Review




Structured Review

Tosoh Corporation tskgel pheny 5pw
Tskgel Pheny 5pw, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/us12157073-110-62-66
Average 93 stars, based on 1 article reviews
tskgel pheny 5pw - by Bioz Stars, 2026-09
93/100 stars

Images

Related Articles

High Performance Liquid Chromatography:

Article Title: Heat-Treated Lysozyme Hydrochloride: A Study on Its Structural Modifications and Anti-SARS-CoV-2 Activity
Article Snippet: .. The chromatographic profile of utilized native lysozyme, as well as that of heat-treated lysozyme HCl, was determined using a chromatographic HPLC method employing the following analytical conditions: HPLC column TSK-GEL Phenyl-5PW RP 75 × 4.6 mm ID, 10 μm Tosoh; wavelength 281 nm; column temperature 30 °C; flow rate: 1 mL/min; eluant A: acetonitrile/water 10: 90 v / v + trifluoroacetic acid (TFA) 0.2% v / v ; eluant B: acetonitrile/water 70: 30 v / v + TFA 0.2% v / v ; gradient elution according to the composition indicated in , reported below. ..

Article Title: Anti-CD117 antibodies and conjugates
Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Tosoh TSKgel Phenyl-5PW 7.5 mm ID×7.5 cm 10-micron column (Catalog #07573) on a Waters ARC HPLC/UPLC system. ..

Article Title: Compositions and methods for the depletion of CD117+ cells
Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Tosoh TSKgel Phenyl-5PW 7.5 mm ID×7.5 cm 10-micron column (Catalog #07573) on a Waters ARC HPLC/UPLC system. ..

Injection:

Article Title: Anti-CD117 antibodies and conjugates
Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Tosoh TSKgel Phenyl-5PW 7.5 mm ID×7.5 cm 10-micron column (Catalog #07573) on a Waters ARC HPLC/UPLC system. ..

Article Title: Exploring the Correlation between LC-MS Multi-Attribute Method and Conventional Chromatographic Product Quality Assays through Multivariate Data Analysis.
Article Snippet: .. 50 μg of total protein was injected onto a Tosoh TSK gel Phenyl-5PW 10 μm, 7.5 × 75 mm column. ..

Article Title: Compositions and methods for the depletion of CD117+ cells
Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Tosoh TSKgel Phenyl-5PW 7.5 mm ID×7.5 cm 10-micron column (Catalog #07573) on a Waters ARC HPLC/UPLC system. ..

Hydrophobic Interaction Chromatography:

Article Title: Use of alkaline washes during chromatography to remove impurities
Article Snippet: .. Examples of hydrophobic interaction chromatography resins include: (1) Butyl FF, Butyl HP, Octyl FF, Phenyl FF, Phenyl HP, Phenyl FF (high sub), Phenyl FF (low sub), Capto Phenyl ImpRes, Capto Phenyl (high sub), Capto Octyl, Capto ButylImpRes, Capto Butyl (GE Healthcare, Uppsala, Sweden); (2) TOYOPEARL® Super Butyl-550C, TOYOPEARL® Hexyl-650C, Butyl-650C, Phenyl-650C, Butyl 600 M, Phenyl-600M, PPG-600M, Butyl-650M, Phenyl-650M, Ether-650M, Butyl-650S, Phenyl-650S, Ether-650S, TSKgel Pheny-5PW, TSKgel Ether-5PW (Tosoh Bioscience, Tokyo, Japan); (3) MACRO-PREP®-butyl, MACRO-PREP®-methyl (Bio-Rad); and (4) SARTOBIND® Phenyl (Sartorius corporation, New York, USA). ..

Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome
Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a TSKgel Phenyl-5PW column (Tosoh Bioscience), was ∼95%. ..

Activity Assay:

Article Title: Insecticidal proteins and methods for their use
Article Snippet: This solution was clarified and loaded onto a TSKgel Phenyl-5PW column (Tosoh Bioscience) equilibrated in 20 mM Tris pH 8.0, 1.5 M ammonium sulfate and insecticidal activity eluted with a gradient to 20 mM Tris, pH 8. .. This solution was clarified and loaded onto a TSKgel Phenyl-5PW column (Tosoh Bioscience) equilibrated in 20 mM Tris pH 8.0, 1.5 M ammonium sulfate and insecticidal activity eluted with a gradient to 20 mM Tris, pH 8. .. The desalted pool was loaded onto a Toyopearl GigaCap Q-650S column (Tosoh Biosciences) equilibrated in 20 mM Tris pH 8.0 and eluted with a gradient to 0.4 M NaCl in Tris buffer.

Sequencing:

Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome
Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a TSKgel Phenyl-5PW column (Tosoh Bioscience), was ∼95%. ..

Control:

Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome
Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a TSKgel Phenyl-5PW column (Tosoh Bioscience), was ∼95%. ..

In Vitro:

Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome
Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a TSKgel Phenyl-5PW column (Tosoh Bioscience), was ∼95%. ..

Plasmid Preparation:

Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome
Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a TSKgel Phenyl-5PW column (Tosoh Bioscience), was ∼95%. ..



Similar Products

94
DSMZ mycobacterium
Mycobacterium, supplied by DSMZ, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/Mycobacterium+smegmatis/pm41597734-269-0-14
Average 94 stars, based on 1 article reviews
mycobacterium - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
DSMZ m smegmatis
M Smegmatis, supplied by DSMZ, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/Mycobacterium+smegmatis/pm39852527-463-132-138
Average 94 stars, based on 1 article reviews
m smegmatis - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Tosoh Corporation tskgel pheny 5pw
Tskgel Pheny 5pw, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/us12157073-110-62-66
Average 93 stars, based on 1 article reviews
tskgel pheny 5pw - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Tosoh Corporation tosoh tsk gel phenyl 5pw
Tosoh Tsk Gel Phenyl 5pw, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/TSKgel+Phenyl-5PW/pm39572443-73-9-9
Average 93 stars, based on 1 article reviews
tosoh tsk gel phenyl 5pw - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Tosoh Corporation tskgel phenyl 5pw
Tskgel Phenyl 5pw, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/us11958908-1452-12-11
Average 93 stars, based on 1 article reviews
tskgel phenyl 5pw - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Tosoh Corporation tskgel phenyl 5pw column
Tskgel Phenyl 5pw Column, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/us11959090-1677-8-11
Average 93 stars, based on 1 article reviews
tskgel phenyl 5pw column - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Tosoh Corporation tosoh tskgel phenyl 5pw
Tosoh Tskgel Phenyl 5pw, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/us11958908-1452-11-11
Average 93 stars, based on 1 article reviews
tosoh tskgel phenyl 5pw - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
DSMZ mycobacterium smegmatis mc
Mycobacterium Smegmatis Mc, supplied by DSMZ, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/Mycobacterium+smegmatis/pmc10955285-94-0-8
Average 94 stars, based on 1 article reviews
mycobacterium smegmatis mc - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results