hiv 1  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Integrated DNA Technologies hiv 1
    (a) Frequency of intact (black) and defective (gray) viruses characterized by Q4PCR per million AIM+ CD4 + T cells from 8 donors. (b) Frequency of virus sequences identified more than once (clonal) or only once (unique) among AIM+ cells from each donor. (c) Clonal distribution of Q4PCR-derived <t>HIV-1</t> sequences from total CD4 + T cells (MOG control) and all antigen-reactive AIM+ CD4 + T cells combined, from 8 donors. Numbers in the inner circles indicate the total number of HIV-1 sequences analyzed. White represents sequences identified only once across all conditions (unique) and colored slices represent sequences identified more than once (clones). The size of each pie slice is proportional to the size of the clone. Asterisks denote a significant change in overall clonal distribution (* P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001, two-sided Fisher’s exact test).
    Hiv 1, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiv 1/product/Integrated DNA Technologies
    Average 90 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    hiv 1 - by Bioz Stars, 2020-09
    90/100 stars

    Images

    1) Product Images from "Antigen responsive CD4+ T cell clones contribute to the HIV-1 latent reservoir"

    Article Title: Antigen responsive CD4+ T cell clones contribute to the HIV-1 latent reservoir

    Journal: bioRxiv

    doi: 10.1101/2020.01.10.902155

    (a) Frequency of intact (black) and defective (gray) viruses characterized by Q4PCR per million AIM+ CD4 + T cells from 8 donors. (b) Frequency of virus sequences identified more than once (clonal) or only once (unique) among AIM+ cells from each donor. (c) Clonal distribution of Q4PCR-derived HIV-1 sequences from total CD4 + T cells (MOG control) and all antigen-reactive AIM+ CD4 + T cells combined, from 8 donors. Numbers in the inner circles indicate the total number of HIV-1 sequences analyzed. White represents sequences identified only once across all conditions (unique) and colored slices represent sequences identified more than once (clones). The size of each pie slice is proportional to the size of the clone. Asterisks denote a significant change in overall clonal distribution (* P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001, two-sided Fisher’s exact test).
    Figure Legend Snippet: (a) Frequency of intact (black) and defective (gray) viruses characterized by Q4PCR per million AIM+ CD4 + T cells from 8 donors. (b) Frequency of virus sequences identified more than once (clonal) or only once (unique) among AIM+ cells from each donor. (c) Clonal distribution of Q4PCR-derived HIV-1 sequences from total CD4 + T cells (MOG control) and all antigen-reactive AIM+ CD4 + T cells combined, from 8 donors. Numbers in the inner circles indicate the total number of HIV-1 sequences analyzed. White represents sequences identified only once across all conditions (unique) and colored slices represent sequences identified more than once (clones). The size of each pie slice is proportional to the size of the clone. Asterisks denote a significant change in overall clonal distribution (* P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001, two-sided Fisher’s exact test).

    Techniques Used: Derivative Assay

    2) Product Images from "Antigen-responsive CD4+ T cell clones contribute to the HIV-1 latent reservoir"

    Article Title: Antigen-responsive CD4+ T cell clones contribute to the HIV-1 latent reservoir

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20200051

    Defective and intact proviral analysis from antigen-responsive cells. (a) Frequency of intact (black) and defective (gray) viruses characterized by Q4PCR per million AIM + CD4 + T cells from eight donors. (b) Frequency of virus sequences identified only once (unique) or more than once (clonal) across baseline and all sorted populations from each donor. (c) Clonal distribution of Q4PCR-derived HIV-1 sequences from total CD4 + T cells (MOG control) and all antigen-reactive AIM + CD4 + T cells combined, from eight donors. Numbers in the inner circles indicate the total number of HIV-1 sequences analyzed. White represents sequences identified only once across all conditions (unique), and colored slices represent sequences identified more than once (clones) across baseline and all sorted populations from each donor. The size of each pie slice is proportional to the size of the clone. P values denote a significant change in overall clonal distribution using a two-sided Fisher’s exact test. Total DNA extracted from sorted populations was diluted across individual PCR reactions (ranging from 384 to 6,144 reactions) based on gag dilution (see Table S3 ).
    Figure Legend Snippet: Defective and intact proviral analysis from antigen-responsive cells. (a) Frequency of intact (black) and defective (gray) viruses characterized by Q4PCR per million AIM + CD4 + T cells from eight donors. (b) Frequency of virus sequences identified only once (unique) or more than once (clonal) across baseline and all sorted populations from each donor. (c) Clonal distribution of Q4PCR-derived HIV-1 sequences from total CD4 + T cells (MOG control) and all antigen-reactive AIM + CD4 + T cells combined, from eight donors. Numbers in the inner circles indicate the total number of HIV-1 sequences analyzed. White represents sequences identified only once across all conditions (unique), and colored slices represent sequences identified more than once (clones) across baseline and all sorted populations from each donor. The size of each pie slice is proportional to the size of the clone. P values denote a significant change in overall clonal distribution using a two-sided Fisher’s exact test. Total DNA extracted from sorted populations was diluted across individual PCR reactions (ranging from 384 to 6,144 reactions) based on gag dilution (see Table S3 ).

    Techniques Used: Derivative Assay, Polymerase Chain Reaction

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: PLD3 epigenetic changes in the hippocampus of Alzheimer’s disease
    Article Snippet: .. Sequences of primer pair were designed using Real Time PCR tool (IDT, Coralville, IA, USA) and are listed in Additional file : Table S2. .. Relative expression level of PLD3 mRNA in a particular sample was calculated as previously described [ ] and ACTB gene was used as the reference gene to normalize expression values.

    Article Title: Antigen responsive CD4+ T cell clones contribute to the HIV-1 latent reservoir
    Article Snippet: .. HIV-1–specific primers and a probe targeting a conserved region in gag were used in a limiting dilution qPCR reaction (forward primer, 5’-ATGTTT TCAGCATTATCAGAAGGA-3’; internal probe, 5’-/6-FAM/CCACCCCAC/ZEN/AAGATTTAAACACCATGCTAA/3’/IABkFQ/; reverse primer, 5’-TGCTTGATGTCCCCCCACT-3’; Integrated DNA Technologies; ( )). .. Each qPCR reaction was performed in a 10 μl total reaction volume containing 5 μl of TaqMan Universal PCR Master Mix containing Rox (catalog no. 4304437; Applied Biosystems), 1 μl of diluted genomic DNA, nuclease free water, and the following primer and probe concentrations: 337.5 nM of forward and reverse primers with 93.75 nm of gag internal probe. gag qPCR conditions were 94°C for 10 min, 50 cycles of 94°C for 15 s, and 60°C for 60 s.

    Article Title: A novel quantitative real-time PCR diagnostic assay for fecal and nasal swab detection of an otariid lungworm, Parafilaroides decorus
    Article Snippet: .. A primer-probe set (based on repeat family Pd65 identified in ) for amplifying and detecting P. decorus DNA by qPCR was designed with the PrimerQuest tool offered through Integrated DNA Technologies (Coralville, IA, USA) using standard parameters ( http://www.idtdna.com/primerquest/home/ index). ..

    Article Title: Hallmarks of HIV-1 pathogenesis are modulated by Nef’s Secretion Modification Region
    Article Snippet: .. Quantitative-PCR was performed using SYBR Green (Applied Biosystems, Carlsbad, CA) and a probe and primer pair specific for the HIV pol gene: 5′-CTGGCTACTATTTCTTTTGCTA-3′ and 5′-TGGCATGGGTACCAGCACA-3′ and probe 5′-TTTATCTACTT-GTTCATTTCCTCCATTCCTT-3′ (IDT DNA Technologies, Coralville, IA). .. Quantitative-PCR was performed on an Applied Biosystems 7200 analyzer.

    Article Title: Antigen-responsive CD4+ T cell clones contribute to the HIV-1 latent reservoir
    Article Snippet: .. HIV-1–specific primers and a probe targeting a conserved region in gag were used in a limiting dilution qPCR reaction (forward primer, 5′-ATG​TTT​TCA​GCA​TTA​TCA​GAA​GGA-3′; internal probe, 5′-/6-FAM/CCACCCCAC/ZEN/AAGATTTAAACACCATGCTAA-3′/IABkFQ; reverse primer, 5′-TGC​TTG​ATG​TCC​CCC​CAC​T-3′; Integrated DNA Technologies; ). .. Each qPCR reaction was performed in a 10-µl total reaction volume containing 5 µl of TaqMan Universal PCR Master Mix containing Rox (4304437; Applied Biosystems), 1 µl of diluted genomic DNA, nuclease-free water, and 337.5 nM of forward and reverse primers with 93.75 nm of gag internal probe. gag qPCR conditions were 94°C for 10 min, 50 cycles of 94°C for 15 s, and 60°C for 60 s.

    Amplification:

    Article Title: Development of co-selected single nucleotide polymorphisms in the viral promoter precedes the onset of human immunodeficiency virus type 1-associated neurocognitive impairment
    Article Snippet: .. The HIV-1 LAI LTR (approximately 640 bp) was derived from the HIV-1LAI molecular clone of HIV-1 by PCR amplification using the forward primer: 5′-GG GGTACC TGGAAGGGCTAATTCACTCC-3′ and reverse primer: 5′-TCC CCCGGG TGCTAGAGATTTTCCACA-3′ (Integrated DNA Technologies). ..

    Labeling:

    Article Title: Combination of quadruplex qPCR and next-generation sequencing for qualitative and quantitative analysis of the HIV-1 latent reservoir
    Article Snippet: .. Each primer/probe set consists of a forward and reverse primer pair as well as a fluorescently labeled internal hydrolysis probe as follows: PS: forward, 5′-TCT​CTC​GAC​GCA​GGA​CTC-3′; reverse, 5′-TCT​AGC​CTC​CGC​TAG​TCA​AA-3′; probe, 5′/Cy5/TTTGGCGTA/TAO/CTCACCAGTCGCC/3′/IAbRQSp (Integrated DNA Technologies; ); env : forward, 5′-AGT​GGT​GCA​GAG​AGA​AAA​AAG​AGC-3′; reverse, 5′-GTC​TGG​CCT​GTA​CCG​TCA​GC-3′; probe, 5′/VIC/CCTTGGGTTCTTGGGA/3′/MGB (Thermo Fisher Scientific; ); gag : forward, 5′-ATG​TTT​TCA​GCA​TTA​TCA​GAA​GGA-3′; reverse, 5′-TGC​TTG​ATG​TCC​CCC​CAC​T-3′; probe, 5′/6-FAM/CCACCCCAC/ZEN/AAGATTTAAACACCATGCTAA/3′/IABkFQ (Integrated DNA Technologies; ); and pol : forward, 5′-GCA​CTT​TAA​ATT​TTC​CCA​TTA​GTC​CTA-3′; reverse, 5′-CAA​ATT​TCT​ACT​AAT​GCT​TTT​ATT​TTT​TC-3′; probe, 5′/NED/AAGCCAGGAATGGATGGCC/3′/MGB (Thermo Fisher Scientific; ). .. Each Q4PCR reaction was performed in a 10-µl total reaction volume containing 5 µl TaqMan Universal PCR Master Mix containing Rox (4304437; Applied Biosystems), 1 µl diluted genomic DNA, nuclease-free water, and the following primer and probe concentrations: PS, 675 nM of forward and reverse primers with 187.5 nM of PS internal probe; env , 90 nM of forward and reverse primers with 25 nM of env internal probe; gag , 337.5 nM of forward and reverse primers with 93.75 nM of gag internal probe; and pol , 675 nM of forward and reverse primers with 187.5 nM of pol internal probe. qPCR conditions were 94°C for 10 min, 40 cycles of 94°C for 15 s, and 60°C for 60 s. All qPCR reactions were performed in a 384-well plate format using the Applied Biosystem QuantStudio 6 Flex Real-Time PCR System.

    SYBR Green Assay:

    Article Title: Hallmarks of HIV-1 pathogenesis are modulated by Nef’s Secretion Modification Region
    Article Snippet: .. Quantitative-PCR was performed using SYBR Green (Applied Biosystems, Carlsbad, CA) and a probe and primer pair specific for the HIV pol gene: 5′-CTGGCTACTATTTCTTTTGCTA-3′ and 5′-TGGCATGGGTACCAGCACA-3′ and probe 5′-TTTATCTACTT-GTTCATTTCCTCCATTCCTT-3′ (IDT DNA Technologies, Coralville, IA). .. Quantitative-PCR was performed on an Applied Biosystems 7200 analyzer.

    Polymerase Chain Reaction:

    Article Title: Development of co-selected single nucleotide polymorphisms in the viral promoter precedes the onset of human immunodeficiency virus type 1-associated neurocognitive impairment
    Article Snippet: .. The HIV-1 LAI LTR (approximately 640 bp) was derived from the HIV-1LAI molecular clone of HIV-1 by PCR amplification using the forward primer: 5′-GG GGTACC TGGAAGGGCTAATTCACTCC-3′ and reverse primer: 5′-TCC CCCGGG TGCTAGAGATTTTCCACA-3′ (Integrated DNA Technologies). ..

    IA:

    Article Title: Hallmarks of HIV-1 pathogenesis are modulated by Nef’s Secretion Modification Region
    Article Snippet: .. Quantitative-PCR was performed using SYBR Green (Applied Biosystems, Carlsbad, CA) and a probe and primer pair specific for the HIV pol gene: 5′-CTGGCTACTATTTCTTTTGCTA-3′ and 5′-TGGCATGGGTACCAGCACA-3′ and probe 5′-TTTATCTACTT-GTTCATTTCCTCCATTCCTT-3′ (IDT DNA Technologies, Coralville, IA). .. Quantitative-PCR was performed on an Applied Biosystems 7200 analyzer.

    Derivative Assay:

    Article Title: Development of co-selected single nucleotide polymorphisms in the viral promoter precedes the onset of human immunodeficiency virus type 1-associated neurocognitive impairment
    Article Snippet: .. The HIV-1 LAI LTR (approximately 640 bp) was derived from the HIV-1LAI molecular clone of HIV-1 by PCR amplification using the forward primer: 5′-GG GGTACC TGGAAGGGCTAATTCACTCC-3′ and reverse primer: 5′-TCC CCCGGG TGCTAGAGATTTTCCACA-3′ (Integrated DNA Technologies). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Integrated DNA Technologies 5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq
    5 6 Fam Ccaccccac Zen Aagatttaaacaccatgctaa 3 Iabkfq, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq/product/Integrated DNA Technologies
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    Image Search Results