mircury lna rt kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    miRCURY LNA RT Kit
    Description:
    For optimal first strand cDNA synthesis with the miRCURY LNA miRNA PCR System Kit contents cDNA synthesis kit for reverse transcription of miRNA Benefits Optimized for use with miRCURY LNA miRNA PCR Assays and Panels Fast easy and reliable first strand synthesis Includes RNA spike in template for monitoring performance
    Catalog Number:
    339340
    Price:
    356
    Category:
    miRCURY LNA RT Kit
    Buy from Supplier


    Structured Review

    Qiagen mircury lna rt kit
    miRCURY LNA RT Kit
    For optimal first strand cDNA synthesis with the miRCURY LNA miRNA PCR System Kit contents cDNA synthesis kit for reverse transcription of miRNA Benefits Optimized for use with miRCURY LNA miRNA PCR Assays and Panels Fast easy and reliable first strand synthesis Includes RNA spike in template for monitoring performance
    https://www.bioz.com/result/mircury lna rt kit/product/Qiagen
    Average 99 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    mircury lna rt kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms"

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms

    Journal: Frontiers in Genetics

    doi: 10.3389/fgene.2018.00011

    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.
    Figure Legend Snippet: Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.

    Techniques Used: Amplification, Polymerase Chain Reaction, Variant Assay, Modification, Quantitative RT-PCR

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Article Title: Profiling microRNA expression during fracture healing
    Article Snippet: Paragraph title: Quantitative real-time PCR analysis ... Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon).

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: tetR mRNA expression level was detected with a custom qPCR probe set (forward primer GCCTACAGAGAAGCAGTATGAG, reverse primer AGAGGGCATACAAGGCATTT, and probe FAM/AAGCCTTGTTGGCACAGGAATGC/TAMSp). .. Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351).

    Article Title: WIN55,212-2-Induced Expression of Mir-29b1 Favours the Suppression of Osteosarcoma Cell Migration in a SPARC-Independent Manner
    Article Snippet: Paragraph title: 4.8. Real-Time PCR for miR-29b1 Expression ... Twenty nanograms of total RNA was reverse transcripted in a final volume of 10 μL by using miRCURY LNATM Universal RT microRNA PCR kit (Exiqon, Mi, Italy) according to the manufacturer’s instructions.

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms
    Article Snippet: Paragraph title: Reverse Transcription Quantitative Real-Time PCR (RT-qPCR) ... For detection with the miRCURY LNA hsa-miR-222-3p (YP00204551 – targeted to the 21 nt isoform), 1.125 pmol of synthetic miRNA was polyadenylated and reverse transcribed with the miRCURY LNA RT Kit, following the manufacturer’s instructions (Qiagen).

    RNA Extraction:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: Paragraph title: RNA extraction and quantitative real-time PCR ... Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems).

    Amplification:

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: Semi-Quantitative analysis of EMT related genes (Zeb1, Zeb2, E-cadherin) in matched H1975P and H1975GR cell lines Total RNA from H1975P and H1975GR cell lines was extracted using 1 ml TRI Reagent and miRCURY LNA isolation kit (Exiqon) (as per manufacturer’s protocol). .. Zeb1, Zeb2 and E-cadherin were amplified using primer sets outlined as follows: Zeb1 Forward (5′ TTCAAACCCATAGTGGTTGCT 3′), Zeb1 Reverse (5′ TGGGAGACACCAAACCAACTG 3′), Zeb2 Forward (5′ CAAGAGGCGCAAACAAGC 3′), Zeb2 Reverse (5′ GGTTGGCAATACCGTCATCC 3′), E-cadherin Forward (5′ CAGCACGTACACAGCCCTAA 3′), E-cadherin Reverse (5′ GCTGGCTCAAGTCAAAGTCC 3′).

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: Total RNA from H1975P and H1975GR cell lines was extracted using 1 ml TRI Reagent and miRCURY LNA isolation kit (Exiqon) (as per manufacturer’s protocol). .. Zeb1, Zeb2 and E-cadherin were amplified using primer sets outlined as follows: Zeb1 Forward (5′ TTCAAACCCATAGTGGTTGCT 3′), Zeb1 Reverse (5′ TGGGAGACACCAAACCAACTG 3′), Zeb2 Forward (5′ CAAGAGGCGCAAACAAGC 3′), Zeb2 Reverse (5′ GGTTGGCAATACCGTCATCC 3′), E-cadherin Forward (5′ CAGCACGTACACAGCCCTAA 3′), E-cadherin Reverse (5′ GCTGGCTCAAGTCAAAGTCC 3′).

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol. .. For amplification of miR146a, LNA PCR miR146a and reference 5S rRNA primer sets were used and the reaction was set up as recommended by EXIQON.

    Article Title: Histone Methyltransferase MMSET/NSD2 Alters EZH2 Binding and Reprograms the Myeloma Epigenome through Global and Focal Changes in H3K36 and H3K27 Methylation
    Article Snippet: .. The miRCURY LNA Universal RT microRNA PCR kit (Exiqon) was used for reverse transcription and miRNA amplification. .. Expression was calculated using the ΔΔ CT method and U6 was used as internal controls.

    Expressing:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. Each sample was assayed in triplicate, and the relative expression of miR-141 was normalized to SNORD48.

    Article Title: Profiling microRNA expression during fracture healing
    Article Snippet: To compare the expression levels of the selected miRNAs between standard healing fractures and unhealing fractures and to investigate their changes in expression over time in standard healing fractures, real-time PCR was performed on RNA from tissue specimens collected on post-fracture days 3, 7, 10, 14, 21, and 28 (n = 5 in each group at each time point). .. Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon).

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: .. Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol. .. For amplification of miR146a, LNA PCR miR146a and reference 5S rRNA primer sets were used and the reaction was set up as recommended by EXIQON.

    Article Title: Histone Methyltransferase MMSET/NSD2 Alters EZH2 Binding and Reprograms the Myeloma Epigenome through Global and Focal Changes in H3K36 and H3K27 Methylation
    Article Snippet: Paragraph title: miRNA expression analysis ... The miRCURY LNA Universal RT microRNA PCR kit (Exiqon) was used for reverse transcription and miRNA amplification.

    Article Title: WIN55,212-2-Induced Expression of Mir-29b1 Favours the Suppression of Osteosarcoma Cell Migration in a SPARC-Independent Manner
    Article Snippet: Paragraph title: 4.8. Real-Time PCR for miR-29b1 Expression ... Twenty nanograms of total RNA was reverse transcripted in a final volume of 10 μL by using miRCURY LNATM Universal RT microRNA PCR kit (Exiqon, Mi, Italy) according to the manufacturer’s instructions.

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: For gene expression analysis, total RNA was quantified by Nanodrop and reverse transcribed using hexameric random primers followed by qRT-PCR. .. For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions.

    Fluorescence:

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Synthesized:

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: .. Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol. .. For amplification of miR146a, LNA PCR miR146a and reference 5S rRNA primer sets were used and the reaction was set up as recommended by EXIQON.

    Isolation:

    Article Title: Profiling microRNA expression during fracture healing
    Article Snippet: Tissue specimens were homogenized with a T 18 ULTRA-TURRAX homogenizer (IKA Werke, Staufen, Germany) and total RNA, including miRNAs, was extracted using a miRCURY RNA Isolation Kit-Tissue. .. Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon).

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. Semi-Quantitative analysis of EMT related genes (Zeb1, Zeb2, E-cadherin) in matched H1975P and H1975GR cell lines Total RNA from H1975P and H1975GR cell lines was extracted using 1 ml TRI Reagent and miRCURY LNA isolation kit (Exiqon) (as per manufacturer’s protocol). .. First strand complementary DNA (cDNA) was synthesised using 1 µg of total RNA and Superscript III reverse transcriptase kit (Invitrogen).

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: .. Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. Total RNA from H1975P and H1975GR cell lines was extracted using 1 ml TRI Reagent and miRCURY LNA isolation kit (Exiqon) (as per manufacturer’s protocol). .. First strand complementary DNA (cDNA) was synthesised using 1 µg of total RNA and Superscript III reverse transcriptase kit (Invitrogen).

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: Total RNA, including miRNAs was isolated by miRNAeasy isolation kit (QIAGEN, Germany) according to the manufacturer's instructions. .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol.

    Article Title: Histone Methyltransferase MMSET/NSD2 Alters EZH2 Binding and Reprograms the Myeloma Epigenome through Global and Focal Changes in H3K36 and H3K27 Methylation
    Article Snippet: miRNA expression analysis To determine miRNA expression levels, total RNA was isolated using the miRNeasy Mini Kit (Qiagen). .. The miRCURY LNA Universal RT microRNA PCR kit (Exiqon) was used for reverse transcription and miRNA amplification.

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: Paragraph title: DNA and RNA isolation and quantification ... For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions.

    Transfection:

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Cells were transfected with siRNAs at a final concentration of 5 nM and UBC mRNA was measured 24 hours after transfection.

    Infection:

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: q-PCR analysis Bone marrow derived DC were isolated and infected with different bacterial strains (H37Rv, H37RvΔRD1, BCG and BCG::RD1) as described above and cultured for 24 hours for RNA isolation. .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol.

    Concentration Assay:

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Cells were transfected with siRNAs at a final concentration of 5 nM and UBC mRNA was measured 24 hours after transfection.

    SYBR Green Assay:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Article Title: Profiling microRNA expression during fracture healing
    Article Snippet: Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon). .. Real-time PCR analysis was performed in duplicate with a StepOne Sequence Detector (Applied Biosystems, Branchburg, NJ, USA), using SYBR Green master mix and microRNA LNA PCR primer sets (both from Exiqon).

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol. .. For amplification of miR146a, LNA PCR miR146a and reference 5S rRNA primer sets were used and the reaction was set up as recommended by EXIQON.

    Article Title: WIN55,212-2-Induced Expression of Mir-29b1 Favours the Suppression of Osteosarcoma Cell Migration in a SPARC-Independent Manner
    Article Snippet: Twenty nanograms of total RNA was reverse transcripted in a final volume of 10 μL by using miRCURY LNATM Universal RT microRNA PCR kit (Exiqon, Mi, Italy) according to the manufacturer’s instructions. .. The resulting cDNAs were used for quantitative analysis by real-time PCR (qPCR) using miR-29b1 LNA™ primers (204261; Exiqon) and SYBR Green Master Mix (Exiqon).

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms
    Article Snippet: The mixture was incubated for 1 h at 37°C and the reaction was stopped after incubation at 85°C for 5 min. Fifteen microliter of RNase and DNase free water was added to the reverse-transcribed polyadenylated total cellular RNA, and 1 μL of the resulting mix was used per qPCR reaction with the Power SYBR Green mastermix (Applied Biosystems). .. For detection with the miRCURY LNA hsa-miR-222-3p (YP00204551 – targeted to the 21 nt isoform), 1.125 pmol of synthetic miRNA was polyadenylated and reverse transcribed with the miRCURY LNA RT Kit, following the manufacturer’s instructions (Qiagen).

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: .. For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions. .. MicroRNA expression was normalized on the expression levels of 5S rRNA.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: Paragraph title: miRNA validation by RT-PCR ... RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon).

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Incubation:

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms
    Article Snippet: The mixture was incubated for 1 h at 37°C and the reaction was stopped after incubation at 85°C for 5 min. Fifteen microliter of RNase and DNase free water was added to the reverse-transcribed polyadenylated total cellular RNA, and 1 μL of the resulting mix was used per qPCR reaction with the Power SYBR Green mastermix (Applied Biosystems). .. For detection with the miRCURY LNA hsa-miR-222-3p (YP00204551 – targeted to the 21 nt isoform), 1.125 pmol of synthetic miRNA was polyadenylated and reverse transcribed with the miRCURY LNA RT Kit, following the manufacturer’s instructions (Qiagen).

    Polymerase Chain Reaction:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: .. Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol. .. For amplification of miR146a, LNA PCR miR146a and reference 5S rRNA primer sets were used and the reaction was set up as recommended by EXIQON.

    Article Title: Histone Methyltransferase MMSET/NSD2 Alters EZH2 Binding and Reprograms the Myeloma Epigenome through Global and Focal Changes in H3K36 and H3K27 Methylation
    Article Snippet: .. The miRCURY LNA Universal RT microRNA PCR kit (Exiqon) was used for reverse transcription and miRNA amplification. .. Expression was calculated using the ΔΔ CT method and U6 was used as internal controls.

    Article Title: WIN55,212-2-Induced Expression of Mir-29b1 Favours the Suppression of Osteosarcoma Cell Migration in a SPARC-Independent Manner
    Article Snippet: .. Twenty nanograms of total RNA was reverse transcripted in a final volume of 10 μL by using miRCURY LNATM Universal RT microRNA PCR kit (Exiqon, Mi, Italy) according to the manufacturer’s instructions. .. The resulting cDNAs were used for quantitative analysis by real-time PCR (qPCR) using miR-29b1 LNA™ primers (204261; Exiqon) and SYBR Green Master Mix (Exiqon).

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: .. For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions. .. MicroRNA expression was normalized on the expression levels of 5S rRNA.

    Cell Culture:

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Cells were cultured in RPMI containing 10% tet-free FCS and 1 μg/ml puromycin.

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: q-PCR analysis Bone marrow derived DC were isolated and infected with different bacterial strains (H37Rv, H37RvΔRD1, BCG and BCG::RD1) as described above and cultured for 24 hours for RNA isolation. .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol.

    Quantitative RT-PCR:

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol. .. For amplification of miR146a, LNA PCR miR146a and reference 5S rRNA primer sets were used and the reaction was set up as recommended by EXIQON.

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms
    Article Snippet: Paragraph title: Reverse Transcription Quantitative Real-Time PCR (RT-qPCR) ... For detection with the miRCURY LNA hsa-miR-222-3p (YP00204551 – targeted to the 21 nt isoform), 1.125 pmol of synthetic miRNA was polyadenylated and reverse transcribed with the miRCURY LNA RT Kit, following the manufacturer’s instructions (Qiagen).

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: .. For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions. .. MicroRNA expression was normalized on the expression levels of 5S rRNA.

    miRNA RT:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Sequencing:

    Article Title: Profiling microRNA expression during fracture healing
    Article Snippet: Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon). .. Real-time PCR analysis was performed in duplicate with a StepOne Sequence Detector (Applied Biosystems, Branchburg, NJ, USA), using SYBR Green master mix and microRNA LNA PCR primer sets (both from Exiqon).

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: .. Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    shRNA:

    Article Title: Recurrent ubiquitin B silencing in gynecological cancers establishes dependence on ubiquitin C
    Article Snippet: Hairpin expression was measured using a probe designed and synthesized by Exiqon based on the shUBC target sequence CGAGAACGTCAAAGCAAAGAT. miRNA was isolated using a miRNeasy Mini Kit (Qiagen, 217004), and cDNAs were synthesized using a miRCURY LNA Universal RT microRNA PCR Starter Kit (Exiqon, 203351). .. Briefly, a poly-A tail added to the mature shRNA transcript was used as an anchor for a poly-T primer to convert this into cDNA, which was amplified using template-specific and LNA-enhanced forward and reverse primers and product was detected by SYBR Green fluorescence and quantified by Applied Biosystems 7900 real-time PCR.

    Microarray:

    Article Title: Profiling microRNA expression during fracture healing
    Article Snippet: RNA used for real-time PCR assays did not include any of the RNA used in the microarray assay. .. Total RNA was reverse transcribed into single-strand cDNA using the miRCURY LNA Universal RT microRNA PCR kit (Exiqon).

    Derivative Assay:

    Article Title: Early Secreted Antigen ESAT-6 of Mycobacterium tuberculosis Promotes Protective T Helper 17 Cell Responses in a Toll-Like Receptor-2-dependent Manner
    Article Snippet: q-PCR analysis Bone marrow derived DC were isolated and infected with different bacterial strains (H37Rv, H37RvΔRD1, BCG and BCG::RD1) as described above and cultured for 24 hours for RNA isolation. .. Real-time quantitative RT-PCR analysis was performed using BioRad Real-Time thermal cycler (BioRad, USA) and miRCURY LNA universal reverse transcriptase microRNA PCR SYBR green master mix (EXIQON, Denmark) for miRNA amplification and IQ BioRad SYBER green master mix (BioRad, USA) for IL-6 expression, respectively. cDNA was synthesized by the miRCURY LNA universal reverse transcriptase microRNA cDNA synthesis kit (EXIQON) and the reaction was set up according to the manufacturer's protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen mircury lna rt kit
    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or <t>miRCURY</t> <t>LNA</t> assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.
    Mircury Lna Rt Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mircury lna rt kit/product/Qiagen
    Average 99 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    mircury lna rt kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Qiagen mircury lna sybr green pcr kit
    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or <t>miRCURY</t> <t>LNA</t> assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.
    Mircury Lna Sybr Green Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mircury lna sybr green pcr kit/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mircury lna sybr green pcr kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.

    Journal: Frontiers in Genetics

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms

    doi: 10.3389/fgene.2018.00011

    Figure Lengend Snippet: Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.

    Article Snippet: For detection with the miRCURY LNA hsa-miR-222-3p (YP00204551 – targeted to the 21 nt isoform), 1.125 pmol of synthetic miRNA was polyadenylated and reverse transcribed with the miRCURY LNA RT Kit, following the manufacturer’s instructions (Qiagen).

    Techniques: Amplification, Polymerase Chain Reaction, Variant Assay, Modification, Quantitative RT-PCR