Structured Review

Illumina Inc bp single end protocol
Bp Single End Protocol, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 1153 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bp single end protocol/product/Illumina Inc
Average 86 stars, based on 1153 article reviews
Price from $9.99 to $1999.99
bp single end protocol - by Bioz Stars, 2020-02
86/100 stars

Images

Related Articles

Centrifugation:

Article Title: Transcriptomic Changes in Response to Putrescine Production in Metabolically Engineered Corynebacterium glutamicum
Article Snippet: Transcriptome Analysis RNA-Seq was performed by GENWIZ (Shuzhou, China) using an Illumina HiSeq sequencer (Illumina, San Diego, CA, United States). .. Cells cultured for 48 h were harvested by centrifugation at 300 rpm for 2 min to remove CaCO3 and then at 5,000 × g for 15 min and washed twice with PBS.

Amplification:

Article Title: Hypoparathyroidism and central diabetes insipidus: in search of the link
Article Snippet: Whole-exome analyses were performed at the Broad Institute, Cambridge, MA, using the Agilent SureSelect Human All Exon Kit v2 followed by massively parallel sequencing using an Illumina HiSeq Sequencer. .. The PCR amplification products were directly sequenced using BigDye 3.1 Terminator chemistry (Applied Biosystems) and separated on an ABI 3500 genetic analyzer (Applied Biosystems, Foster City, CA).

Article Title: Identification and validation of QTLs for seedling salinity tolerance in introgression lines of a salt tolerant rice landrace ‘Pokkali’
Article Snippet: The PCR amplification was conducted with the following settings: initial denaturation at 94°C for 5 min, 35 cycles of 94°C for 45 sec, 55°C for 45 sec, 72°C for 1 min and a final extension at 72°C for 5 min. .. The Genomic Diversity Facility, Cornell University Institute of Biotechnology ( http://www.biotech.cornell.edu/brc/genomic-diversity-facility ) provided the GBS service that included the genomic DNA library construction following the method of Elshire et al. [ ], 288-plex sequencing using the Illumina HiSeq sequencer, and SNP calling based on the Nipponbare reference genome MSU release 7 [ ].

Article Title: β-catenin mediates behavioral resilience through Dicer1/microRNA regulation
Article Snippet: After removing RNA template by addition of RNase, the di-tagged cDNA was amplified and individually barcoded with nine PCR cycles using indices and PCR primers provided in the kit. .. Multiplexed libraries were then pooled and sequenced on an Illumina Hiseq sequencer.

Article Title: Single-cell transcriptome analysis of Physcomitrella leaf cells during reprogramming using microcapillary manipulation
Article Snippet: The content of each cell was transferred to a PCR tube and cDNA was synthesized using reverse transcription with an exonuclease I treatment, poly(dA) tailing, second-strand synthesis, and cDNA amplification. .. After quantification and qualification, these batches of NGS libraries were equally mixed and sequenced on an Illumina HiSeq sequencer set to generate 126-bp single-end reads and 18-bp index reads, including 8 bp of multiplex index and 10 bp of UMI.

Synthesized:

Article Title: Gel-free multiplexed reduced representation bisulfite sequencing for large-scale DNA methylation profiling
Article Snippet: To do this, we loaded a HiSeq 2000 with a custom recipe file co-developed with Illumina plus extra reagents to support primer re-hybridization. .. Next, the recipe removed the newly synthesized strand using NaOH and a buffer wash, re-hybridized fresh sequencing primer to the sample, and began read 1 data collection as usual from the first base but using the pre-existing cluster map or 'template' generated by the template read.

Picogreen Assay:

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: DNA quantity and quality were measured using the Picogreen Assay (Invitrogen) for Nanodrop. cDNAs were then ready for sequencing. .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

Construct:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: .. Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences. ..

Random Hexamer Labeling:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: Total RNA was extracted from cells, and a barcoded cDNA library was generated through reverse transcription-PCR (RT-PCR) using a random hexamer. .. Sequencing was performed using an Illumina HiSeq sequencer.

Modification:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: In brief, hybridomas were cultured in Iscove’s modified Dulbecco’s medium (IMDM) supplemented with 10% FBS in an incubator at 37°C and with 5% CO2 . .. Sequencing was performed using an Illumina HiSeq sequencer.

Transformation Assay:

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: This fact is important because it suggests that it is possible to obtain the raw sequence data from a DNA sample within 1–2 working days with the new sequencer (Illumina MiSeq), as compared to 14 working days with the Illumina HiSeq sequencer used in the present study. .. Similarly, we estimate that without any a priori knowledge of the transformation vector or insert (module 3) a draft map of the insert excluding experimental verification can be obtained in as little as five working days with the help of automatic software in future.

Article Title: Species-specific regulation of angiogenesis by glucocorticoids reveals contrasting effects on inflammatory and angiogenic pathways
Article Snippet: RNA from each of the samples was profiled on an Illumina HiSeq sequencer. .. Read counts were generated with HTSeq-Count ( http://www.ncbi.nlm.nih.gov/pubmed/25260700 ) and transformed to log2 counts per million reads using voom ( http://genomebiology.biomedcentral.com/articles/10.1186/gb-2014-15-2-r29 ).

Flow Cytometry:

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer. .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

Ligation:

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: This band was excised, purified and RNA was precipitated and resuspended in RNase-free H2 O to proceed with 5´RNA linker ligation. .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

Cell Culture:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: In brief, hybridomas were cultured in Iscove’s modified Dulbecco’s medium (IMDM) supplemented with 10% FBS in an incubator at 37°C and with 5% CO2 . .. Sequencing was performed using an Illumina HiSeq sequencer.

Article Title: Transcriptomic Changes in Response to Putrescine Production in Metabolically Engineered Corynebacterium glutamicum
Article Snippet: Transcriptome Analysis RNA-Seq was performed by GENWIZ (Shuzhou, China) using an Illumina HiSeq sequencer (Illumina, San Diego, CA, United States). .. Cells cultured for 48 h were harvested by centrifugation at 300 rpm for 2 min to remove CaCO3 and then at 5,000 × g for 15 min and washed twice with PBS.

Generated:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: Total RNA was extracted from cells, and a barcoded cDNA library was generated through reverse transcription-PCR (RT-PCR) using a random hexamer. .. Sequencing was performed using an Illumina HiSeq sequencer.

Article Title: Gel-free multiplexed reduced representation bisulfite sequencing for large-scale DNA methylation profiling
Article Snippet: To do this, we loaded a HiSeq 2000 with a custom recipe file co-developed with Illumina plus extra reagents to support primer re-hybridization. .. Next, the recipe removed the newly synthesized strand using NaOH and a buffer wash, re-hybridized fresh sequencing primer to the sample, and began read 1 data collection as usual from the first base but using the pre-existing cluster map or 'template' generated by the template read.

Article Title: Global Identification of HIF-1α Target Genes in Benzene Poisoning Mouse Bone Marrow Cells
Article Snippet: Illumina sequencing libraries were generated with the NEBNext® Ultra™ DNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s manual. .. The library quality was determined by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and then subjected to high-throughput 150 bp-end sequencing on a Illumina Hiseq sequencer.

Polymerase Chain Reaction:

Article Title: Hypoparathyroidism and central diabetes insipidus: in search of the link
Article Snippet: Whole-exome analyses were performed at the Broad Institute, Cambridge, MA, using the Agilent SureSelect Human All Exon Kit v2 followed by massively parallel sequencing using an Illumina HiSeq Sequencer. .. Identified mutations were confirmed by Sanger sequencing of PCR-amplified genomic DNA from the patients, their parents, and their younger healthy sibling (1.5 years old at the time of this investigation).

Article Title: Identification and validation of QTLs for seedling salinity tolerance in introgression lines of a salt tolerant rice landrace ‘Pokkali’
Article Snippet: The PCR products were run in 4.5% SFR agarose gel electrophoresis and alleles of each line were scored according to the banding pattern of the parents. .. The Genomic Diversity Facility, Cornell University Institute of Biotechnology ( http://www.biotech.cornell.edu/brc/genomic-diversity-facility ) provided the GBS service that included the genomic DNA library construction following the method of Elshire et al. [ ], 288-plex sequencing using the Illumina HiSeq sequencer, and SNP calling based on the Nipponbare reference genome MSU release 7 [ ].

Article Title: β-catenin mediates behavioral resilience through Dicer1/microRNA regulation
Article Snippet: After removing RNA template by addition of RNase, the di-tagged cDNA was amplified and individually barcoded with nine PCR cycles using indices and PCR primers provided in the kit. .. Multiplexed libraries were then pooled and sequenced on an Illumina Hiseq sequencer.

Article Title: Single-cell transcriptome analysis of Physcomitrella leaf cells during reprogramming using microcapillary manipulation
Article Snippet: The content of each cell was transferred to a PCR tube and cDNA was synthesized using reverse transcription with an exonuclease I treatment, poly(dA) tailing, second-strand synthesis, and cDNA amplification. .. After quantification and qualification, these batches of NGS libraries were equally mixed and sequenced on an Illumina HiSeq sequencer set to generate 126-bp single-end reads and 18-bp index reads, including 8 bp of multiplex index and 10 bp of UMI.

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer. ..

Imaging:

Article Title: Gel-free multiplexed reduced representation bisulfite sequencing for large-scale DNA methylation profiling
Article Snippet: To improve performance of these samples and increase coverage obtained, we used a method referred to as 'dark sequencing' in which imaging and cluster localization were delayed until the fourth cycle of sequencing chemistry, beyond the extent of bias from the MspI cut site (Figure S3 in Additional file ). .. To do this, we loaded a HiSeq 2000 with a custom recipe file co-developed with Illumina plus extra reagents to support primer re-hybridization.

Reverse Transcription Polymerase Chain Reaction:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: Total RNA was extracted from cells, and a barcoded cDNA library was generated through reverse transcription-PCR (RT-PCR) using a random hexamer. .. Sequencing was performed using an Illumina HiSeq sequencer.

Molecular Weight:

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: Protein-RNA complexes were transferred from the gel to a nitrocellulose membrane that was exposed until obtaining a clear image of the band corresponding to Ago2 molecular weight (97 kDa). .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

Nucleic Acid Electrophoresis:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: The quantity and quality of RNA were assessed by gel electrophoresis and spectrophotometry. .. Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences.

Article Title: Widespread genetic heterogeneity in multiple myeloma: implications for targeted therapy
Article Snippet: Adapter ligated purification was done by preparatory gel electrophoresis, and size was selected by excision of two bands (500–520 bp and 520–540 bp respectively) yielding two libraries per sample with average of 380 bp and 400 bp respectively. .. The libraries were then sequenced with the Illumina GA-II or Illumina HiSeq sequencer with 76 or 101 bp reads, achieving an average of ~30X coverage depth.

RNA Sequencing Assay:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: Sequencing was performed by whole-transcriptome shotgun sequencing (RNA-Seq). .. Sequencing was performed using an Illumina HiSeq sequencer.

Article Title: Transcriptomic Changes in Response to Putrescine Production in Metabolically Engineered Corynebacterium glutamicum
Article Snippet: .. Transcriptome Analysis RNA-Seq was performed by GENWIZ (Shuzhou, China) using an Illumina HiSeq sequencer (Illumina, San Diego, CA, United States). .. Cells cultured for 48 h were harvested by centrifugation at 300 rpm for 2 min to remove CaCO3 and then at 5,000 × g for 15 min and washed twice with PBS.

Article Title: β-catenin mediates behavioral resilience through Dicer1/microRNA regulation
Article Snippet: Paragraph title: Small RNA-seq and analysis ... Multiplexed libraries were then pooled and sequenced on an Illumina Hiseq sequencer.

Fluorescence:

Article Title: Global Identification of HIF-1α Target Genes in Benzene Poisoning Mouse Bone Marrow Cells
Article Snippet: The DNA from ChIP was quantified via Quant IT fluorescence assay (Life Technologies, Waltham, MA, USA). .. The library quality was determined by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and then subjected to high-throughput 150 bp-end sequencing on a Illumina Hiseq sequencer.

Magnetic Beads:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: After mixing an approximately equal weight of mixture for each species, total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer instructions, then poly-A mRNA was isolated from total RNA using poly-T oligo-attached magnetic beads (Illumina Inc., San Diego, CA, USA). .. Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences.

Isolation:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: After mixing an approximately equal weight of mixture for each species, total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer instructions, then poly-A mRNA was isolated from total RNA using poly-T oligo-attached magnetic beads (Illumina Inc., San Diego, CA, USA). .. Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences.

Article Title: Hypoparathyroidism and central diabetes insipidus: in search of the link
Article Snippet: Genomic DNA was isolated from blood samples obtained from all family members. .. Whole-exome analyses were performed at the Broad Institute, Cambridge, MA, using the Agilent SureSelect Human All Exon Kit v2 followed by massively parallel sequencing using an Illumina HiSeq Sequencer.

Article Title: Species-specific regulation of angiogenesis by glucocorticoids reveals contrasting effects on inflammatory and angiogenic pathways
Article Snippet: Next generation-sequencing of vessel rings from mice and horses incubated with FBS or FBS and cortisol Vessels isolated from healthy horses (n = 3) and C57BL6/J mice (male, 8 weeks old, n = 3), embedded in collagen, were mechanically disrupted in QIAzol (Qiagen Inc, Valencia, CA, USA) after 5 days culture in medium containing FBS or FBS plus cortisol. .. RNA from each of the samples was profiled on an Illumina HiSeq sequencer.

Marker:

Article Title: Identification and validation of QTLs for seedling salinity tolerance in introgression lines of a salt tolerant rice landrace ‘Pokkali’
Article Snippet: The Genomic Diversity Facility, Cornell University Institute of Biotechnology ( http://www.biotech.cornell.edu/brc/genomic-diversity-facility ) provided the GBS service that included the genomic DNA library construction following the method of Elshire et al. [ ], 288-plex sequencing using the Illumina HiSeq sequencer, and SNP calling based on the Nipponbare reference genome MSU release 7 [ ]. .. Each SNP call at a particular coordinate was treated as a marker.

Size-exclusion Chromatography:

Article Title: Identification and validation of QTLs for seedling salinity tolerance in introgression lines of a salt tolerant rice landrace ‘Pokkali’
Article Snippet: The PCR amplification was conducted with the following settings: initial denaturation at 94°C for 5 min, 35 cycles of 94°C for 45 sec, 55°C for 45 sec, 72°C for 1 min and a final extension at 72°C for 5 min. .. The Genomic Diversity Facility, Cornell University Institute of Biotechnology ( http://www.biotech.cornell.edu/brc/genomic-diversity-facility ) provided the GBS service that included the genomic DNA library construction following the method of Elshire et al. [ ], 288-plex sequencing using the Illumina HiSeq sequencer, and SNP calling based on the Nipponbare reference genome MSU release 7 [ ].

Purification:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: .. Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences. ..

Article Title: β-catenin mediates behavioral resilience through Dicer1/microRNA regulation
Article Snippet: The library was purified with Zymo DNA Clean & Concentrator kit (Cat# D4003) and size selected with Pippin (Sage Science). .. Multiplexed libraries were then pooled and sequenced on an Illumina Hiseq sequencer.

Article Title: Single-cell transcriptome analysis of Physcomitrella leaf cells during reprogramming using microcapillary manipulation
Article Snippet: To prepare the Illumina sequencing libraries, four or five samples with different multiplex sequences were mixed equally in a single batch, and were subsequently subjected to fragmentation, end-repair, dA-tailing, adaptor-ligation, library enrichment and library purification. .. After quantification and qualification, these batches of NGS libraries were equally mixed and sequenced on an Illumina HiSeq sequencer set to generate 126-bp single-end reads and 18-bp index reads, including 8 bp of multiplex index and 10 bp of UMI.

Article Title: Global Identification of HIF-1α Target Genes in Benzene Poisoning Mouse Bone Marrow Cells
Article Snippet: Finally, all tubes were incubated with 6 μL of 5 mol/L NaCl and 2 μL of proteinase K at 65 °C for 2 h. The DNA was purified by centrifuge column. .. The library quality was determined by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and then subjected to high-throughput 150 bp-end sequencing on a Illumina Hiseq sequencer.

Article Title: Widespread genetic heterogeneity in multiple myeloma: implications for targeted therapy
Article Snippet: Adapter ligated purification was done by preparatory gel electrophoresis, and size was selected by excision of two bands (500–520 bp and 520–540 bp respectively) yielding two libraries per sample with average of 380 bp and 400 bp respectively. .. The libraries were then sequenced with the Illumina GA-II or Illumina HiSeq sequencer with 76 or 101 bp reads, achieving an average of ~30X coverage depth.

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: This band was excised, purified and RNA was precipitated and resuspended in RNase-free H2 O to proceed with 5´RNA linker ligation. .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

Sequencing:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: Paragraph title: 4.2. RNA Extraction, Reverse Transcription and Sequencing ... Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences.

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: .. Sequencing was performed using an Illumina HiSeq sequencer. ..

Article Title: Hypoparathyroidism and central diabetes insipidus: in search of the link
Article Snippet: .. Whole-exome analyses were performed at the Broad Institute, Cambridge, MA, using the Agilent SureSelect Human All Exon Kit v2 followed by massively parallel sequencing using an Illumina HiSeq Sequencer. .. Data processing and variant calling were done as described elsewhere [ ].

Article Title: Identification and validation of QTLs for seedling salinity tolerance in introgression lines of a salt tolerant rice landrace ‘Pokkali’
Article Snippet: .. The Genomic Diversity Facility, Cornell University Institute of Biotechnology ( http://www.biotech.cornell.edu/brc/genomic-diversity-facility ) provided the GBS service that included the genomic DNA library construction following the method of Elshire et al. [ ], 288-plex sequencing using the Illumina HiSeq sequencer, and SNP calling based on the Nipponbare reference genome MSU release 7 [ ]. ..

Article Title: β-catenin mediates behavioral resilience through Dicer1/microRNA regulation
Article Snippet: The library concentration was confirmed on Agilent Bioanalyzer prior to sequencing. .. Multiplexed libraries were then pooled and sequenced on an Illumina Hiseq sequencer.

Article Title: Gel-free multiplexed reduced representation bisulfite sequencing for large-scale DNA methylation profiling
Article Snippet: Paragraph title: Sequencing ... To do this, we loaded a HiSeq 2000 with a custom recipe file co-developed with Illumina plus extra reagents to support primer re-hybridization.

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: .. This fact is important because it suggests that it is possible to obtain the raw sequence data from a DNA sample within 1–2 working days with the new sequencer (Illumina MiSeq), as compared to 14 working days with the Illumina HiSeq sequencer used in the present study. ..

Article Title: Single-cell transcriptome analysis of Physcomitrella leaf cells during reprogramming using microcapillary manipulation
Article Snippet: To prepare the Illumina sequencing libraries, four or five samples with different multiplex sequences were mixed equally in a single batch, and were subsequently subjected to fragmentation, end-repair, dA-tailing, adaptor-ligation, library enrichment and library purification. .. After quantification and qualification, these batches of NGS libraries were equally mixed and sequenced on an Illumina HiSeq sequencer set to generate 126-bp single-end reads and 18-bp index reads, including 8 bp of multiplex index and 10 bp of UMI.

Article Title: Global Identification of HIF-1α Target Genes in Benzene Poisoning Mouse Bone Marrow Cells
Article Snippet: .. The library quality was determined by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and then subjected to high-throughput 150 bp-end sequencing on a Illumina Hiseq sequencer. .. Data Analysis The genes corresponding to the differentially enriched peak located in the promoter region were selected by reference to the specific binding site HRE (aCGTG/gCGTG) of HIF-1α.

Article Title: Widespread genetic heterogeneity in multiple myeloma: implications for targeted therapy
Article Snippet: Paragraph title: Whole exome, whole genome sequencing, and detection of copy number variations ... The libraries were then sequenced with the Illumina GA-II or Illumina HiSeq sequencer with 76 or 101 bp reads, achieving an average of ~30X coverage depth.

Article Title: Sequencing the mosaic genome of Brahman cattle identifies historic and recent introgression including polled
Article Snippet: Paragraph title: Sequence data ... The selected bulls were sequenced on an Illumina HiSeq sequencer, at an average of 12.5 times genome coverage and a range of 10–30 times genome coverage.

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: DNA quantity and quality were measured using the Picogreen Assay (Invitrogen) for Nanodrop. cDNAs were then ready for sequencing. .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

cDNA Library Assay:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: .. Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences. ..

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: Total RNA was extracted from cells, and a barcoded cDNA library was generated through reverse transcription-PCR (RT-PCR) using a random hexamer. .. Sequencing was performed using an Illumina HiSeq sequencer.

Shotgun Sequencing:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: Sequencing was performed by whole-transcriptome shotgun sequencing (RNA-Seq). .. Sequencing was performed using an Illumina HiSeq sequencer.

Mouse Assay:

Article Title: Species-specific regulation of angiogenesis by glucocorticoids reveals contrasting effects on inflammatory and angiogenic pathways
Article Snippet: Paragraph title: Next generation-sequencing of vessel rings from mice and horses incubated with FBS or FBS and cortisol ... RNA from each of the samples was profiled on an Illumina HiSeq sequencer.

Chromatin Immunoprecipitation:

Article Title: Global Identification of HIF-1α Target Genes in Benzene Poisoning Mouse Bone Marrow Cells
Article Snippet: Paragraph title: 2.3. Chromatin Immunoprecipitation (ChIP) Assay ... The library quality was determined by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and then subjected to high-throughput 150 bp-end sequencing on a Illumina Hiseq sequencer.

RNA Extraction:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: Paragraph title: 4.2. RNA Extraction, Reverse Transcription and Sequencing ... Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences.

Plasmid Preparation:

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: This fact is important because it suggests that it is possible to obtain the raw sequence data from a DNA sample within 1–2 working days with the new sequencer (Illumina MiSeq), as compared to 14 working days with the Illumina HiSeq sequencer used in the present study. .. Similarly, we estimate that without any a priori knowledge of the transformation vector or insert (module 3) a draft map of the insert excluding experimental verification can be obtained in as little as five working days with the help of automatic software in future.

Software:

Article Title: A Glucuronoxylomannan Epitope Exhibits Serotype-Specific Accessibility and Redistributes towards the Capsule Surface during Titanization of the Fungal Pathogen Cryptococcus neoformans
Article Snippet: Sequencing was performed using an Illumina HiSeq sequencer. .. Variable-region gene usage was determined using VBASE2 software , and CDRs were predicted using the Kabat numbering system ( ).

Article Title: Gel-free multiplexed reduced representation bisulfite sequencing for large-scale DNA methylation profiling
Article Snippet: To do this, we loaded a HiSeq 2000 with a custom recipe file co-developed with Illumina plus extra reagents to support primer re-hybridization. .. HiSeq Control Software (HCS) provided by Illumina prevented cluster intensity files from the template read to enter downstream analysis.

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: The bioinformatics workload still represents a limitation to the routine use of modules 2 and 3 until the automatic and simplified software be developed in future. .. This fact is important because it suggests that it is possible to obtain the raw sequence data from a DNA sample within 1–2 working days with the new sequencer (Illumina MiSeq), as compared to 14 working days with the Illumina HiSeq sequencer used in the present study.

Multiplex Assay:

Article Title: Single-cell transcriptome analysis of Physcomitrella leaf cells during reprogramming using microcapillary manipulation
Article Snippet: .. After quantification and qualification, these batches of NGS libraries were equally mixed and sequenced on an Illumina HiSeq sequencer set to generate 126-bp single-end reads and 18-bp index reads, including 8 bp of multiplex index and 10 bp of UMI. ..

Agarose Gel Electrophoresis:

Article Title: Transcriptomic Changes in Response to Putrescine Production in Metabolically Engineered Corynebacterium glutamicum
Article Snippet: Transcriptome Analysis RNA-Seq was performed by GENWIZ (Shuzhou, China) using an Illumina HiSeq sequencer (Illumina, San Diego, CA, United States). .. Total RNA from each sample was quantified and qualified by an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, United States), NanoDrop (Thermo Fisher Scientific Inc.) and a 1% agarose gel.

Article Title: Identification and validation of QTLs for seedling salinity tolerance in introgression lines of a salt tolerant rice landrace ‘Pokkali’
Article Snippet: The PCR products were run in 4.5% SFR agarose gel electrophoresis and alleles of each line were scored according to the banding pattern of the parents. .. The Genomic Diversity Facility, Cornell University Institute of Biotechnology ( http://www.biotech.cornell.edu/brc/genomic-diversity-facility ) provided the GBS service that included the genomic DNA library construction following the method of Elshire et al. [ ], 288-plex sequencing using the Illumina HiSeq sequencer, and SNP calling based on the Nipponbare reference genome MSU release 7 [ ].

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: The PCR product was loaded in a 4% low-melt agarose gel, extracted from the gel and then eluted using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

Next-Generation Sequencing:

Article Title: Single-cell transcriptome analysis of Physcomitrella leaf cells during reprogramming using microcapillary manipulation
Article Snippet: .. After quantification and qualification, these batches of NGS libraries were equally mixed and sequenced on an Illumina HiSeq sequencer set to generate 126-bp single-end reads and 18-bp index reads, including 8 bp of multiplex index and 10 bp of UMI. ..

Article Title: Non-exomic and synonymous variants in ABCA4 are an important cause of Stargardt disease
Article Snippet: Paragraph title: Next-generation DNA sequencing ... Nine samples were barcoded, pooled and sequenced according to the manufacturer’s instructions on one paired end 100 bp lane of an Illumina HiSeq sequencer (Illumina, San Diego, CA, USA) at University of Iowa's DNA Core Facility.

Article Title: Species-specific regulation of angiogenesis by glucocorticoids reveals contrasting effects on inflammatory and angiogenic pathways
Article Snippet: Paragraph title: Next generation-sequencing of vessel rings from mice and horses incubated with FBS or FBS and cortisol ... RNA from each of the samples was profiled on an Illumina HiSeq sequencer.

Incubation:

Article Title: Global Identification of HIF-1α Target Genes in Benzene Poisoning Mouse Bone Marrow Cells
Article Snippet: Finally, all tubes were incubated with 6 μL of 5 mol/L NaCl and 2 μL of proteinase K at 65 °C for 2 h. The DNA was purified by centrifuge column. .. The library quality was determined by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and then subjected to high-throughput 150 bp-end sequencing on a Illumina Hiseq sequencer.

Article Title: Species-specific regulation of angiogenesis by glucocorticoids reveals contrasting effects on inflammatory and angiogenic pathways
Article Snippet: Paragraph title: Next generation-sequencing of vessel rings from mice and horses incubated with FBS or FBS and cortisol ... RNA from each of the samples was profiled on an Illumina HiSeq sequencer.

Spectrophotometry:

Article Title: Characterization of Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Two Species of Gynostemma (Cucurbitaceae)
Article Snippet: The quantity and quality of RNA were assessed by gel electrophoresis and spectrophotometry. .. Purified RNA was used to construct a directional cDNA library using the cDNA Synthesis Kit (Illumina), and then the cDNA library was sequenced using a HiSeq 2000 (Illumina) to obtain short sequences.

Concentration Assay:

Article Title: β-catenin mediates behavioral resilience through Dicer1/microRNA regulation
Article Snippet: The library concentration was confirmed on Agilent Bioanalyzer prior to sequencing. .. Multiplexed libraries were then pooled and sequenced on an Illumina Hiseq sequencer.

High Throughput Screening Assay:

Article Title: Global Identification of HIF-1α Target Genes in Benzene Poisoning Mouse Bone Marrow Cells
Article Snippet: .. The library quality was determined by using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA), and then subjected to high-throughput 150 bp-end sequencing on a Illumina Hiseq sequencer. .. Data Analysis The genes corresponding to the differentially enriched peak located in the promoter region were selected by reference to the specific binding site HRE (aCGTG/gCGTG) of HIF-1α.

Gel Extraction:

Article Title: The role of miR-17-92 in the miRegulatory landscape of Ewing sarcoma
Article Snippet: The PCR product was loaded in a 4% low-melt agarose gel, extracted from the gel and then eluted using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). .. Linkers: 3′ AUCGUAUGCCGUCUUCUGCUUGU 5′ GUUCAGAGUUCUACAGUCCGACGAUC PCR primers: 5′ AATGATACGGCGACCACCGACAGGTTCAG AGTTCTACAGTCCGA3′ CAAGCAGAAGACG GCATACGA Size-selected DNA from the PAR-CLIP experiments was sequenced on an Illumina HiSeq sequencer.

Variant Assay:

Article Title: Hypoparathyroidism and central diabetes insipidus: in search of the link
Article Snippet: Whole-exome analyses were performed at the Broad Institute, Cambridge, MA, using the Agilent SureSelect Human All Exon Kit v2 followed by massively parallel sequencing using an Illumina HiSeq Sequencer. .. Data processing and variant calling were done as described elsewhere [ ].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Illumina Inc bp single end protocol
    Bp Single End Protocol, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bp single end protocol/product/Illumina Inc
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    bp single end protocol - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    99
    Illumina Inc hiseq 2000
    Hiseq 2000, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1065 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiseq 2000/product/Illumina Inc
    Average 99 stars, based on 1065 article reviews
    Price from $9.99 to $1999.99
    hiseq 2000 - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc 50 bp single end sequencing
    50 Bp Single End Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/50 bp single end sequencing/product/Illumina Inc
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    50 bp single end sequencing - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results