tskgel pheny 5pw (Tosoh Corporation)
93
Structured Review
Tosoh Corporation
tskgel pheny 5pw
Tskgel Pheny 5pw, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/us12157073-110-62-66
Average 93 stars, based on 1 article reviews
Tskgel Pheny 5pw, supplied by Tosoh Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/43277/us12157073-110-62-66
Average 93 stars, based on 1 article reviews
tskgel pheny 5pw - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
High Performance Liquid Chromatography:Article Title: Heat-Treated Lysozyme Hydrochloride: A Study on Its Structural Modifications and Anti-SARS-CoV-2 Activity Article Snippet: .. The chromatographic profile of utilized native lysozyme, as well as that of heat-treated lysozyme HCl, was determined using a chromatographic HPLC method employing the following analytical conditions: Article Title: Anti-CD117 antibodies and conjugates Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Article Title: Compositions and methods for the depletion of CD117+ cells Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Injection:Article Title: Anti-CD117 antibodies and conjugates Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Article Title: Exploring the Correlation between LC-MS Multi-Attribute Method and Conventional Chromatographic Product Quality Assays through Multivariate Data Analysis. Article Snippet: .. 50 μg of total protein was injected onto a Article Title: Compositions and methods for the depletion of CD117+ cells Article Snippet: .. Briefly, 50 micrograms of the indicated antibody were injected onto a Hydrophobic Interaction Chromatography:Article Title: Use of alkaline washes during chromatography to remove impurities Article Snippet: .. Examples of hydrophobic interaction chromatography resins include: (1) Butyl FF, Butyl HP, Octyl FF, Phenyl FF, Phenyl HP, Phenyl FF (high sub), Phenyl FF (low sub), Capto Phenyl ImpRes, Capto Phenyl (high sub), Capto Octyl, Capto ButylImpRes, Capto Butyl (GE Healthcare, Uppsala, Sweden); (2) TOYOPEARL® Super Butyl-550C, TOYOPEARL® Hexyl-650C, Butyl-650C, Phenyl-650C, Butyl 600 M, Phenyl-600M, PPG-600M, Butyl-650M, Phenyl-650M, Ether-650M, Butyl-650S, Phenyl-650S, Ether-650S, Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a Activity Assay:Article Title: Insecticidal proteins and methods for their use Article Snippet: This solution was clarified and loaded onto a TSKgel Phenyl-5PW column (Tosoh Bioscience) equilibrated in 20 mM Tris pH 8.0, 1.5 M ammonium sulfate and insecticidal activity eluted with a gradient to 20 mM Tris, pH 8. .. This solution was clarified and loaded onto a Sequencing:Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a Control:Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a In Vitro:Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a Plasmid Preparation:Article Title: Cryo-EM studies of the four E. coli paralogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome Article Snippet: .. The mRNAs with a strong Shine-Dalgarno sequence (underlined) were used to control positioning of the codon in the P site (bolded and underlined), which was the methionine codon AUG for the 70S ICs and the valine codon GUU for the 70S ECs (PRE -A Val complexes) : 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA AUG ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ 5’-GCAACCUAAAACUCACACAGGGCCC UAAGGA CAUAAAA GUU ACACCUAAUCCUCCUGCUGCACUCGCUGCACAAAUCGCUCAACGGCAAUUAAGGA-3’ The mRNAs were in vitro transcribed using T7 RNA polymerase from a linearized plasmid DNA template using previously described protocol , . tRNA fMet and tRNA Val were obtained from MP Biomedicals, tRNA fMet was aminoacylated and formylated and the yield of fMet-tRNA fMet , as assessed by hydrophobic interaction chromatography , on a |