjected to nucleic acid extraction using the Qiagen QIAamp Viral RNA Mini Kit or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA). .. The conventional PCR assayed for diarrheagenic Escherichia coli (including enterotoxigenic E . coli [ETEC], enteroinvasive E . coli [EIEC], enteropathogenic E . coli [EPEC] and enteroaggregative E . coli [EAEC]), Salmonella species (spp.), Shigella spp., Campylobacter spp., Vibrio cholerae , astrovirus, groups A and C rotavirus, sapovirus, adenovirus, and norovirus genogroups GI and GII ( ).

    Electrophoresis:

    Article Title: Echinococcus in wild canids in Québec (Canada) and Maine (USA)
    Article Snippet: Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA). .. Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA).

    Multiplex Assay:

    Article Title: Incidence, Etiology and Risk Factors for Travelers’ Diarrhea during a Hospital Ship-Based Military Humanitarian Mission: Continuing Promise 2011
    Article Snippet: Briefly, frozen stool samples were diluted to a 20% solution with phosphate-buffered saline and subjected to nucleic acid extraction using the Qiagen QIAamp Viral RNA Mini Kit or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA). .. Identification of norovirus was performed using a real-time RT-PCR protocol stipulated by the CDC CaliciNet program.

    Incubation:

    Article Title: A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles
    Article Snippet: DNA was extracted from a starting faecal quantity of 10–200 mg (depending on obtainable amount) using the QIAamp® Fast DNA Stool Mini Kit (Qiagen) under aseptic conditions using the manufacturer’s protocol alongside the following modifications. .. DNA was extracted from a starting faecal quantity of 10–200 mg (depending on obtainable amount) using the QIAamp® Fast DNA Stool Mini Kit (Qiagen) under aseptic conditions using the manufacturer’s protocol alongside the following modifications.

    Infection:

    Article Title: Echinococcus in wild canids in Québec (Canada) and Maine (USA)
    Article Snippet: Forward and reverse sequences were trimmed, aligned, and then identified using the BLASTn tool to compare the similarity of sample sequences to reference sequences in the nucleotide database of GenBank [ ]. .. Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA). .. We modified the manufacturer protocol to increase tissue disruption by shaking the cestodes at 4 m/s for 20s in lysis matrix tubes containing a garnet matrix and ¼ inch spherical beads (MP Biomedicals; Solon, Ohio, USA) in the initial step and eluting 100 μL of DNA in the final step.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Incidence, Etiology and Risk Factors for Travelers’ Diarrhea during a Hospital Ship-Based Military Humanitarian Mission: Continuing Promise 2011
    Article Snippet: Conventional, real-time, and Luminex xTAG® -Gastrointestinal Pathogen Panel (GPP)-based (reverse transcription) polymerase chain reaction (RT-)PCR was performed to detect various bacterial, viral, and parasitic enteric pathogens within clinical samples (Luminex Corporation, Toronto, Canada). .. Briefly, frozen stool samples were diluted to a 20% solution with phosphate-buffered saline and subjected to nucleic acid extraction using the Qiagen QIAamp Viral RNA Mini Kit or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA).

    Inhibition:

    Article Title: Towards diagnostic metagenomics of Campylobacter in fecal samples
    Article Snippet: DNA was extracted from chicken fecal samples with QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions on pathogen detection step 1–4 (inhibition buffer and heat treatment), and on human DNA analysis step 5–14 (larger volumes of reagents) to maximize DNA yield according to [ ]. .. DNA was extracted from C. jejuni strain 381 and C. jejuni strain DVI-SC181 with QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions on pathogen detection.

    Polymerase Chain Reaction:

    Article Title: Incidence, Etiology and Risk Factors for Travelers’ Diarrhea during a Hospital Ship-Based Military Humanitarian Mission: Continuing Promise 2011
    Article Snippet: Briefly, frozen stool samples were diluted to a 20% solution with phosphate-buffered saline and subjected to nucleic acid extraction using the Qiagen QIAamp Viral RNA Mini Kit or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA). .. Sample RNAs/DNAs were then subjected to conventional and real-time (RT-)PCR for identification.

    Article Title: The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China. The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China
    Article Snippet: Paragraph title: DNA extraction and PCR amplification ... 2.2 DNA was extracted from fecal samples according to the manufacturer's instructions by the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany).

    Article Title: Protozoan parasites in irritable bowel syndrome: A case-control study
    Article Snippet: Paragraph title: Detection of blastocystis spp. by polymerase chain reaction ... Genomic DNA was extracted from stool samples using QIAamp® Fast DNA Stool Mini Kit (Qiagen, Germany) following the manufacturer’s instructions.

    Article Title: Molecular diversity of the faecal microbiota of Toy Poodles in Japan
    Article Snippet: Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany). .. Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany).

    Article Title: Butyrate Protects Mice Against Methionine–Choline-Deficient Diet-Induced Non-alcoholic Steatohepatitis by Improving Gut Barrier Function, Attenuating Inflammation and Reducing Endotoxin Levels
    Article Snippet: DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols. .. DNA concentration and integrity were measured by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Hudson, NH, United States) and agarose gel electrophoresis, respectively.

    Article Title: Intestinal Inflammation in Chilean Infants Fed With Bovine Formula vs. Breast Milk and Its Association With Their Gut Microbiota
    Article Snippet: The mean of the ΔCT of the BM group was used as a reference for the fold expression changes in the BF group. .. Total DNA was extracted from stool samples using the QIAamp Fast DNA Stool Mini Kit (Qiagen) and stored at −20°C until PCR amplification. .. The 16S rRNA gene was amplified in a two-step process.

    Article Title: Western diet feeding influences gut microbiota profiles in apoE knockout mice
    Article Snippet: About each of 0.5 g cecal sample was used for DNA extraction with QIAamp Fast DNA Stool Mini kit (Qiagen) according to the manufacturer’s protocols. .. The extracted DNA was amplified with primers targeting V4-V5 hypervariable region of bacterial 16S rRNA genes (forward: 5-CCAGCAGCYGCGGTAAN-3; reverse: 5-CCGTCAATTCNTTTRAGT-3).

    Article Title: Echinococcus in wild canids in Québec (Canada) and Maine (USA)
    Article Snippet: Single cestode PCR products were purified using the QIAquick PCR Purification Kit (Qiagen Inc., Valencia, California, USA), and sequenced (Macrogen Inc., Seoul, Korea). .. Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA).

    DNA Extraction:

    Article Title: The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China. The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China
    Article Snippet: Paragraph title: DNA extraction and PCR amplification ... 2.2 DNA was extracted from fecal samples according to the manufacturer's instructions by the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany).

    Article Title: Towards diagnostic metagenomics of Campylobacter in fecal samples
    Article Snippet: Paragraph title: DNA extraction ... DNA was extracted from C. jejuni strain 381 and C. jejuni strain DVI-SC181 with QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions on pathogen detection.

    Article Title: Comparison of Fecal Microbial Composition and Antibiotic Resistance Genes from Swine, Farm Workers and the Surrounding Villagers
    Article Snippet: Paragraph title: DNA extraction ... Fecal DNA was extracted using QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.

    Article Title: Evolution in fecal bacterial/viral composition in infants of two central African countries (Gabon and Republic of the Congo) during their first month of life
    Article Snippet: Paragraph title: DNA extraction ... Total genomic DNA was isolated from 500 μL of filtered stool sample using the QIAamp Fast DNA Stool mini kit (QIAGEN) and following the manufacturer’s instructions.

    Article Title: A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles
    Article Snippet: Paragraph title: DNA extraction from faeces and DNA concentration analysis ... DNA was extracted from a starting faecal quantity of 10–200 mg (depending on obtainable amount) using the QIAamp® Fast DNA Stool Mini Kit (Qiagen) under aseptic conditions using the manufacturer’s protocol alongside the following modifications.

    Article Title: Detection and genotyping of Helicobacter pylori in saliva versus stool samples from asymptomatic individuals in Northeastern Thailand reveals intra-host tissue-specific H. pylori subtypes
    Article Snippet: Paragraph title: DNA extraction ... DNA was extracted from 1 ml of saliva and 1 g of stool samples using the Puregene DNA Purification System (Gentra System, USA) and QIAamp® Fast DNA Stool Mini Kit (Qiagen, USA), respectively, according to manufacturers’ instructions.

    Article Title: Molecular diversity of the faecal microbiota of Toy Poodles in Japan
    Article Snippet: Paragraph title: DNA extraction and 16S rRNA gene sequencing ... Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany).

    Article Title: Butyrate Protects Mice Against Methionine–Choline-Deficient Diet-Induced Non-alcoholic Steatohepatitis by Improving Gut Barrier Function, Attenuating Inflammation and Reducing Endotoxin Levels
    Article Snippet: The data were normalized to the total weight of feces. .. DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols. .. DNA concentration and integrity were measured by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Hudson, NH, United States) and agarose gel electrophoresis, respectively.

    Article Title: Western diet feeding influences gut microbiota profiles in apoE knockout mice
    Article Snippet: Finally, image processing was carried out using a Leica DMRE microscope equipped with Spot digital image analysis software and camera. .. About each of 0.5 g cecal sample was used for DNA extraction with QIAamp Fast DNA Stool Mini kit (Qiagen) according to the manufacturer’s protocols. .. The extracted DNA was amplified with primers targeting V4-V5 hypervariable region of bacterial 16S rRNA genes (forward: 5-CCAGCAGCYGCGGTAAN-3; reverse: 5-CCGTCAATTCNTTTRAGT-3).

    Article Title: Differences in the Gut Microbiota Establishment and Metabolome Characteristics Between Low- and Normal-Birth-Weight Piglets During Early-Life
    Article Snippet: A total of 60 fecal samples from the rectum were collected on ice, immediately frozen in liquid nitrogen, and then stored at -80°C until microbiome and metabolome analysis. .. DNA Extraction, 16S rRNA Gene Amplification and Sequencing Total metagenomic DNA was extracted from 200 mg of each fecal specimen by using the QIAamp® Fast DNA Stool Mini Kit (Qiagen Ltd., Germany) in accordance with manufacturer’s instructions. .. The V3-V4 region of the 16S rRNA gene was amplified with universal primers 341F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT), as described by .

    Isolation:

    Article Title: Evolution in fecal bacterial/viral composition in infants of two central African countries (Gabon and Republic of the Congo) during their first month of life
    Article Snippet: Each stool sample was collected non-invasively in a sterile 50 mL tube and stored in RNAlater® (Sigma) at 4°C just after collection and then -20°C until DNA/RNA extraction. .. Total genomic DNA was isolated from 500 μL of filtered stool sample using the QIAamp Fast DNA Stool mini kit (QIAGEN) and following the manufacturer’s instructions. .. DNA samples were eluted in 200 μL of ATE buffer (QIAGEN) and stored at -20°C.

    Article Title: Chronic Sleep Disruption Alters Gut Microbiota, Induces Systemic and Adipose Tissue Inflammation and Insulin Resistance in Mice
    Article Snippet: The relative expression of the gene of interest was calculated using the 2-ΔΔCt method. .. Fecal DNA was isolated using Stool Fast Mini Kit (Qiagen). .. The 16S rRNA tag libraries were generated using the set of indexed primers (V4 hypervariable region) and sequenced on Illumina MiSeq platform .

    Size-exclusion Chromatography:

    Article Title: Molecular diversity of the faecal microbiota of Toy Poodles in Japan
    Article Snippet: Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany). .. Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany).

    Purification:

    Article Title: Molecular diversity of the faecal microbiota of Toy Poodles in Japan
    Article Snippet: Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany). .. Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany).

    Article Title: Butyrate Protects Mice Against Methionine–Choline-Deficient Diet-Induced Non-alcoholic Steatohepatitis by Improving Gut Barrier Function, Attenuating Inflammation and Reducing Endotoxin Levels
    Article Snippet: DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols. .. The library for 16S rDNA amplicon sequencing was constructed based on the PCR-amplified V3–V4 variable regions.

    Article Title: Intestinal Inflammation in Chilean Infants Fed With Bovine Formula vs. Breast Milk and Its Association With Their Gut Microbiota
    Article Snippet: Total DNA was extracted from stool samples using the QIAamp Fast DNA Stool Mini Kit (Qiagen) and stored at −20°C until PCR amplification. .. First, the 16S rRNA gene was amplified using the primers GM3 and 1492R, and then a nested PCR was performed using the GM3-PS forward primer and a different 907-PS reverse primer for each sample in a 7-cycle reaction as described (Gallardo et al., ).

    Article Title: Echinococcus in wild canids in Québec (Canada) and Maine (USA)
    Article Snippet: Single cestode PCR products were purified using the QIAquick PCR Purification Kit (Qiagen Inc., Valencia, California, USA), and sequenced (Macrogen Inc., Seoul, Korea). .. Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA).

    Sequencing:

    Article Title: The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China. The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin Lake, China
    Article Snippet: 2.2 DNA was extracted from fecal samples according to the manufacturer's instructions by the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany). .. 2.2 DNA was extracted from fecal samples according to the manufacturer's instructions by the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany).

    Article Title: Dynamic alterations in the gut microbiota and metabolome during the development of methionine-choline-deficient diet-induced nonalcoholic steatohepatitis
    Article Snippet: Total DNA was extracted from fecal samples with a QIAamp fast DNA stool mini kit (Qiagen, Valencia, CA, United States) following the manufacturer’s handbook. .. Total DNA was extracted from fecal samples with a QIAamp fast DNA stool mini kit (Qiagen, Valencia, CA, United States) following the manufacturer’s handbook.

    Article Title: Molecular diversity of the faecal microbiota of Toy Poodles in Japan
    Article Snippet: Paragraph title: DNA extraction and 16S rRNA gene sequencing ... Before extraction, each faecal swab was resuspended in 2 ml of sterile PBS and centrifuged at max speed for 3 min. DNA was extracted from pellet samples with the QIAamp Fast DNA Stool Mini Kit (Qiagen Hilden, Germany).

    Article Title: Butyrate Protects Mice Against Methionine–Choline-Deficient Diet-Induced Non-alcoholic Steatohepatitis by Improving Gut Barrier Function, Attenuating Inflammation and Reducing Endotoxin Levels
    Article Snippet: DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols. .. DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols.

    Article Title: Western diet feeding influences gut microbiota profiles in apoE knockout mice
    Article Snippet: Paragraph title: Gut bacterial DNA extraction and sequencing ... About each of 0.5 g cecal sample was used for DNA extraction with QIAamp Fast DNA Stool Mini kit (Qiagen) according to the manufacturer’s protocols.

    Article Title: Differences in the Gut Microbiota Establishment and Metabolome Characteristics Between Low- and Normal-Birth-Weight Piglets During Early-Life
    Article Snippet: A total of 60 fecal samples from the rectum were collected on ice, immediately frozen in liquid nitrogen, and then stored at -80°C until microbiome and metabolome analysis. .. DNA Extraction, 16S rRNA Gene Amplification and Sequencing Total metagenomic DNA was extracted from 200 mg of each fecal specimen by using the QIAamp® Fast DNA Stool Mini Kit (Qiagen Ltd., Germany) in accordance with manufacturer’s instructions. .. The V3-V4 region of the 16S rRNA gene was amplified with universal primers 341F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT), as described by .

    Construct:

    Article Title: Butyrate Protects Mice Against Methionine–Choline-Deficient Diet-Induced Non-alcoholic Steatohepatitis by Improving Gut Barrier Function, Attenuating Inflammation and Reducing Endotoxin Levels
    Article Snippet: DNA extraction from fecal samples was conducted using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA, United States) following the manufacturer’s protocols. .. DNA concentration and integrity were measured by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Hudson, NH, United States) and agarose gel electrophoresis, respectively.

    Nested PCR:

    Article Title: Intestinal Inflammation in Chilean Infants Fed With Bovine Formula vs. Breast Milk and Its Association With Their Gut Microbiota
    Article Snippet: Total DNA was extracted from stool samples using the QIAamp Fast DNA Stool Mini Kit (Qiagen) and stored at −20°C until PCR amplification. .. The 16S rRNA gene was amplified in a two-step process.

    Software:

    Article Title: Dynamic alterations in the gut microbiota and metabolome during the development of methionine-choline-deficient diet-induced nonalcoholic steatohepatitis
    Article Snippet: Total DNA was extracted from fecal samples with a QIAamp fast DNA stool mini kit (Qiagen, Valencia, CA, United States) following the manufacturer’s handbook. .. Total DNA was extracted from fecal samples with a QIAamp fast DNA stool mini kit (Qiagen, Valencia, CA, United States) following the manufacturer’s handbook.

    Article Title: Chronic Sleep Disruption Alters Gut Microbiota, Induces Systemic and Adipose Tissue Inflammation and Insulin Resistance in Mice
    Article Snippet: Fecal DNA was isolated using Stool Fast Mini Kit (Qiagen). .. Fecal DNA was isolated using Stool Fast Mini Kit (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: Comparison of Microbial Communities Isolated from Feces of Asymptomatic Salmonella-Shedding and Non-Salmonella Shedding Dairy Cows
    Article Snippet: Cows were selected as Salmonella -positive if S. enterica was detected in their feces by traditional culture analysis and real-time PCR detection of the invA gene. .. Total DNA was extracted from preserved fecal grab samples using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany) and DNA was evaluated for quality using a Nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA) and a Qubit 2.0 (Thermo Fisher Scientific, Waltham, MA).

    Negative Control:

    Article Title: Protozoan parasites in irritable bowel syndrome: A case-control study
    Article Snippet: Genomic DNA was extracted from stool samples using QIAamp® Fast DNA Stool Mini Kit (Qiagen, Germany) following the manufacturer’s instructions. .. Each PCR reaction contained 12.5 μL of GoTaq® Green Master Mix solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers (Promega, United States), 0.5 μL of each primer, 5 μL of sample genomic DNA extract, and 5.5 μL of nuclease free water in a total volume of 25 μL.

    Agarose Gel Electrophoresis:

    Article Title: Estimating the Population Size and Genetic Diversity of Amur Tigers in Northeast China
    Article Snippet: DNA was extracted from the scats using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Inc.) as described in Russello et al. [ ]. .. DNA was extracted from the scats using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Inc.) as described in Russello et al. [ ].

    Article Title: Differences in the Gut Microbiota Establishment and Metabolome Characteristics Between Low- and Normal-Birth-Weight Piglets During Early-Life
    Article Snippet: DNA Extraction, 16S rRNA Gene Amplification and Sequencing Total metagenomic DNA was extracted from 200 mg of each fecal specimen by using the QIAamp® Fast DNA Stool Mini Kit (Qiagen Ltd., Germany) in accordance with manufacturer’s instructions. .. The V3-V4 region of the 16S rRNA gene was amplified with universal primers 341F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT), as described by .

    Article Title: Echinococcus in wild canids in Québec (Canada) and Maine (USA)
    Article Snippet: Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA). .. Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA).

    Sampling:

    Article Title: Incidence, Etiology and Risk Factors for Travelers’ Diarrhea during a Hospital Ship-Based Military Humanitarian Mission: Continuing Promise 2011
    Article Snippet: Briefly, frozen stool samples were diluted to a 20% solution with phosphate-buffered saline and subjected to nucleic acid extraction using the Qiagen QIAamp Viral RNA Mini Kit or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA). .. Briefly, frozen stool samples were diluted to a 20% solution with phosphate-buffered saline and subjected to nucleic acid extraction using the Qiagen QIAamp Viral RNA Mini Kit or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA).

    Article Title: Comparison of Microbial Communities Isolated from Feces of Asymptomatic Salmonella-Shedding and Non-Salmonella Shedding Dairy Cows
    Article Snippet: Sampling dates were selected from archived samples to capture the appropriate number of Salmonella -shedding and non-shedding cows to conduct the analysis. .. Total DNA was extracted from preserved fecal grab samples using a QIAamp Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany) and DNA was evaluated for quality using a Nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA) and a Qubit 2.0 (Thermo Fisher Scientific, Waltham, MA).

    Article Title: Species From Feces: Order-Wide Identification of Chiroptera From Guano and Other Non-Invasive Genetic Samples
    Article Snippet: [ ] for use with Illumina short-read sequencers. .. We vortexed each pooled guano sample taken from roosts in abandoned mines (sampling described above) into a semi-slurry, then subsampled 0.22g into a 1.5 mL centrifuge tube and performed the TE soak mentioned above, and then extracted DNA via QiaAmp Fast Stool Mini Kit. .. Using samples of known multiple species composition, we also tested whether subsampling four times from the same conical resulted in more bat species detected.

    Concentration Assay:

    Article Title: Towards diagnostic metagenomics of Campylobacter in fecal samples
    Article Snippet: However, in step 14, 100 μl Buffer ATE was used to increase DNA concentration. .. DNA was extracted from C. jejuni strain 381 and C. jejuni strain DVI-SC181 with QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions on pathogen detection.

    Article Title: A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles
    Article Snippet: Paragraph title: DNA extraction from faeces and DNA concentration analysis ... DNA was extracted from a starting faecal quantity of 10–200 mg (depending on obtainable amount) using the QIAamp® Fast DNA Stool Mini Kit (Qiagen) under aseptic conditions using the manufacturer’s protocol alongside the following modifications.

    Article Title: Intestinal Inflammation in Chilean Infants Fed With Bovine Formula vs. Breast Milk and Its Association With Their Gut Microbiota
    Article Snippet: Total DNA was extracted from stool samples using the QIAamp Fast DNA Stool Mini Kit (Qiagen) and stored at −20°C until PCR amplification. .. First, the 16S rRNA gene was amplified using the primers GM3 and 1492R, and then a nested PCR was performed using the GM3-PS forward primer and a different 907-PS reverse primer for each sample in a 7-cycle reaction as described (Gallardo et al., ).

    DNA Purification:

    Article Title: Detection and genotyping of Helicobacter pylori in saliva versus stool samples from asymptomatic individuals in Northeastern Thailand reveals intra-host tissue-specific H. pylori subtypes
    Article Snippet: The study was approved by Institutional Human Ethics Committee of Khon Kaen University (HE571489). .. DNA was extracted from 1 ml of saliva and 1 g of stool samples using the Puregene DNA Purification System (Gentra System, USA) and QIAamp® Fast DNA Stool Mini Kit (Qiagen, USA), respectively, according to manufacturers’ instructions. .. vac A of H. pylori was amplified by semi-nested PCR using specific primers, vac F1/F2 and R1 followed by vac F1/F2 and R2 (Table ).

    Lysis:

    Article Title: Echinococcus in wild canids in Québec (Canada) and Maine (USA)
    Article Snippet: To identify Echinococcus species and genotypes, we randomly selected three intact cestodes from each infected canid and extracted DNA using a thermocycler tissue lysis technique [ ]. .. Similar to Santa et al [ ], we then pooled all the Echinococcus spp. cestodes remaining from each infected animal and extracted DNA from these pools (up to 100 mg per reaction) using the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, California, USA).

    Luminex:

    Article Title: Incidence, Etiology and Risk Factors for Travelers’ Diarrhea during a Hospital Ship-Based Military Humanitarian Mission: Continuing Promise 2011
    Article Snippet: Briefly, frozen stool samples were diluted to a 20% solution with phosphate-buffered saline and subjected to nucleic acid extraction using the Qiagen QIAamp Viral RNA Mini Kit or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA). .. Identification of norovirus was performed using a real-time RT-PCR protocol stipulated by the CDC CaliciNet program.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen qiaamp ffpe dna kit
    MicroRNA expression analysis of matched fresh and <t>FFPE</t> RNA from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen AllPrep <t>DNA/RNA</t> FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.
    Qiaamp Ffpe Dna Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1427 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaamp ffpe dna kit/product/Qiagen
    Average 99 stars, based on 1427 article reviews
    Price from $9.99 to $1999.99
    qiaamp ffpe dna kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    MicroRNA expression analysis of matched fresh and FFPE RNA from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: MicroRNA expression analysis of matched fresh and FFPE RNA from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Article Snippet: For extraction of FFPE-DNA, we selected the Qiagen QiaAmp FFPE DNA kit (QD; Qiagen, CA, USA), as a control for yield and quality, because it has been shown to be a robust approach when compared to other methods and kits and the recovered FFPE-DNA has successfully been used for genotyping studies , array CGH , genome-wide massively-parallel sequencing , and methylation studies .

    Techniques: Expressing, Formalin-fixed Paraffin-Embedded, RNA Extraction, Quantitative RT-PCR, Isolation

    Summary of sequential recovery of DNA and RNA from MCF10A Fresh and FFPE samples using different extraction methods. (A) Schematic representation of cell culture and DNA/RNA extraction methods used with matched fresh and 1 month-old formalin-fixed paraffin-embedded (FFPE) human mammary epithelial MCF10A cells. FFPE DNA and RNA extractions (QD, TRI, QDR, AMB) were performed in triplicate using three 10 µm sections for each replicate. (B) Analysis of RNA extracted from matched fresh and FFPE MCF10A cells. Total RNA extracted from fresh cells using TRIzol (TRI-Fr; Lane 2), and total RNA extracted from FFPE cells using TRIzol (TRI; lane 3), Qiagen QIAamp DNA/RNA extraction kit (QDR; lane 4), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 5) was analyzed and quantified using an Agilent 2100 Bioanalyzer 6000 Nanochip (size ladder in lane 1). The bar graph placed above the Bioanalyzer image displays total amounts of RNA recovered from three consecutive 10 µm sections, in triplicate experiments, using the three different methods (TRI, QDR, AMB). (C) Analysis of genomic DNA extracted from matched fresh and FFPE MCF10A cells. DNA was extracted from fresh cells using a phenol/chloroform based method (PC-Fr; lane 2), and TRIzol (TRI-Fr lane 3); and from FFPE cells using Qiagen QIAamp DNA FFPE kit (QD; lane 4), TRIzol DNA/RNA extraction method (TRI; lane 5), Qiagen AllPrep DNA/RNA FFPE kit (QDR; lane 6), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 7) was analyzed on a 1% agarose gel (size ladder in lane 1). The bar graph placed above the agarose gel displays total amounts of DNA recovered alone (QD), simultaneously with RNA (TRI, QDR), or separately from RNA (AMB), using three consecutive 10 µm sections, in triplicate experiments for each method.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Summary of sequential recovery of DNA and RNA from MCF10A Fresh and FFPE samples using different extraction methods. (A) Schematic representation of cell culture and DNA/RNA extraction methods used with matched fresh and 1 month-old formalin-fixed paraffin-embedded (FFPE) human mammary epithelial MCF10A cells. FFPE DNA and RNA extractions (QD, TRI, QDR, AMB) were performed in triplicate using three 10 µm sections for each replicate. (B) Analysis of RNA extracted from matched fresh and FFPE MCF10A cells. Total RNA extracted from fresh cells using TRIzol (TRI-Fr; Lane 2), and total RNA extracted from FFPE cells using TRIzol (TRI; lane 3), Qiagen QIAamp DNA/RNA extraction kit (QDR; lane 4), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 5) was analyzed and quantified using an Agilent 2100 Bioanalyzer 6000 Nanochip (size ladder in lane 1). The bar graph placed above the Bioanalyzer image displays total amounts of RNA recovered from three consecutive 10 µm sections, in triplicate experiments, using the three different methods (TRI, QDR, AMB). (C) Analysis of genomic DNA extracted from matched fresh and FFPE MCF10A cells. DNA was extracted from fresh cells using a phenol/chloroform based method (PC-Fr; lane 2), and TRIzol (TRI-Fr lane 3); and from FFPE cells using Qiagen QIAamp DNA FFPE kit (QD; lane 4), TRIzol DNA/RNA extraction method (TRI; lane 5), Qiagen AllPrep DNA/RNA FFPE kit (QDR; lane 6), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 7) was analyzed on a 1% agarose gel (size ladder in lane 1). The bar graph placed above the agarose gel displays total amounts of DNA recovered alone (QD), simultaneously with RNA (TRI, QDR), or separately from RNA (AMB), using three consecutive 10 µm sections, in triplicate experiments for each method.

    Article Snippet: For extraction of FFPE-DNA, we selected the Qiagen QiaAmp FFPE DNA kit (QD; Qiagen, CA, USA), as a control for yield and quality, because it has been shown to be a robust approach when compared to other methods and kits and the recovered FFPE-DNA has successfully been used for genotyping studies , array CGH , genome-wide massively-parallel sequencing , and methylation studies .

    Techniques: Formalin-fixed Paraffin-Embedded, Cell Culture, RNA Extraction, Isolation, Agarose Gel Electrophoresis

    DNA/RNA extractions using archived human specimens. Four different methods were tested on seven different archived tissues: (A) Qiagen QIAamp DNA FFPE kit for DNA (QD), (B) TRIzol DNA/RNA extraction method for DNA and RNA (TRI), (C) Qiagen AllPrep DNA/RNA FFPE kit for DNA and RNA (QDR), and (D) Ambion RecoverAll™ Total Nucleic Acid Isolation (AMB) for DNA and for RNA. Each nucleic acid extraction was done in triplicate to determine technical reproducibility.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: DNA/RNA extractions using archived human specimens. Four different methods were tested on seven different archived tissues: (A) Qiagen QIAamp DNA FFPE kit for DNA (QD), (B) TRIzol DNA/RNA extraction method for DNA and RNA (TRI), (C) Qiagen AllPrep DNA/RNA FFPE kit for DNA and RNA (QDR), and (D) Ambion RecoverAll™ Total Nucleic Acid Isolation (AMB) for DNA and for RNA. Each nucleic acid extraction was done in triplicate to determine technical reproducibility.

    Article Snippet: For extraction of FFPE-DNA, we selected the Qiagen QiaAmp FFPE DNA kit (QD; Qiagen, CA, USA), as a control for yield and quality, because it has been shown to be a robust approach when compared to other methods and kits and the recovered FFPE-DNA has successfully been used for genotyping studies , array CGH , genome-wide massively-parallel sequencing , and methylation studies .

    Techniques: Formalin-fixed Paraffin-Embedded, RNA Extraction, Isolation

    Methylation analysis of CpG regions in genes of interest using matched fresh and FFPE genomic DNA obtained by different extraction methods. Representative 2% agarose gel electrophoresis images of PCR products for (A) ESR1 and (B) CCND2 genes. Graphs depict methylation values as a percentage for CpG dinucleotide rich regions in (C) ESR1, (D) CCND2, (E) GHSR, and (F) ARID3A as assayed via the MassARRAY system (Sequenom). Data were analyzed and confirmed using the MassArray R script statistical package. Methylation values for fresh MCF10A DNA isolated with control methods (DNA from fresh cells recovered by phenol/chloroform (PC-Fr) and from FFPE cells using the Qiagen QIAamp DNA FFPE kit (QD)) are compared against methods used for matched FFPE DNA (TRIzol extraction (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), and AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB)). The bar graphs display the correlation between DNA methylation measurements obtained from fresh genomic DNA and each FFPE genomic DNA recovered by the different extraction methods.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Methylation analysis of CpG regions in genes of interest using matched fresh and FFPE genomic DNA obtained by different extraction methods. Representative 2% agarose gel electrophoresis images of PCR products for (A) ESR1 and (B) CCND2 genes. Graphs depict methylation values as a percentage for CpG dinucleotide rich regions in (C) ESR1, (D) CCND2, (E) GHSR, and (F) ARID3A as assayed via the MassARRAY system (Sequenom). Data were analyzed and confirmed using the MassArray R script statistical package. Methylation values for fresh MCF10A DNA isolated with control methods (DNA from fresh cells recovered by phenol/chloroform (PC-Fr) and from FFPE cells using the Qiagen QIAamp DNA FFPE kit (QD)) are compared against methods used for matched FFPE DNA (TRIzol extraction (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), and AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB)). The bar graphs display the correlation between DNA methylation measurements obtained from fresh genomic DNA and each FFPE genomic DNA recovered by the different extraction methods.

    Article Snippet: For extraction of FFPE-DNA, we selected the Qiagen QiaAmp FFPE DNA kit (QD; Qiagen, CA, USA), as a control for yield and quality, because it has been shown to be a robust approach when compared to other methods and kits and the recovered FFPE-DNA has successfully been used for genotyping studies , array CGH , genome-wide massively-parallel sequencing , and methylation studies .

    Techniques: Methylation, Formalin-fixed Paraffin-Embedded, Agarose Gel Electrophoresis, Electrophoresis, Polymerase Chain Reaction, Isolation, DNA Methylation Assay

    Optimized TRIzol extraction of DNA from archived specimens. (A) Schematic representation of DNA recovery from the lower phase of TRIzol (upper phase yields RNA). In step 1 (yellow bullet), tissue digestion is performed following the procedure described in Loudig et al. 2007. In step 2 (yellow bullet), using TRIzol RNA and DNA are separated into the upper and lower phases, respectively. The DNA is recovered from the lower phase, using our optimized approach described in the materials and methods . The four steps describing optimization of DNA recovery from the lower phase of TRIzol include: a. Precipitate DNA; b. Process DNA pellet (using reagents from Qiagen DNA FFPE kit for steps b to d); c. Purify DNA; d. Bind, wash, and elute DNA. (B) Analysis of DNA from FFPE tissue recovered from the lower phase of TRIzol. The upper panel shows the histogram of DNA recovery. The lower panel shows a 1.5% agarose gel electrophoresis image of fresh DNA recovered from a TRIzol treatment lower phase (lane 1), FFPE DNA recovered from a TRIzol lower phase (lanes 2–6), and the size ladder (lane 7). For DNA, precipitation was tested for 600 µl (lane 2 and lane 4), 1000 µl (lane 3 and lane 5), and 1200 µl of Ethanol (lane 6). Proteinase K (PK) treatment was performed for 24 (lanes 2–3) or 48 hours (lanes 4–6). Electrophoresis reveals integrity of the extracted DNA samples. The histogram and agarose gel show that precipitation with a combination of 1200 µl ethanol and 48 hours of PK treatment gives the best quality and quantity of DNA. 500 ng of DNA was loaded per well of the gel.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Optimized TRIzol extraction of DNA from archived specimens. (A) Schematic representation of DNA recovery from the lower phase of TRIzol (upper phase yields RNA). In step 1 (yellow bullet), tissue digestion is performed following the procedure described in Loudig et al. 2007. In step 2 (yellow bullet), using TRIzol RNA and DNA are separated into the upper and lower phases, respectively. The DNA is recovered from the lower phase, using our optimized approach described in the materials and methods . The four steps describing optimization of DNA recovery from the lower phase of TRIzol include: a. Precipitate DNA; b. Process DNA pellet (using reagents from Qiagen DNA FFPE kit for steps b to d); c. Purify DNA; d. Bind, wash, and elute DNA. (B) Analysis of DNA from FFPE tissue recovered from the lower phase of TRIzol. The upper panel shows the histogram of DNA recovery. The lower panel shows a 1.5% agarose gel electrophoresis image of fresh DNA recovered from a TRIzol treatment lower phase (lane 1), FFPE DNA recovered from a TRIzol lower phase (lanes 2–6), and the size ladder (lane 7). For DNA, precipitation was tested for 600 µl (lane 2 and lane 4), 1000 µl (lane 3 and lane 5), and 1200 µl of Ethanol (lane 6). Proteinase K (PK) treatment was performed for 24 (lanes 2–3) or 48 hours (lanes 4–6). Electrophoresis reveals integrity of the extracted DNA samples. The histogram and agarose gel show that precipitation with a combination of 1200 µl ethanol and 48 hours of PK treatment gives the best quality and quantity of DNA. 500 ng of DNA was loaded per well of the gel.

    Article Snippet: For extraction of FFPE-DNA, we selected the Qiagen QiaAmp FFPE DNA kit (QD; Qiagen, CA, USA), as a control for yield and quality, because it has been shown to be a robust approach when compared to other methods and kits and the recovered FFPE-DNA has successfully been used for genotyping studies , array CGH , genome-wide massively-parallel sequencing , and methylation studies .

    Techniques: Formalin-fixed Paraffin-Embedded, Agarose Gel Electrophoresis, Electrophoresis

    Messenger RNA expression analysis of matched fresh and FFPE RNA using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® mRNA assays) Measurements obtained for ESR1, CCND2 and KRT14 genes using matched fresh and FFPE RNA from MCF10A cells. The three genes were quantified using matched fresh RNA recovered with TRIzol (TRI-Fr), and FFPE RNA recovered with TRIzol (TRI), with Qiagen AllPrep DNA/RNA FFPE (QDR), with AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) and with the Roche RNA FFPE (Roche) kits. The results are represented as fold changes. The lower panels show the comparison of global mRNA quantifications obtained between fresh and FFPE RNA samples using the Illumina whole-Genome DASL platform. The different panels display comparison between triplicate RNA extractions from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3 (bottom to top panel)) and FFPE (TRI1-3, QDR1-3, AMB1-3 and Roche1-3 (from left to right panel)) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Messenger RNA expression analysis of matched fresh and FFPE RNA using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® mRNA assays) Measurements obtained for ESR1, CCND2 and KRT14 genes using matched fresh and FFPE RNA from MCF10A cells. The three genes were quantified using matched fresh RNA recovered with TRIzol (TRI-Fr), and FFPE RNA recovered with TRIzol (TRI), with Qiagen AllPrep DNA/RNA FFPE (QDR), with AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) and with the Roche RNA FFPE (Roche) kits. The results are represented as fold changes. The lower panels show the comparison of global mRNA quantifications obtained between fresh and FFPE RNA samples using the Illumina whole-Genome DASL platform. The different panels display comparison between triplicate RNA extractions from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3 (bottom to top panel)) and FFPE (TRI1-3, QDR1-3, AMB1-3 and Roche1-3 (from left to right panel)) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Article Snippet: For extraction of FFPE-DNA, we selected the Qiagen QiaAmp FFPE DNA kit (QD; Qiagen, CA, USA), as a control for yield and quality, because it has been shown to be a robust approach when compared to other methods and kits and the recovered FFPE-DNA has successfully been used for genotyping studies , array CGH , genome-wide massively-parallel sequencing , and methylation studies .

    Techniques: RNA Expression, Formalin-fixed Paraffin-Embedded, RNA Extraction, Quantitative RT-PCR, Isolation

    Comparison of cancer spheroid- and FFPE tumor-derived DNA samples in sequence analysis of MMR-target coding mononucleotide repeats ( A ) Agarose gel profile comparing the DNA samples from spheroid and FFPE tumors. ( B ) Mutation profiles of coding mononucleotides in four MMR-target genes for seven MSI cases analyzed with spheroid- and FFPE tissue-derived DNA samples. Red boxes/triangles indicate mutated alleles, whereas white ones show the wild-type. Analysis with spheroid-derived DNA enabled unambiguous identification of both alleles. However, FFPE tissue-derived DNA often gave confusing results. ( C , top) An example of homozygous mononucleotide repeat mutation in BAX (G8 → G7), detected using the spheroid-derived DNA. Arrow points 8th G → T (C → A in reverse strand sequenced here). (bottom) With the FFPE tissue-derived DNA, a slightly low peak for the 8th G was detected after seven G peaks (C in reverse strand here). This is likely derived from DNA of the normal (i.e., wild-type) stromal cells rather than cancer epithelial cells.

    Journal: Oncotarget

    Article Title: Accurate diagnosis of mismatch repair deficiency in colorectal cancer using high-quality DNA samples from cultured stem cells

    doi: 10.18632/oncotarget.26495

    Figure Lengend Snippet: Comparison of cancer spheroid- and FFPE tumor-derived DNA samples in sequence analysis of MMR-target coding mononucleotide repeats ( A ) Agarose gel profile comparing the DNA samples from spheroid and FFPE tumors. ( B ) Mutation profiles of coding mononucleotides in four MMR-target genes for seven MSI cases analyzed with spheroid- and FFPE tissue-derived DNA samples. Red boxes/triangles indicate mutated alleles, whereas white ones show the wild-type. Analysis with spheroid-derived DNA enabled unambiguous identification of both alleles. However, FFPE tissue-derived DNA often gave confusing results. ( C , top) An example of homozygous mononucleotide repeat mutation in BAX (G8 → G7), detected using the spheroid-derived DNA. Arrow points 8th G → T (C → A in reverse strand sequenced here). (bottom) With the FFPE tissue-derived DNA, a slightly low peak for the 8th G was detected after seven G peaks (C in reverse strand here). This is likely derived from DNA of the normal (i.e., wild-type) stromal cells rather than cancer epithelial cells.

    Article Snippet: Genomic DNA was extracted using QIAamp DNA FFPE tissue kit (Qiagen, Hilden, Germany).

    Techniques: Formalin-fixed Paraffin-Embedded, Derivative Assay, Sequencing, Agarose Gel Electrophoresis, Mutagenesis

    Electropherograms of on-chip MSI analysis using spheroid-derived DNA samples ( A ) HC51T. Representative electropherograms of an MSS case for five microsatellite markers of the Bethesda panel. Red lines show the PCR products amplified from the cancer cell spheroid DNA samples, whereas blue lines indicate those from the normal epithelial stem cell DNA of the same patient. HC26T and HC4T. Representative electropherograms of MSI-H cases. The peak patterns between tumor-initiating cells (red) and the normal epithelial stem cells (blue) are separated for all loci tested. The ordinate shows fluorescence intensity in arbitrary unit (FU). ( B ) On-chip electropherogram of a representative case in which FFPE tumor-derived DNA sample (blue) showed much lower peaks with poorer resolution than spheroid-derived DNA (red) of the same patient normal mucosal stem cells (HC6N). The ordinate shows fluorescence intensity in arbitrary unit (FU). ( C ) Maximum electrophoretic peak-heights of PCR-amplified MSI markers (shown at bottom) compared between spheroid- and FFPE tumor-derived DNA samples. Note that spheroid-derived (Sph) DNA gave taller peaks than FFPE tumor-derived (FFPE) DNA for all five Bethesda panel markers. **** P

    Journal: Oncotarget

    Article Title: Accurate diagnosis of mismatch repair deficiency in colorectal cancer using high-quality DNA samples from cultured stem cells

    doi: 10.18632/oncotarget.26495

    Figure Lengend Snippet: Electropherograms of on-chip MSI analysis using spheroid-derived DNA samples ( A ) HC51T. Representative electropherograms of an MSS case for five microsatellite markers of the Bethesda panel. Red lines show the PCR products amplified from the cancer cell spheroid DNA samples, whereas blue lines indicate those from the normal epithelial stem cell DNA of the same patient. HC26T and HC4T. Representative electropherograms of MSI-H cases. The peak patterns between tumor-initiating cells (red) and the normal epithelial stem cells (blue) are separated for all loci tested. The ordinate shows fluorescence intensity in arbitrary unit (FU). ( B ) On-chip electropherogram of a representative case in which FFPE tumor-derived DNA sample (blue) showed much lower peaks with poorer resolution than spheroid-derived DNA (red) of the same patient normal mucosal stem cells (HC6N). The ordinate shows fluorescence intensity in arbitrary unit (FU). ( C ) Maximum electrophoretic peak-heights of PCR-amplified MSI markers (shown at bottom) compared between spheroid- and FFPE tumor-derived DNA samples. Note that spheroid-derived (Sph) DNA gave taller peaks than FFPE tumor-derived (FFPE) DNA for all five Bethesda panel markers. **** P

    Article Snippet: Genomic DNA was extracted using QIAamp DNA FFPE tissue kit (Qiagen, Hilden, Germany).

    Techniques: Chromatin Immunoprecipitation, Derivative Assay, Polymerase Chain Reaction, Amplification, Fluorescence, Formalin-fixed Paraffin-Embedded

    Schematic summary of the analysis results using colorectal cancer spheroids compared with those using FFPE tumors ( A ) Mutational burden estimated by exonic sequencing of spheroid DNA for 409 cancer related genes. ( B ) MSI status judged by on-chip electrophoresis of the Bethesda panel markers. ( C ) Mutations in the mononucleotide repeats in coding regions of TGFBR2 and BAX determined using spheroid and FFPE tumor DNA. ( D ) IHC results of the cultured spheroids of tumor-initiating cells and FFPE primary tumors. Color keys are shown in boxes. See text for details.

    Journal: Oncotarget

    Article Title: Accurate diagnosis of mismatch repair deficiency in colorectal cancer using high-quality DNA samples from cultured stem cells

    doi: 10.18632/oncotarget.26495

    Figure Lengend Snippet: Schematic summary of the analysis results using colorectal cancer spheroids compared with those using FFPE tumors ( A ) Mutational burden estimated by exonic sequencing of spheroid DNA for 409 cancer related genes. ( B ) MSI status judged by on-chip electrophoresis of the Bethesda panel markers. ( C ) Mutations in the mononucleotide repeats in coding regions of TGFBR2 and BAX determined using spheroid and FFPE tumor DNA. ( D ) IHC results of the cultured spheroids of tumor-initiating cells and FFPE primary tumors. Color keys are shown in boxes. See text for details.

    Article Snippet: Genomic DNA was extracted using QIAamp DNA FFPE tissue kit (Qiagen, Hilden, Germany).

    Techniques: Formalin-fixed Paraffin-Embedded, Sequencing, Chromatin Immunoprecipitation, Electrophoresis, Immunohistochemistry, Cell Culture

    Overview of proposed methods for FSM ULS processing of FFPE specimens. Summary of methods and timeline for aCGH using the FSM method. Following DNA extraction, the workflow and protocol for preparation of fresh or frozen samples is identical to FFPE workflow shown.

    Journal: PLoS ONE

    Article Title: DNA Fragmentation Simulation Method (FSM) and Fragment Size Matching Improve aCGH Performance of FFPE Tissues

    doi: 10.1371/journal.pone.0038881

    Figure Lengend Snippet: Overview of proposed methods for FSM ULS processing of FFPE specimens. Summary of methods and timeline for aCGH using the FSM method. Following DNA extraction, the workflow and protocol for preparation of fresh or frozen samples is identical to FFPE workflow shown.

    Article Snippet: 0.34 ml of Buffer ATL (Qiagen, QIAamp DNA FFPE Tissue Kit cat. no. 56404, Valencia, CA) and 40 µl of Proteinase K (20 mg/mL) (Qiagen, cat. no. 19131) were added and samples were incubated in a thermomixer (Eppendorf, cat. no. 022670000, Hamburg, Germany) set at 56–58°C and 450 rpm.

    Techniques: Formalin-fixed Paraffin-Embedded, DNA Extraction

    DNA fragmentation and thermodegradation are unpredictably variable. (A) Gel electrophoresis image of DNA extracted from 22 FFPE tissue specimens stored in paraffin from one to 13 years. (B) Mode fragment size of samples in (A) plotted by age of paraffin block, linear regression of data indicated by dashed line. (C) Gel electrophoresis image of DNA from six FFPE specimens intact prior to labeling (i), after ULS labeling only (0), or after ULS labeling plus 1 min heat fragmentation (1). (D) Mode fragment size of lanes marked 0 and 1 plotted for the six FFPE samples from the gel shown in (C). (E) Gel electrophoresis image of DNA from three frozen specimens with i, 0, and 1 indicating same conditions as in (C), and another samples after ULS labeling conditions plus 2 min heat fragmentation (2). (F) Plot of mode fragment size for lanes marked 0, 1, and 2 plotted for the three frozen samples in (E).

    Journal: PLoS ONE

    Article Title: DNA Fragmentation Simulation Method (FSM) and Fragment Size Matching Improve aCGH Performance of FFPE Tissues

    doi: 10.1371/journal.pone.0038881

    Figure Lengend Snippet: DNA fragmentation and thermodegradation are unpredictably variable. (A) Gel electrophoresis image of DNA extracted from 22 FFPE tissue specimens stored in paraffin from one to 13 years. (B) Mode fragment size of samples in (A) plotted by age of paraffin block, linear regression of data indicated by dashed line. (C) Gel electrophoresis image of DNA from six FFPE specimens intact prior to labeling (i), after ULS labeling only (0), or after ULS labeling plus 1 min heat fragmentation (1). (D) Mode fragment size of lanes marked 0 and 1 plotted for the six FFPE samples from the gel shown in (C). (E) Gel electrophoresis image of DNA from three frozen specimens with i, 0, and 1 indicating same conditions as in (C), and another samples after ULS labeling conditions plus 2 min heat fragmentation (2). (F) Plot of mode fragment size for lanes marked 0, 1, and 2 plotted for the three frozen samples in (E).

    Article Snippet: 0.34 ml of Buffer ATL (Qiagen, QIAamp DNA FFPE Tissue Kit cat. no. 56404, Valencia, CA) and 40 µl of Proteinase K (20 mg/mL) (Qiagen, cat. no. 19131) were added and samples were incubated in a thermomixer (Eppendorf, cat. no. 022670000, Hamburg, Germany) set at 56–58°C and 450 rpm.

    Techniques: Nucleic Acid Electrophoresis, Formalin-fixed Paraffin-Embedded, Blocking Assay, Labeling

    A Fragmentation Simulation Method (FSM) enables accurate prediction and precise control of labeled DNA fragment sizes. (A–F) Vertical axes indicate DNA bp. (A,D) Gel image of DNA from three FFPE specimens (A) or three frozen specimens (D) either intact, (i), after ULS labeling conditions only, (0), or ULS labeling conditions and 0.5, 1, 2, 4, 6, or eight minutes heat fragmentation (0.5, 1, 2, 4, 6, 8). (B,E) Utilizing mode fragment size of lanes in (A) or (D) as data points, FSM regression curves fit to data from each sample. Intersection with target size (dashed line) reveals FSM prediction for optimal time of heat fragmentation for each sample. (C,F) Agarose gel electrophoresis of samples in (A) or (D) after heat fragmentation for time predicted by FSM in (B) or (E) and ULS labeling conditions, shown adjacent to ImageJ gel analysis of same lanes. The mode fragment size of each smear, as measured with ImageJ, is indicated by arrows and solid horizontal lines.

    Journal: PLoS ONE

    Article Title: DNA Fragmentation Simulation Method (FSM) and Fragment Size Matching Improve aCGH Performance of FFPE Tissues

    doi: 10.1371/journal.pone.0038881

    Figure Lengend Snippet: A Fragmentation Simulation Method (FSM) enables accurate prediction and precise control of labeled DNA fragment sizes. (A–F) Vertical axes indicate DNA bp. (A,D) Gel image of DNA from three FFPE specimens (A) or three frozen specimens (D) either intact, (i), after ULS labeling conditions only, (0), or ULS labeling conditions and 0.5, 1, 2, 4, 6, or eight minutes heat fragmentation (0.5, 1, 2, 4, 6, 8). (B,E) Utilizing mode fragment size of lanes in (A) or (D) as data points, FSM regression curves fit to data from each sample. Intersection with target size (dashed line) reveals FSM prediction for optimal time of heat fragmentation for each sample. (C,F) Agarose gel electrophoresis of samples in (A) or (D) after heat fragmentation for time predicted by FSM in (B) or (E) and ULS labeling conditions, shown adjacent to ImageJ gel analysis of same lanes. The mode fragment size of each smear, as measured with ImageJ, is indicated by arrows and solid horizontal lines.

    Article Snippet: 0.34 ml of Buffer ATL (Qiagen, QIAamp DNA FFPE Tissue Kit cat. no. 56404, Valencia, CA) and 40 µl of Proteinase K (20 mg/mL) (Qiagen, cat. no. 19131) were added and samples were incubated in a thermomixer (Eppendorf, cat. no. 022670000, Hamburg, Germany) set at 56–58°C and 450 rpm.

    Techniques: Labeling, Formalin-fixed Paraffin-Embedded, Agarose Gel Electrophoresis, Electrophoresis

    Agarose gel electrophoresis of C. jejuni -specific PCR with mallard eluates. (a) PCR products from DNA samples extracted with four different kits. Top row from left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit and DNeasy Blood Tissue Kit (sample S1). Bottom row from left: DNeasy Blood Tissue Kit (samples S2 and S3) and QIAamp cador Pathogen Kit. Faint bands were detected in samples extracted with DNeasy Blood Tissue kit and QIAamp cador Pathogen kit (bottom row). (b) Intense bands visible in samples pretreated with combined heat-shock and bead beating and extracted with the QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , consecutive samples. NC , negative control. PC , positive control.

    Journal: Infection Ecology & Epidemiology

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species

    doi: 10.1080/20008686.2017.1386536

    Figure Lengend Snippet: Agarose gel electrophoresis of C. jejuni -specific PCR with mallard eluates. (a) PCR products from DNA samples extracted with four different kits. Top row from left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit and DNeasy Blood Tissue Kit (sample S1). Bottom row from left: DNeasy Blood Tissue Kit (samples S2 and S3) and QIAamp cador Pathogen Kit. Faint bands were detected in samples extracted with DNeasy Blood Tissue kit and QIAamp cador Pathogen kit (bottom row). (b) Intense bands visible in samples pretreated with combined heat-shock and bead beating and extracted with the QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , consecutive samples. NC , negative control. PC , positive control.

    Article Snippet: The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Positive Control

    Agarose gel electrophoresis of kit eluates. (a) DNA yields after extraction with four different kits. From left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit, DNeasy Blood Tissue Kit and QIAamp cador Pathogen Kit. Faint smears observed in the DNeasy Blood Tissue kit and the QIAamp cador Pathogen kit lanes. (b) DNA yields after bead beating pretreatment and extraction with QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , fecal extracts.

    Journal: Infection Ecology & Epidemiology

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species

    doi: 10.1080/20008686.2017.1386536

    Figure Lengend Snippet: Agarose gel electrophoresis of kit eluates. (a) DNA yields after extraction with four different kits. From left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit, DNeasy Blood Tissue Kit and QIAamp cador Pathogen Kit. Faint smears observed in the DNeasy Blood Tissue kit and the QIAamp cador Pathogen kit lanes. (b) DNA yields after bead beating pretreatment and extraction with QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , fecal extracts.

    Article Snippet: The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen).

    Techniques: Agarose Gel Electrophoresis