qiaamp fast dna stool mini kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    QIAamp Fast DNA Stool Mini Kit
    Description:
    For isolation of gDNA from stool samples Kit contents For 50 DNA preps 50 QIAamp Mini Spin Columns QIAGEN Proteinase K InhibitEXBuffer wash and elution buffers Collection Tubes 2 ml Benefits Streamlined faster purification protocol No use of hazardous organic chemicals Automatable on the QIAcube Efficient removal of PCR inhibitors High sensitivity for downstream assay
    Catalog Number:
    51604
    Price:
    269
    Category:
    QIAamp Fast DNA Stool Mini Kit
    		Buy from Supplier

    Structured Review

    Qiagen qiaamp fast dna stool mini kit
    QIAamp Fast DNA Stool Mini Kit
    For isolation of gDNA from stool samples Kit contents For 50 DNA preps 50 QIAamp Mini Spin Columns QIAGEN Proteinase K InhibitEXBuffer wash and elution buffers Collection Tubes 2 ml Benefits Streamlined faster purification protocol No use of hazardous organic chemicals Automatable on the QIAcube Efficient removal of PCR inhibitors High sensitivity for downstream assay
    https://www.bioz.com/result/qiaamp fast dna stool mini kit/product/Qiagen
    Average 99 stars, based on 279 article reviews
    Price from $9.99 to $1999.99
    qiaamp fast dna stool mini kit - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    bsa
    triton x-100
    dapi
    alexa fluor 488
    permeabilization
    pbst
    vectashield
    alexa fluor
    biotinylated secondary antibodies
    rnase a
    cy3
    4 6 diamidino 2 phenylindole dapi
    trypsin-edta
    immunofluorescence staining
    triton x100

    Images

    1) Product Images from "Development of a novel detection system for microbes from bovine diarrhea by real-time PCR"

    Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR

    Journal: The Journal of Veterinary Medical Science

    doi: 10.1292/jvms.15-0552

    Dembo-PCR workflow. To prepare each sample for assay, 10% fecal suspensions were made in PBS (−). The suspensions were then used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit. For virus detection, the suspensions were centrifuged for 15 min at 10,000 rpm, and viral DNA and RNA were extracted from the supernatants with a High Pure Viral Nucleic Acid Kit. After pathogen RNA and DNA were extracted, samples, reagents and each primer and probe were mixed in individual reaction tubes. Samples were applied at 2 µl per tube. A LightCycler Nano was used for all qPCR reactions performed in this study. A one step PrimeScript RT-PCR Kit (Perfect Real time) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) was used for amplification of extracts from DNA viruses, bacteria and protozoa.
    Figure Legend Snippet: Dembo-PCR workflow. To prepare each sample for assay, 10% fecal suspensions were made in PBS (−). The suspensions were then used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit. For virus detection, the suspensions were centrifuged for 15 min at 10,000 rpm, and viral DNA and RNA were extracted from the supernatants with a High Pure Viral Nucleic Acid Kit. After pathogen RNA and DNA were extracted, samples, reagents and each primer and probe were mixed in individual reaction tubes. Samples were applied at 2 µl per tube. A LightCycler Nano was used for all qPCR reactions performed in this study. A one step PrimeScript RT-PCR Kit (Perfect Real time) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) was used for amplification of extracts from DNA viruses, bacteria and protozoa.

    Techniques Used: Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Amplification

    2) Product Images from "Effects of Oat Bran on Nutrient Digestibility, Intestinal Microbiota, and Inflammatory Responses in the Hindgut of Growing Pigs"

    Article Title: Effects of Oat Bran on Nutrient Digestibility, Intestinal Microbiota, and Inflammatory Responses in the Hindgut of Growing Pigs

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19082407

    Microbiota composition in the caecal (E) and colonic (O) digesta from growing pigs fed either control (CON) or oat bran diet (OB). ( A ) Microbiota composition in the caecal and colonic digesta at the phylum level; ( B ) microbiota composition in the caecal and colonic digesta at the genus level. The results were presented as mean percentage of different bacteria, n = 4.
    Figure Legend Snippet: Microbiota composition in the caecal (E) and colonic (O) digesta from growing pigs fed either control (CON) or oat bran diet (OB). ( A ) Microbiota composition in the caecal and colonic digesta at the phylum level; ( B ) microbiota composition in the caecal and colonic digesta at the genus level. The results were presented as mean percentage of different bacteria, n = 4.

    Techniques Used:

    The microbiota α- and β-diversity of the caecal (E) and colonic (O) digesta from growing pigs fed either control (CON) or oat bran diet (OB). Each symbol represents a different group. ( A ) The Sobs index of the caecal and colonic digesta microbiota of the CON and OB groups; ( B ) the Shannon index of the caecal and colonic digesta microbiota of the CON and OB groups; ( C ) the principal coordinates analysis (PCoA) plots of the microbial communities at operational taxon unit (OUT) level. Values are mean ± SEM, n = 4. * Compared with the control p
    Figure Legend Snippet: The microbiota α- and β-diversity of the caecal (E) and colonic (O) digesta from growing pigs fed either control (CON) or oat bran diet (OB). Each symbol represents a different group. ( A ) The Sobs index of the caecal and colonic digesta microbiota of the CON and OB groups; ( B ) the Shannon index of the caecal and colonic digesta microbiota of the CON and OB groups; ( C ) the principal coordinates analysis (PCoA) plots of the microbial communities at operational taxon unit (OUT) level. Values are mean ± SEM, n = 4. * Compared with the control p

    Techniques Used:

    3) Product Images from "Metagenomics Reveals Seasonal Functional Adaptation of the Gut Microbiome to Host Feeding and Fasting in the Chinese Alligator"

    Article Title: Metagenomics Reveals Seasonal Functional Adaptation of the Gut Microbiome to Host Feeding and Fasting in the Chinese Alligator

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2019.02409

    (A) Relative abundance of the top 10 phyla in each sample based on 16S rRNA gene sequencing. (B) Bacterial taxa significantly differentiated between hibernation and the active state, as determined by LEfSe. LDA scores were interpreted as the degree of difference in relative abundance. A1-6, six independent alligator individual 1–6; AAs, amino acids; C_, class; F_, family; G_, genus; O_, order; P_, phylum; Peps, peptides; S_, species.
    Figure Legend Snippet: (A) Relative abundance of the top 10 phyla in each sample based on 16S rRNA gene sequencing. (B) Bacterial taxa significantly differentiated between hibernation and the active state, as determined by LEfSe. LDA scores were interpreted as the degree of difference in relative abundance. A1-6, six independent alligator individual 1–6; AAs, amino acids; C_, class; F_, family; G_, genus; O_, order; P_, phylum; Peps, peptides; S_, species.

    Techniques Used: Sequencing, Atomic Absorption Spectroscopy

    4) Product Images from "Effects of Oat Bran on Nutrient Digestibility, Intestinal Microbiota, and Inflammatory Responses in the Hindgut of Growing Pigs"

    Article Title: Effects of Oat Bran on Nutrient Digestibility, Intestinal Microbiota, and Inflammatory Responses in the Hindgut of Growing Pigs

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19082407

    The microbiota α- and β-diversity of the caecal (E) and colonic (O) digesta from growing pigs fed either control (CON) or oat bran diet (OB). Each symbol represents a different group. ( A ) The Sobs index of the caecal and colonic digesta microbiota of the CON and OB groups; ( B ) the Shannon index of the caecal and colonic digesta microbiota of the CON and OB groups; ( C ) the principal coordinates analysis (PCoA) plots of the microbial communities at operational taxon unit (OUT) level. Values are mean ± SEM, n = 4. * Compared with the control p
    Figure Legend Snippet: The microbiota α- and β-diversity of the caecal (E) and colonic (O) digesta from growing pigs fed either control (CON) or oat bran diet (OB). Each symbol represents a different group. ( A ) The Sobs index of the caecal and colonic digesta microbiota of the CON and OB groups; ( B ) the Shannon index of the caecal and colonic digesta microbiota of the CON and OB groups; ( C ) the principal coordinates analysis (PCoA) plots of the microbial communities at operational taxon unit (OUT) level. Values are mean ± SEM, n = 4. * Compared with the control p

    Techniques Used:

    5) Product Images from "Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits"

    Article Title: Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits

    Journal: BMC Research Notes

    doi: 10.1186/s13104-018-3549-5

    Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)
    Figure Legend Snippet: Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)

    Techniques Used: Real-time Polymerase Chain Reaction, DNA Extraction

    6) Product Images from "Flagellin-elicited adaptive immunity suppresses flagellated microbiota and vaccinates against chronic inflammatory diseases"

    Article Title: Flagellin-elicited adaptive immunity suppresses flagellated microbiota and vaccinates against chronic inflammatory diseases

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13538-y

    Beneficial effects of flagellin immunization are abolished in TCRβ KO mice. 4-week old C57BL/6 J TCRβ KO mice were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Next, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, j colon weight, and k colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05, n.s. indicates non-significant). ( N =4–5). Source data are provided as a Source Data file.
    Figure Legend Snippet: Beneficial effects of flagellin immunization are abolished in TCRβ KO mice. 4-week old C57BL/6 J TCRβ KO mice were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Next, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, j colon weight, and k colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05, n.s. indicates non-significant). ( N =4–5). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Confocal Microscopy, Expressing

    Specificity of the beneficial effects induced by flagellin immunization. 4-week old C57BL/6 J, wild-type mice, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, mice were treated with either flagellin (10 μg per mouse), TNF-α (50 μg/kg body weight), or Poly (I:C) (10 μg/kg body weight) via intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, and j colon weight. Colitis severity was assessed by k fecal lipocalin-2 concentration and l colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice). Source data are provided as a Source Data file.
    Figure Legend Snippet: Specificity of the beneficial effects induced by flagellin immunization. 4-week old C57BL/6 J, wild-type mice, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, mice were treated with either flagellin (10 μg per mouse), TNF-α (50 μg/kg body weight), or Poly (I:C) (10 μg/kg body weight) via intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, and j colon weight. Colitis severity was assessed by k fecal lipocalin-2 concentration and l colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Confocal Microscopy, Expressing, Concentration Assay

    Flagellin administration alters the intestinal microbiota toward a lower pro-inflammatory state. a Fecal pro-inflammatory potential was analyzed using HEK 293 cells expressing mTLR5 or mTLR4 measuring bioactive flagellin and lipopolysaccharide, respectively. b Colonic myeloperoxidase quantification of 4-week old, wild-type C57BL/6 J mice after receiving either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. c – f Colonic microbiota localization analysis of wild type and μMT mice treated with PBS, Salmonella -derived flagellin, or Bacillus -derived flagellin. c , e Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d , f Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. g Fecal bacterial load determined by qPCR analysis of 16 S bacterial DNA in the fecal contents of mice treated with PBS or flagellin. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Flagellin administration alters the intestinal microbiota toward a lower pro-inflammatory state. a Fecal pro-inflammatory potential was analyzed using HEK 293 cells expressing mTLR5 or mTLR4 measuring bioactive flagellin and lipopolysaccharide, respectively. b Colonic myeloperoxidase quantification of 4-week old, wild-type C57BL/6 J mice after receiving either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. c – f Colonic microbiota localization analysis of wild type and μMT mice treated with PBS, Salmonella -derived flagellin, or Bacillus -derived flagellin. c , e Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d , f Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. g Fecal bacterial load determined by qPCR analysis of 16 S bacterial DNA in the fecal contents of mice treated with PBS or flagellin. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Expressing, Mouse Assay, Derivative Assay, Confocal Microscopy, Real-time Polymerase Chain Reaction

    7) Product Images from "Flagellin-elicited adaptive immunity suppresses flagellated microbiota and vaccinates against chronic inflammatory diseases"

    Article Title: Flagellin-elicited adaptive immunity suppresses flagellated microbiota and vaccinates against chronic inflammatory diseases

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13538-y

    Beneficial effects of flagellin immunization are abolished in TCRβ KO mice. 4-week old C57BL/6 J TCRβ KO mice were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Next, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, j colon weight, and k colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05, n.s. indicates non-significant). ( N =4–5). Source data are provided as a Source Data file.
    Figure Legend Snippet: Beneficial effects of flagellin immunization are abolished in TCRβ KO mice. 4-week old C57BL/6 J TCRβ KO mice were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Next, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, j colon weight, and k colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05, n.s. indicates non-significant). ( N =4–5). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Confocal Microscopy, Expressing

    Specificity of the beneficial effects induced by flagellin immunization. 4-week old C57BL/6 J, wild-type mice, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, mice were treated with either flagellin (10 μg per mouse), TNF-α (50 μg/kg body weight), or Poly (I:C) (10 μg/kg body weight) via intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, and j colon weight. Colitis severity was assessed by k fecal lipocalin-2 concentration and l colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice). Source data are provided as a Source Data file.
    Figure Legend Snippet: Specificity of the beneficial effects induced by flagellin immunization. 4-week old C57BL/6 J, wild-type mice, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, mice were treated with either flagellin (10 μg per mouse), TNF-α (50 μg/kg body weight), or Poly (I:C) (10 μg/kg body weight) via intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, and j colon weight. Colitis severity was assessed by k fecal lipocalin-2 concentration and l colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Confocal Microscopy, Expressing, Concentration Assay

    Flagellin immunization protected against high-fat diet-induced obesity. a Flagellin load ( y axis) inversely correlate with anti-flagellin IgA concentration ( x axis) in humans. R2 represents the coefficient of determination. b Mean concentration ± S.E.M. of flagellin load and anti-flagellin IgA concentration for human subjects segregated by their BMI to normal (18.5–24.9, N = 17), overweight (25–29.9, N = 11) or obese ( > 30, N = 15). Flagellin concentration is denoted on the left y axis and anti-flagellin IgA concentration is denoted on the right y axis. # P
    Figure Legend Snippet: Flagellin immunization protected against high-fat diet-induced obesity. a Flagellin load ( y axis) inversely correlate with anti-flagellin IgA concentration ( x axis) in humans. R2 represents the coefficient of determination. b Mean concentration ± S.E.M. of flagellin load and anti-flagellin IgA concentration for human subjects segregated by their BMI to normal (18.5–24.9, N = 17), overweight (25–29.9, N = 11) or obese ( > 30, N = 15). Flagellin concentration is denoted on the left y axis and anti-flagellin IgA concentration is denoted on the right y axis. # P

    Techniques Used: Concentration Assay

    Systemic flagellin administrations elicit systemic and mucosal antibodies to flagellin. a 4-week old C57BL/6 J mice, wild type and TLR5/NLRC4 DKO, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Serum collection occurred on days −14, 0, 28, 56, and 63. Body weight measurements and fecal collection occurred prior to every flagellin administration. b – c Serum anti-flagellin IgA and IgG throughout the experiment, d – e fecal anti-flagellin IgA and IgG, f – g serum anti-flagellin IgA and IgG at day 56, h serum interleukin-6, and i CXCL1 at day 56 were analyzed using ELISA kits. j – k Fecal anti-flagellin IgA j and IgG k were also quantified up to 11 weeks after the final flagellin administration in mice receiving 6 weekly intraperitoneal injections of flagellin (10 μg per mouse). Data are the means ± S.E.M. Significance was determined using t test (** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant) or using one-way ANOVA corrected for multiple comparisons with a Bonferroni test ( # p ≤ 0.05 ## p ≤ 0.01 ### p ≤ 0.001 #### p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Systemic flagellin administrations elicit systemic and mucosal antibodies to flagellin. a 4-week old C57BL/6 J mice, wild type and TLR5/NLRC4 DKO, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Serum collection occurred on days −14, 0, 28, 56, and 63. Body weight measurements and fecal collection occurred prior to every flagellin administration. b – c Serum anti-flagellin IgA and IgG throughout the experiment, d – e fecal anti-flagellin IgA and IgG, f – g serum anti-flagellin IgA and IgG at day 56, h serum interleukin-6, and i CXCL1 at day 56 were analyzed using ELISA kits. j – k Fecal anti-flagellin IgA j and IgG k were also quantified up to 11 weeks after the final flagellin administration in mice receiving 6 weekly intraperitoneal injections of flagellin (10 μg per mouse). Data are the means ± S.E.M. Significance was determined using t test (** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant) or using one-way ANOVA corrected for multiple comparisons with a Bonferroni test ( # p ≤ 0.05 ## p ≤ 0.01 ### p ≤ 0.001 #### p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay

    Flagellin administration alters the intestinal microbiota towards a lower pro-inflammatory state. 4-week old C57BL/6 J Wild Type mice were purchased from The Jackson Laboratory and housed for two weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Fecal microbiota composition was analyzed using Illumina sequencing of the V4 region of 16 S rRNA genes. a – b Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix at a day −14 and b day 56 (post stabilization, post immunization). c LEfSe analysis was performed in order to investigate microbiota taxa that were significantly altered by immunization at day 56 (post stabilization, post immunization), with green and red colors highlighting taxa significantly more abundant in PBS- and flagellin-treated mice, respectively. d Percentage of IgA ± -coated bacteria in PBS- and FliC-treated mice, wherein the IgA − and IgA + gates were determined follows appropriate SSC-A/FSC-A gating of SytoBC + cells in wild-type and μMT mice. e Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix of IgA-coated bacteria. f Alpha diversity rarefaction using the Chao1 index of IgA-coated bacteria. g Taxa summarization of IgA-coated bacteria. In a and b , categories were compared and statistical significance of clustering were determined via Permanova. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Flagellin administration alters the intestinal microbiota towards a lower pro-inflammatory state. 4-week old C57BL/6 J Wild Type mice were purchased from The Jackson Laboratory and housed for two weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Fecal microbiota composition was analyzed using Illumina sequencing of the V4 region of 16 S rRNA genes. a – b Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix at a day −14 and b day 56 (post stabilization, post immunization). c LEfSe analysis was performed in order to investigate microbiota taxa that were significantly altered by immunization at day 56 (post stabilization, post immunization), with green and red colors highlighting taxa significantly more abundant in PBS- and flagellin-treated mice, respectively. d Percentage of IgA ± -coated bacteria in PBS- and FliC-treated mice, wherein the IgA − and IgA + gates were determined follows appropriate SSC-A/FSC-A gating of SytoBC + cells in wild-type and μMT mice. e Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix of IgA-coated bacteria. f Alpha diversity rarefaction using the Chao1 index of IgA-coated bacteria. g Taxa summarization of IgA-coated bacteria. In a and b , categories were compared and statistical significance of clustering were determined via Permanova. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Sequencing

    Flagellin administrations protect against immune dysregulation-induced colitis. 4–8-week old C57BL/6 J wild-type and μMT mice received either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. Biometric data of Wild Type animals represented by a body weight, b adipose weight, c spleen weight, d colon weight, e colon length, f and colon weight/length ratio. g Colonic myeloperoxidase levels. h Colon pathohistological scoring. i – j Serum interleukin-6 and CXCL1 following anti-IL-10R antibody regimen. Severity of colitis in μMT animal represented by k colon pathohistological scoring and l colon length. m – o Principal coordinate analysis of the Bray–Curtis distance using a matrix containing all the morphometric and molecular parameters presented in a – l . Data are the means ± S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 **** p ≤ 0.0001) or using one-way ANOVA corrected for multiple comparisons with a Bonferroni test (# p ≤ 0.05 ## p ≤ 0.01 ### p ≤ 0.001 #### p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of two representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Flagellin administrations protect against immune dysregulation-induced colitis. 4–8-week old C57BL/6 J wild-type and μMT mice received either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. Biometric data of Wild Type animals represented by a body weight, b adipose weight, c spleen weight, d colon weight, e colon length, f and colon weight/length ratio. g Colonic myeloperoxidase levels. h Colon pathohistological scoring. i – j Serum interleukin-6 and CXCL1 following anti-IL-10R antibody regimen. Severity of colitis in μMT animal represented by k colon pathohistological scoring and l colon length. m – o Principal coordinate analysis of the Bray–Curtis distance using a matrix containing all the morphometric and molecular parameters presented in a – l . Data are the means ± S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 **** p ≤ 0.0001) or using one-way ANOVA corrected for multiple comparisons with a Bonferroni test (# p ≤ 0.05 ## p ≤ 0.01 ### p ≤ 0.001 #### p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of two representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay

    Flagellin administration alters the intestinal microbiota toward a lower pro-inflammatory state. a Fecal pro-inflammatory potential was analyzed using HEK 293 cells expressing mTLR5 or mTLR4 measuring bioactive flagellin and lipopolysaccharide, respectively. b Colonic myeloperoxidase quantification of 4-week old, wild-type C57BL/6 J mice after receiving either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. c – f Colonic microbiota localization analysis of wild type and μMT mice treated with PBS, Salmonella -derived flagellin, or Bacillus -derived flagellin. c , e Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d , f Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. g Fecal bacterial load determined by qPCR analysis of 16 S bacterial DNA in the fecal contents of mice treated with PBS or flagellin. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Flagellin administration alters the intestinal microbiota toward a lower pro-inflammatory state. a Fecal pro-inflammatory potential was analyzed using HEK 293 cells expressing mTLR5 or mTLR4 measuring bioactive flagellin and lipopolysaccharide, respectively. b Colonic myeloperoxidase quantification of 4-week old, wild-type C57BL/6 J mice after receiving either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. c – f Colonic microbiota localization analysis of wild type and μMT mice treated with PBS, Salmonella -derived flagellin, or Bacillus -derived flagellin. c , e Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d , f Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. g Fecal bacterial load determined by qPCR analysis of 16 S bacterial DNA in the fecal contents of mice treated with PBS or flagellin. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Expressing, Mouse Assay, Derivative Assay, Confocal Microscopy, Real-time Polymerase Chain Reaction

    8) Product Images from "Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits"

    Article Title: Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits

    Journal: BMC Research Notes

    doi: 10.1186/s13104-018-3549-5

    Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)
    Figure Legend Snippet: Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)

    Techniques Used: Real-time Polymerase Chain Reaction, DNA Extraction

    9) Product Images from "Flagellin-elicited adaptive immunity suppresses flagellated microbiota and vaccinates against chronic inflammatory diseases"

    Article Title: Flagellin-elicited adaptive immunity suppresses flagellated microbiota and vaccinates against chronic inflammatory diseases

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13538-y

    Beneficial effects of flagellin immunization are abolished in TCRβ KO mice. 4-week old C57BL/6 J TCRβ KO mice were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Next, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, j colon weight, and k colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05, n.s. indicates non-significant). ( N =4–5). Source data are provided as a Source Data file.
    Figure Legend Snippet: Beneficial effects of flagellin immunization are abolished in TCRβ KO mice. 4-week old C57BL/6 J TCRβ KO mice were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Next, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, j colon weight, and k colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05, n.s. indicates non-significant). ( N =4–5). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Confocal Microscopy, Expressing

    Specificity of the beneficial effects induced by flagellin immunization. 4-week old C57BL/6 J, wild-type mice, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, mice were treated with either flagellin (10 μg per mouse), TNF-α (50 μg/kg body weight), or Poly (I:C) (10 μg/kg body weight) via intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, and j colon weight. Colitis severity was assessed by k fecal lipocalin-2 concentration and l colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice). Source data are provided as a Source Data file.
    Figure Legend Snippet: Specificity of the beneficial effects induced by flagellin immunization. 4-week old C57BL/6 J, wild-type mice, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, mice were treated with either flagellin (10 μg per mouse), TNF-α (50 μg/kg body weight), or Poly (I:C) (10 μg/kg body weight) via intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Subsequently, animals were treated weekly for 4 weeks by 1 mg of anti-IL-10R antibody intraperitoneally to induce intestinal inflammation. a – b Fecal anti-flagellin IgA and IgG quantified using ELISA. c Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. e – f Fecal flagellin and LPS quantified using HEK 293 cells expressing mTLR5 or mTLR4. g Body weight, h spleen weight, i colon length, and j colon weight. Colitis severity was assessed by k fecal lipocalin-2 concentration and l colon pathohistological scoring. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Confocal Microscopy, Expressing, Concentration Assay

    Systemic flagellin administrations elicit systemic and mucosal antibodies to flagellin. a 4-week old C57BL/6 J mice, wild type and TLR5/NLRC4 DKO, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Serum collection occurred on days −14, 0, 28, 56, and 63. Body weight measurements and fecal collection occurred prior to every flagellin administration. b – c Serum anti-flagellin IgA and IgG throughout the experiment, d – e fecal anti-flagellin IgA and IgG, f – g serum anti-flagellin IgA and IgG at day 56, h serum interleukin-6, and i CXCL1 at day 56 were analyzed using ELISA kits. j – k Fecal anti-flagellin IgA j and IgG k were also quantified up to 11 weeks after the final flagellin administration in mice receiving 6 weekly intraperitoneal injections of flagellin (10 μg per mouse). Data are the means ± S.E.M. Significance was determined using t test (** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant) or using one-way ANOVA corrected for multiple comparisons with a Bonferroni test ( # p ≤ 0.05 ## p ≤ 0.01 ### p ≤ 0.001 #### p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Systemic flagellin administrations elicit systemic and mucosal antibodies to flagellin. a 4-week old C57BL/6 J mice, wild type and TLR5/NLRC4 DKO, were purchased from The Jackson Laboratory and housed for 2 weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Serum collection occurred on days −14, 0, 28, 56, and 63. Body weight measurements and fecal collection occurred prior to every flagellin administration. b – c Serum anti-flagellin IgA and IgG throughout the experiment, d – e fecal anti-flagellin IgA and IgG, f – g serum anti-flagellin IgA and IgG at day 56, h serum interleukin-6, and i CXCL1 at day 56 were analyzed using ELISA kits. j – k Fecal anti-flagellin IgA j and IgG k were also quantified up to 11 weeks after the final flagellin administration in mice receiving 6 weekly intraperitoneal injections of flagellin (10 μg per mouse). Data are the means ± S.E.M. Significance was determined using t test (** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant) or using one-way ANOVA corrected for multiple comparisons with a Bonferroni test ( # p ≤ 0.05 ## p ≤ 0.01 ### p ≤ 0.001 #### p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay

    Flagellin administration alters the intestinal microbiota towards a lower pro-inflammatory state. 4-week old C57BL/6 J Wild Type mice were purchased from The Jackson Laboratory and housed for two weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Fecal microbiota composition was analyzed using Illumina sequencing of the V4 region of 16 S rRNA genes. a – b Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix at a day −14 and b day 56 (post stabilization, post immunization). c LEfSe analysis was performed in order to investigate microbiota taxa that were significantly altered by immunization at day 56 (post stabilization, post immunization), with green and red colors highlighting taxa significantly more abundant in PBS- and flagellin-treated mice, respectively. d Percentage of IgA ± -coated bacteria in PBS- and FliC-treated mice, wherein the IgA − and IgA + gates were determined follows appropriate SSC-A/FSC-A gating of SytoBC + cells in wild-type and μMT mice. e Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix of IgA-coated bacteria. f Alpha diversity rarefaction using the Chao1 index of IgA-coated bacteria. g Taxa summarization of IgA-coated bacteria. In a and b , categories were compared and statistical significance of clustering were determined via Permanova. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Flagellin administration alters the intestinal microbiota towards a lower pro-inflammatory state. 4-week old C57BL/6 J Wild Type mice were purchased from The Jackson Laboratory and housed for two weeks before procedure in order to favor microbiota stabilization. Subsequently, flagellin (10 μg per mouse) was administered by intraperitoneal injections weekly for 9 weeks, whereas control mice received vehicle (PBS). Fecal microbiota composition was analyzed using Illumina sequencing of the V4 region of 16 S rRNA genes. a – b Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix at a day −14 and b day 56 (post stabilization, post immunization). c LEfSe analysis was performed in order to investigate microbiota taxa that were significantly altered by immunization at day 56 (post stabilization, post immunization), with green and red colors highlighting taxa significantly more abundant in PBS- and flagellin-treated mice, respectively. d Percentage of IgA ± -coated bacteria in PBS- and FliC-treated mice, wherein the IgA − and IgA + gates were determined follows appropriate SSC-A/FSC-A gating of SytoBC + cells in wild-type and μMT mice. e Principal coordinates analysis (PCoA) of the unweighted UniFrac distance matrix of IgA-coated bacteria. f Alpha diversity rarefaction using the Chao1 index of IgA-coated bacteria. g Taxa summarization of IgA-coated bacteria. In a and b , categories were compared and statistical significance of clustering were determined via Permanova. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Mouse Assay, Sequencing

    Flagellin administration alters the intestinal microbiota toward a lower pro-inflammatory state. a Fecal pro-inflammatory potential was analyzed using HEK 293 cells expressing mTLR5 or mTLR4 measuring bioactive flagellin and lipopolysaccharide, respectively. b Colonic myeloperoxidase quantification of 4-week old, wild-type C57BL/6 J mice after receiving either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. c – f Colonic microbiota localization analysis of wild type and μMT mice treated with PBS, Salmonella -derived flagellin, or Bacillus -derived flagellin. c , e Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d , f Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. g Fecal bacterial load determined by qPCR analysis of 16 S bacterial DNA in the fecal contents of mice treated with PBS or flagellin. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.
    Figure Legend Snippet: Flagellin administration alters the intestinal microbiota toward a lower pro-inflammatory state. a Fecal pro-inflammatory potential was analyzed using HEK 293 cells expressing mTLR5 or mTLR4 measuring bioactive flagellin and lipopolysaccharide, respectively. b Colonic myeloperoxidase quantification of 4-week old, wild-type C57BL/6 J mice after receiving either vehicle or 10 μg of flagellin by intraperitoneal injections weekly for 9 weeks. c – f Colonic microbiota localization analysis of wild type and μMT mice treated with PBS, Salmonella -derived flagellin, or Bacillus -derived flagellin. c , e Confocal microscopy analysis of colonic microbiota localization; Muc2 (green), actin (purple), bacteria (red), and DNA (blue). d , f Distances of closest bacteria to colonic intestinal epithelial cells (IEC) per condition over 2–3 high-powered fields per mouse. g Fecal bacterial load determined by qPCR analysis of 16 S bacterial DNA in the fecal contents of mice treated with PBS or flagellin. Data are the means ±S.E.M. Significance was determined using t test (* p ≤ 0.05 ** p ≤ 0.01 *** p ≤ 0.001 **** p ≤ 0.0001, n.s. indicates non-significant). ( N =4–5 mice from one out of three representative experiment). Source data are provided as a Source Data file.

    Techniques Used: Expressing, Mouse Assay, Derivative Assay, Confocal Microscopy, Real-time Polymerase Chain Reaction

    10) Product Images from "Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species"

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species

    Journal: Infection Ecology & Epidemiology

    doi: 10.1080/20008686.2017.1386536

    Agarose gel electrophoresis of C. jejuni -specific PCR with mallard eluates. (a) PCR products from DNA samples extracted with four different kits. Top row from left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit and DNeasy Blood Tissue Kit (sample S1). Bottom row from left: DNeasy Blood Tissue Kit (samples S2 and S3) and QIAamp cador Pathogen Kit. Faint bands were detected in samples extracted with DNeasy Blood Tissue kit and QIAamp cador Pathogen kit (bottom row). (b) Intense bands visible in samples pretreated with combined heat-shock and bead beating and extracted with the QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , consecutive samples. NC , negative control. PC , positive control.
    Figure Legend Snippet: Agarose gel electrophoresis of C. jejuni -specific PCR with mallard eluates. (a) PCR products from DNA samples extracted with four different kits. Top row from left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit and DNeasy Blood Tissue Kit (sample S1). Bottom row from left: DNeasy Blood Tissue Kit (samples S2 and S3) and QIAamp cador Pathogen Kit. Faint bands were detected in samples extracted with DNeasy Blood Tissue kit and QIAamp cador Pathogen kit (bottom row). (b) Intense bands visible in samples pretreated with combined heat-shock and bead beating and extracted with the QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , consecutive samples. NC , negative control. PC , positive control.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Positive Control

    Agarose gel electrophoresis of kit eluates. (a) DNA yields after extraction with four different kits. From left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit, DNeasy Blood Tissue Kit and QIAamp cador Pathogen Kit. Faint smears observed in the DNeasy Blood Tissue kit and the QIAamp cador Pathogen kit lanes. (b) DNA yields after bead beating pretreatment and extraction with QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , fecal extracts.
    Figure Legend Snippet: Agarose gel electrophoresis of kit eluates. (a) DNA yields after extraction with four different kits. From left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit, DNeasy Blood Tissue Kit and QIAamp cador Pathogen Kit. Faint smears observed in the DNeasy Blood Tissue kit and the QIAamp cador Pathogen kit lanes. (b) DNA yields after bead beating pretreatment and extraction with QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , fecal extracts.

    Techniques Used: Agarose Gel Electrophoresis

    11) Product Images from "Development of a novel detection system for microbes from bovine diarrhea by real-time PCR"

    Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR

    Journal: The Journal of Veterinary Medical Science

    doi: 10.1292/jvms.15-0552

    Dembo-PCR workflow. To prepare each sample for assay, 10% fecal suspensions were made in PBS (−). The suspensions were then used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit. For virus detection, the suspensions were centrifuged for 15 min at 10,000 rpm, and viral DNA and RNA were extracted from the supernatants with a High Pure Viral Nucleic Acid Kit. After pathogen RNA and DNA were extracted, samples, reagents and each primer and probe were mixed in individual reaction tubes. Samples were applied at 2 µl per tube. A LightCycler Nano was used for all qPCR reactions performed in this study. A one step PrimeScript RT-PCR Kit (Perfect Real time) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) was used for amplification of extracts from DNA viruses, bacteria and protozoa.
    Figure Legend Snippet: Dembo-PCR workflow. To prepare each sample for assay, 10% fecal suspensions were made in PBS (−). The suspensions were then used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit. For virus detection, the suspensions were centrifuged for 15 min at 10,000 rpm, and viral DNA and RNA were extracted from the supernatants with a High Pure Viral Nucleic Acid Kit. After pathogen RNA and DNA were extracted, samples, reagents and each primer and probe were mixed in individual reaction tubes. Samples were applied at 2 µl per tube. A LightCycler Nano was used for all qPCR reactions performed in this study. A one step PrimeScript RT-PCR Kit (Perfect Real time) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) was used for amplification of extracts from DNA viruses, bacteria and protozoa.

    Techniques Used: Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Amplification

    Related Articles

    Diagnostic Assay:

    Article Title: Could the domestic cat play a significant role in the transmission of Echinococcus multilocularis? A study based on qPCR analysis of cat feces in a rural area in France
    Article Snippet: .. Copro-DNA extraction, qPCR protocols, and E. multilocularis diagnostic confirmation The copro-DNA was purified using the QIAamp Fast DNA Stool kit, following the manufacturer’s recommendations (Qiagen, Hilden, Germany), on 0.5 g of sample, and eluted in 200 μL of the elution buffer provided. .. From the copro-DNA, a host fecal PCR test was performed to confirm the feces host identity.

    Clone Assay:

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. For the standard curve, DNA from Pseudomonas denitrificans isolated from stool of a C57BL/6 mouse was amplified using the primers mentioned above and cloned into a TOPO vector (TOPO TA Cloning Kit for Sequencing; Invitrogen).

    Centrifugation:

    Article Title: Diversity and functions of the sheep faecal microbiota: a multi‐omic characterization
    Article Snippet: Briefly, faecal samples (weighing approximately 100 mg each) were resuspended in PBS and subjected to low‐speed centrifugation to eliminate gross particulate material for a total of three rounds. .. DNA extraction was performed in parallel using two commercial kits, namely the QIAamp Fast DNA Stool Kit (Qiagen, Hilden, Germany) and the E.Z.N.A.

    Amplification:

    Article Title: Could the domestic cat play a significant role in the transmission of Echinococcus multilocularis? A study based on qPCR analysis of cat feces in a rural area in France
    Article Snippet: Copro-DNA extraction, qPCR protocols, and E. multilocularis diagnostic confirmation The copro-DNA was purified using the QIAamp Fast DNA Stool kit, following the manufacturer’s recommendations (Qiagen, Hilden, Germany), on 0.5 g of sample, and eluted in 200 μL of the elution buffer provided. .. The test was carried out with real-time quantitative PCR (qPCR) as previously described, based on the amplification of a fragment of the cytB gene [ ] (Vv-qPCR for Vulpes vulpes , Cf-qPCR for Canis familiaris , Fc-qPCR for Felis catus , Mm-qPCR for Meles meles , and Mf-qPCR for Martes foina ).

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. For the standard curve, DNA from Pseudomonas denitrificans isolated from stool of a C57BL/6 mouse was amplified using the primers mentioned above and cloned into a TOPO vector (TOPO TA Cloning Kit for Sequencing; Invitrogen).

    Synthesized:

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: For SAA mRNA expression, primers were synthesized and melting curve analysis was performed to ensure a single product. .. To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen).

    TA Cloning:

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. For the standard curve, DNA from Pseudomonas denitrificans isolated from stool of a C57BL/6 mouse was amplified using the primers mentioned above and cloned into a TOPO vector (TOPO TA Cloning Kit for Sequencing; Invitrogen).

    Quantitative RT-PCR:

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: Paragraph title: Quantitative RT-PCR. ... To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen).

    SYBR Green Assay:

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. The numbers of intestinal bacteria were determined by qPCR using SYBR Green Master kit (Bio‐Rad) and the following primers: Eubacteria‐F: 5′‐ACTCCTACGGGAGGCAGCAGT‐3′; and Eubacteria‐R 5′‐ATTACCGCGGCTGCTGGC‐3′.

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: Real-time PCR was performed on a 7900HT Sequence Detection System (Applied Biosystems) using PerfeCta FastMix II or PerfeCta SYBR Green FastMix (Quanta Biosciences). .. To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen).

    Incubation:

    Article Title: Development and Evaluation of a Loop-Mediated Isothermal Amplification Assay for Diagnosis of Schistosoma mansoni Infection in Faecal Samples
    Article Snippet: Genomic DNA was extracted from freshly collected mice or human faecal samples using the QIAMP fast DNA stool mini kit from Qiagen (Catalogue No. 51604) following the manufacturer's instructions. .. Buffer AL (200 µ l) was added and mixed by vortexing for 15s followed by incubation in a water bath for 10mins at 70°C.

    Expressing:

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: Quantitative expression was normalized to transcript levels of GAPDH using the equation 1/2∆Ct , where ∆Ct = CtTarget − CtGAPDH . .. To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen).

    Generated:

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: Total RNA was extracted from homogenized tissues or sorted cells using RNeasy Kit (Qiagen) and cDNA was generated with qScript cDNA Synthesis Kit (Quanta Biosciences). .. To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Could the domestic cat play a significant role in the transmission of Echinococcus multilocularis? A study based on qPCR analysis of cat feces in a rural area in France
    Article Snippet: Copro-DNA extraction, qPCR protocols, and E. multilocularis diagnostic confirmation The copro-DNA was purified using the QIAamp Fast DNA Stool kit, following the manufacturer’s recommendations (Qiagen, Hilden, Germany), on 0.5 g of sample, and eluted in 200 μL of the elution buffer provided. .. From the copro-DNA, a host fecal PCR test was performed to confirm the feces host identity.

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species
    Article Snippet: The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen). .. The pretreated samples then entered the extraction process and the eluates from the extractions were finally evaluated quantitatively by NanoDrop and/or Qubit, as well as qualitatively by agarose gel electrophoresis and/or performance in PCR.

    Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
    Article Snippet: Furthermore, PCR products were used as β-actin positive controls, which were created from Mardin-Darby bovine kidney (MDBK) cells using conventional PCR primers (data not shown). .. Then, 200 µl of a suspension was used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany).

    DNA Extraction:

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species
    Article Snippet: .. The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen). ..

    Article Title: Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits
    Article Snippet: .. The following kits were evaluated: PowerSoil® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), QIAamp® Fast DNA Stool Mini Kit and QIAamp® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), and NucleoSpin® Soil (Macherey–Nagel, Duren, Germany). .. For NucleoSpin® Soil, sample lysis was performed with the optional enhancer SX solution and SL1 buffer.

    Article Title: Development and Evaluation of a Loop-Mediated Isothermal Amplification Assay for Diagnosis of Schistosoma mansoni Infection in Faecal Samples
    Article Snippet: Paragraph title: 2.3. Parasite DNA Extraction ... Genomic DNA was extracted from freshly collected mice or human faecal samples using the QIAMP fast DNA stool mini kit from Qiagen (Catalogue No. 51604) following the manufacturer's instructions.

    Article Title: Alterations of the Gut Microbiota in Multiple System Atrophy Patients
    Article Snippet: Paragraph title: Sample Collection and DNA Extraction ... QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany) was used to extract DNA from fecal samples.

    Article Title: Diversity and functions of the sheep faecal microbiota: a multi‐omic characterization
    Article Snippet: .. DNA extraction was performed in parallel using two commercial kits, namely the QIAamp Fast DNA Stool Kit (Qiagen, Hilden, Germany) and the E.Z.N.A. .. Soil DNA Kit (Omega Bio‐Tek, Norcross, GA, USA), according to the respective manufacturers’ instructions.

    Isolation:

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. For the standard curve, DNA from Pseudomonas denitrificans isolated from stool of a C57BL/6 mouse was amplified using the primers mentioned above and cloned into a TOPO vector (TOPO TA Cloning Kit for Sequencing; Invitrogen).

    RNA Extraction:

    Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
    Article Snippet: .. Pathogens were subjected to DNA and RNA extraction using a total elution volume of 25 µl with the High Pure Viral Nucleic Acid Kit and 20µl with the QIAamp fast DNA Stool Mini Kit. ..

    Purification:

    Article Title: Could the domestic cat play a significant role in the transmission of Echinococcus multilocularis? A study based on qPCR analysis of cat feces in a rural area in France
    Article Snippet: .. Copro-DNA extraction, qPCR protocols, and E. multilocularis diagnostic confirmation The copro-DNA was purified using the QIAamp Fast DNA Stool kit, following the manufacturer’s recommendations (Qiagen, Hilden, Germany), on 0.5 g of sample, and eluted in 200 μL of the elution buffer provided. .. From the copro-DNA, a host fecal PCR test was performed to confirm the feces host identity.

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: .. To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen). .. For Helicobacter typhlonius qPCR, stool samples were collected from mice housed only with the same genotype, since these bacteria were present in strikingly high levels.

    Sequencing:

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. For the standard curve, DNA from Pseudomonas denitrificans isolated from stool of a C57BL/6 mouse was amplified using the primers mentioned above and cloned into a TOPO vector (TOPO TA Cloning Kit for Sequencing; Invitrogen).

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: Real-time PCR was performed on a 7900HT Sequence Detection System (Applied Biosystems) using PerfeCta FastMix II or PerfeCta SYBR Green FastMix (Quanta Biosciences). .. To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen).

    Agarose Gel Electrophoresis:

    Article Title: Illumina-based sequencing analysis of pathogenic microorganisms in dental caries patients of different Chinese ethnic groups
    Article Snippet: Extraction and quality control of total DNA Saliva samples were filtered using a 0.22-µm bacterial filter, then the filter was crushed and placed into the QIAamp Fast DNA Stool Mini Kit (Qiagen Inc., Valencia, CA, USA). .. The DNA integrity was analyzed by 2.0% agarose gel electrophoresis, and a quality purity assay was performed using a microplate reader (Molecular Devices, Sunnyvale, CA, USA).

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species
    Article Snippet: The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen). .. The pretreated samples then entered the extraction process and the eluates from the extractions were finally evaluated quantitatively by NanoDrop and/or Qubit, as well as qualitatively by agarose gel electrophoresis and/or performance in PCR.

    Article Title: Alterations of the Gut Microbiota in Multiple System Atrophy Patients
    Article Snippet: QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany) was used to extract DNA from fecal samples. .. The DNA integrity and concentration were tested by 1% agarose gel electrophoresis (AGE).

    Mouse Assay:

    Article Title: Development and Evaluation of a Loop-Mediated Isothermal Amplification Assay for Diagnosis of Schistosoma mansoni Infection in Faecal Samples
    Article Snippet: .. Genomic DNA was extracted from freshly collected mice or human faecal samples using the QIAMP fast DNA stool mini kit from Qiagen (Catalogue No. 51604) following the manufacturer's instructions. ..

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen). .. For Helicobacter typhlonius qPCR, stool samples were collected from mice housed only with the same genotype, since these bacteria were present in strikingly high levels.

    Plasmid Preparation:

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. For the standard curve, DNA from Pseudomonas denitrificans isolated from stool of a C57BL/6 mouse was amplified using the primers mentioned above and cloned into a TOPO vector (TOPO TA Cloning Kit for Sequencing; Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: Could the domestic cat play a significant role in the transmission of Echinococcus multilocularis? A study based on qPCR analysis of cat feces in a rural area in France
    Article Snippet: .. Copro-DNA extraction, qPCR protocols, and E. multilocularis diagnostic confirmation The copro-DNA was purified using the QIAamp Fast DNA Stool kit, following the manufacturer’s recommendations (Qiagen, Hilden, Germany), on 0.5 g of sample, and eluted in 200 μL of the elution buffer provided. .. From the copro-DNA, a host fecal PCR test was performed to confirm the feces host identity.

    Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
    Article Snippet: Then, 200 µl of a suspension was used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany). .. A LightCycler Nano (Roche Diagnostics GmbH) was used for all qPCR reactions performed in this study.

    Article Title: CD1d‐mediated lipid presentation by CD11c+ cells regulates intestinal homeostasis
    Article Snippet: Bacterial DNA was obtained from stool, ileum content and ileum wall using QIAamp Fast DNA Stool Kit (Qiagen), following the manufacturer's instructions. .. The numbers of intestinal bacteria were determined by qPCR using SYBR Green Master kit (Bio‐Rad) and the following primers: Eubacteria‐F: 5′‐ACTCCTACGGGAGGCAGCAGT‐3′; and Eubacteria‐R 5′‐ATTACCGCGGCTGCTGGC‐3′.

    Article Title: Defective IgA response to atypical intestinal commensals in IL-21 receptor deficiency reshapes immune cell homeostasis and mucosal immunity
    Article Snippet: Real-time PCR was performed on a 7900HT Sequence Detection System (Applied Biosystems) using PerfeCta FastMix II or PerfeCta SYBR Green FastMix (Quanta Biosciences). .. To assess the levels of various bacteria in fecal pellets, DNA was purified using QIAamp Fast DNA Stool Kit (Qiagen).

    Negative Control:

    Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
    Article Snippet: Nuclease-free water was applied as a negative control sample, again using β-actin primer-probe sets. .. Then, 200 µl of a suspension was used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany).

    Selection:

    Article Title: Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits
    Article Snippet: Paragraph title: Kit selection and DNA extraction ... The following kits were evaluated: PowerSoil® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), QIAamp® Fast DNA Stool Mini Kit and QIAamp® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), and NucleoSpin® Soil (Macherey–Nagel, Duren, Germany).

    Sample Prep:

    Article Title: Diversity and functions of the sheep faecal microbiota: a multi‐omic characterization
    Article Snippet: Paragraph title: DNA sample preparation ... DNA extraction was performed in parallel using two commercial kits, namely the QIAamp Fast DNA Stool Kit (Qiagen, Hilden, Germany) and the E.Z.N.A.

    Concentration Assay:

    Article Title: Alterations of the Gut Microbiota in Multiple System Atrophy Patients
    Article Snippet: QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany) was used to extract DNA from fecal samples. .. The DNA integrity and concentration were tested by 1% agarose gel electrophoresis (AGE).

    DNA Purification:

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species
    Article Snippet: .. The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen). ..

    Lysis:

    Article Title: Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits
    Article Snippet: The following kits were evaluated: PowerSoil® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), QIAamp® Fast DNA Stool Mini Kit and QIAamp® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), and NucleoSpin® Soil (Macherey–Nagel, Duren, Germany). .. For NucleoSpin® Soil, sample lysis was performed with the optional enhancer SX solution and SL1 buffer.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • qiaamp fast dna stool mini kit  (Qiagen)
    99
    Qiagen qiaamp fast dna stool mini kit
    Dembo-PCR workflow. To prepare each sample for assay, 10% fecal suspensions were made in PBS (−). The suspensions were then used directly for the extraction of bacteria and protozoa nucleic acids with a <t>QIAamp</t> Fast <t>DNA</t> Stool Mini Kit. For virus detection, the suspensions were centrifuged for 15 min at 10,000 rpm, and viral DNA and RNA were extracted from the supernatants with a High Pure Viral Nucleic Acid Kit. After pathogen RNA and DNA were extracted, samples, reagents and each primer and probe were mixed in individual reaction tubes. Samples were applied at 2 µl per tube. A LightCycler Nano was used for all qPCR reactions performed in this study. A one step PrimeScript RT-PCR Kit (Perfect Real time) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) was used for amplification of extracts from DNA viruses, bacteria and protozoa.
    Qiaamp Fast Dna Stool Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaamp fast dna stool mini kit/product/Qiagen
    Average 99 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    qiaamp fast dna stool mini kit - by Bioz Stars, 2020-04
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Dembo-PCR workflow. To prepare each sample for assay, 10% fecal suspensions were made in PBS (−). The suspensions were then used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit. For virus detection, the suspensions were centrifuged for 15 min at 10,000 rpm, and viral DNA and RNA were extracted from the supernatants with a High Pure Viral Nucleic Acid Kit. After pathogen RNA and DNA were extracted, samples, reagents and each primer and probe were mixed in individual reaction tubes. Samples were applied at 2 µl per tube. A LightCycler Nano was used for all qPCR reactions performed in this study. A one step PrimeScript RT-PCR Kit (Perfect Real time) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) was used for amplification of extracts from DNA viruses, bacteria and protozoa.

    Journal: The Journal of Veterinary Medical Science

    Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR

    doi: 10.1292/jvms.15-0552

    Figure Lengend Snippet: Dembo-PCR workflow. To prepare each sample for assay, 10% fecal suspensions were made in PBS (−). The suspensions were then used directly for the extraction of bacteria and protozoa nucleic acids with a QIAamp Fast DNA Stool Mini Kit. For virus detection, the suspensions were centrifuged for 15 min at 10,000 rpm, and viral DNA and RNA were extracted from the supernatants with a High Pure Viral Nucleic Acid Kit. After pathogen RNA and DNA were extracted, samples, reagents and each primer and probe were mixed in individual reaction tubes. Samples were applied at 2 µl per tube. A LightCycler Nano was used for all qPCR reactions performed in this study. A one step PrimeScript RT-PCR Kit (Perfect Real time) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) was used for amplification of extracts from DNA viruses, bacteria and protozoa.

    Article Snippet: Pathogens were subjected to DNA and RNA extraction using a total elution volume of 25 µl with the High Pure Viral Nucleic Acid Kit and 20µl with the QIAamp fast DNA Stool Mini Kit.

    Techniques: Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Amplification

    Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)

    Journal: BMC Research Notes

    Article Title: Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits

    doi: 10.1186/s13104-018-3549-5

    Figure Lengend Snippet: Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)

    Article Snippet: The following kits were evaluated: PowerSoil® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), QIAamp® Fast DNA Stool Mini Kit and QIAamp® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), and NucleoSpin® Soil (Macherey–Nagel, Duren, Germany).

    Techniques: Real-time Polymerase Chain Reaction, DNA Extraction

    Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)

    Journal: BMC Research Notes

    Article Title: Detection of Clostridium botulinum group III in environmental samples from farms by real-time PCR using four commercial DNA extraction kits

    doi: 10.1186/s13104-018-3549-5

    Figure Lengend Snippet: Number of samples in which C. botulinum group III was detected using real-time PCR according to the DNA extraction kit used and the analyzed matrix. Total: number of samples analyzed per matrix. QA QIAamp ® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), QF QIAamp ® Fast DNA Stool Mini Kit (QIAGEN Inc., Valencia, CA, USA), PS PowerSoil ® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), NS NucleoSpin ® Soil (Macherey–Nagel, Duren, Germany)

    Article Snippet: The following kits were evaluated: PowerSoil® DNA isolation kit (Mo Bio Laboratories Inc., Carlsbad, CA, USA), QIAamp® Fast DNA Stool Mini Kit and QIAamp® DNA Mini Kit (QIAGEN Inc., Valencia, CA, USA), and NucleoSpin® Soil (Macherey–Nagel, Duren, Germany).

    Techniques: Real-time Polymerase Chain Reaction, DNA Extraction

    Agarose gel electrophoresis of C. jejuni -specific PCR with mallard eluates. (a) PCR products from DNA samples extracted with four different kits. Top row from left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit and DNeasy Blood Tissue Kit (sample S1). Bottom row from left: DNeasy Blood Tissue Kit (samples S2 and S3) and QIAamp cador Pathogen Kit. Faint bands were detected in samples extracted with DNeasy Blood Tissue kit and QIAamp cador Pathogen kit (bottom row). (b) Intense bands visible in samples pretreated with combined heat-shock and bead beating and extracted with the QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , consecutive samples. NC , negative control. PC , positive control.

    Journal: Infection Ecology & Epidemiology

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species

    doi: 10.1080/20008686.2017.1386536

    Figure Lengend Snippet: Agarose gel electrophoresis of C. jejuni -specific PCR with mallard eluates. (a) PCR products from DNA samples extracted with four different kits. Top row from left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit and DNeasy Blood Tissue Kit (sample S1). Bottom row from left: DNeasy Blood Tissue Kit (samples S2 and S3) and QIAamp cador Pathogen Kit. Faint bands were detected in samples extracted with DNeasy Blood Tissue kit and QIAamp cador Pathogen kit (bottom row). (b) Intense bands visible in samples pretreated with combined heat-shock and bead beating and extracted with the QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , consecutive samples. NC , negative control. PC , positive control.

    Article Snippet: The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Positive Control

    Agarose gel electrophoresis of kit eluates. (a) DNA yields after extraction with four different kits. From left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit, DNeasy Blood Tissue Kit and QIAamp cador Pathogen Kit. Faint smears observed in the DNeasy Blood Tissue kit and the QIAamp cador Pathogen kit lanes. (b) DNA yields after bead beating pretreatment and extraction with QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , fecal extracts.

    Journal: Infection Ecology & Epidemiology

    Article Title: Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species

    doi: 10.1080/20008686.2017.1386536

    Figure Lengend Snippet: Agarose gel electrophoresis of kit eluates. (a) DNA yields after extraction with four different kits. From left: QIAamp Fast DNA Stool Mini Kit, QIAamp DNA Stool Mini Kit, DNeasy Blood Tissue Kit and QIAamp cador Pathogen Kit. Faint smears observed in the DNeasy Blood Tissue kit and the QIAamp cador Pathogen kit lanes. (b) DNA yields after bead beating pretreatment and extraction with QIAamp cador Pathogen kit. L , DNA ladder. S1, S2 and S3 , fecal extracts.

    Article Snippet: The six DNA extraction kits evaluated were the following: PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, USA), Maxwell 16 Tissue DNA Purification Kit (Promega Biotech AB, Stockholm, Sweden), DNeasy Blood & Tissue Kit (Qiagen), QIAamp Fast DNA Stool Mini Kit (Qiagen), QIAamp DNA Stool Mini Kit (Qiagen) and QIAamp cador Pathogen Kit (Qiagen).

    Techniques: Agarose Gel Electrophoresis