mircury lna rt kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    miRCURY LNA RT Kit
    Description:
    For optimal first strand cDNA synthesis with the miRCURY LNA miRNA PCR System Kit contents cDNA synthesis kit for reverse transcription of miRNA Benefits Optimized for use with miRCURY LNA miRNA PCR Assays and Panels Fast easy and reliable first strand synthesis Includes RNA spike in template for monitoring performance
    Catalog Number:
    339340
    Price:
    356
    Category:
    miRCURY LNA RT Kit
    		Buy from Supplier

    Structured Review

    Qiagen mircury lna rt kit
    miRCURY LNA RT Kit
    For optimal first strand cDNA synthesis with the miRCURY LNA miRNA PCR System Kit contents cDNA synthesis kit for reverse transcription of miRNA Benefits Optimized for use with miRCURY LNA miRNA PCR Assays and Panels Fast easy and reliable first strand synthesis Includes RNA spike in template for monitoring performance
    https://www.bioz.com/result/mircury lna rt kit/product/Qiagen
    Average 99 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    mircury lna rt kit - by Bioz Stars, 2020-09
    99/100 stars

    Related Products / Commonly Used Together

    rna
    cdna
    nuclease-free water
    mircury lna rt kit
    synthetic spike-in
    5x reaction buffer
    mirnas
    mj mini thermal cycler
    qpcr
    lightcycler
    total rna
    qrt-pcr analysis
    quantitative real-time pcr
    snord48
    hsa-mir-192-5p

    Images

    1) Product Images from "Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms"

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms

    Journal: Frontiers in Genetics

    doi: 10.3389/fgene.2018.00011

    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.
    Figure Legend Snippet: Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.

    Techniques Used: Amplification, Polymerase Chain Reaction, Variant Assay, Modification, Quantitative RT-PCR

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Article Title: Regulation of epithelial plasticity by miR-424 and miR-200 in a new prostate cancer metastasis model
    Article Snippet: .. Real time PCR was performed using a DNA Engine Opticon 2 machine (MJ Research) and analyzed using Opticon 3.1 software (Biorad Laboratories). cDNA was amplified using primers to mouse GAPDH, human GAPDH, CDH1 and ZEB1 (Real Time Primers, Elkins Park, PA), and ZEB2, FWD 5′CAAGAGGCGCAAACAAGC and REV 5′GGTTGGCAATACCGTCATCC . miRNA was copied using the miRCURY LNA Universal cDNA synthesis kit (Exiqon) followed by PCR using iQ SYBR Green Supermix (Biorad) with miRNA LNA PCR primer sets to hsa-miR-200a, has-miR-200b, hsa-miR-200c, hsa-miR-141, hsa-miR-424 and the reference gene primer sets; U6 snRNA (hsa, mmu, rno) and SNORD38B (hsa) (Exiqon). .. Animal studies and development of metastatic DU145-LN model Orthotopic prostate injection of 8 week male nu/nu mice with DU145 cells and sublines was performed.

    Amplification:

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Regulation of epithelial plasticity by miR-424 and miR-200 in a new prostate cancer metastasis model
    Article Snippet: .. Real time PCR was performed using a DNA Engine Opticon 2 machine (MJ Research) and analyzed using Opticon 3.1 software (Biorad Laboratories). cDNA was amplified using primers to mouse GAPDH, human GAPDH, CDH1 and ZEB1 (Real Time Primers, Elkins Park, PA), and ZEB2, FWD 5′CAAGAGGCGCAAACAAGC and REV 5′GGTTGGCAATACCGTCATCC . miRNA was copied using the miRCURY LNA Universal cDNA synthesis kit (Exiqon) followed by PCR using iQ SYBR Green Supermix (Biorad) with miRNA LNA PCR primer sets to hsa-miR-200a, has-miR-200b, hsa-miR-200c, hsa-miR-141, hsa-miR-424 and the reference gene primer sets; U6 snRNA (hsa, mmu, rno) and SNORD38B (hsa) (Exiqon). .. Animal studies and development of metastatic DU145-LN model Orthotopic prostate injection of 8 week male nu/nu mice with DU145 cells and sublines was performed.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Isolation:

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. Semi-Quantitative analysis of EMT related genes (Zeb1, Zeb2, E-cadherin) in matched H1975P and H1975GR cell lines Total RNA from H1975P and H1975GR cell lines was extracted using 1 ml TRI Reagent and miRCURY LNA isolation kit (Exiqon) (as per manufacturer’s protocol). .. First strand complementary DNA (cDNA) was synthesised using 1 µg of total RNA and Superscript III reverse transcriptase kit (Invitrogen).

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. Total RNA from H1975P and H1975GR cell lines was extracted using 1 ml TRI Reagent and miRCURY LNA isolation kit (Exiqon) (as per manufacturer’s protocol). .. First strand complementary DNA (cDNA) was synthesised using 1 µg of total RNA and Superscript III reverse transcriptase kit (Invitrogen).

    Quantitative RT-PCR:

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: .. For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions. .. MicroRNA expression was normalized on the expression levels of 5S rRNA.

    SYBR Green Assay:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Regulation of epithelial plasticity by miR-424 and miR-200 in a new prostate cancer metastasis model
    Article Snippet: .. Real time PCR was performed using a DNA Engine Opticon 2 machine (MJ Research) and analyzed using Opticon 3.1 software (Biorad Laboratories). cDNA was amplified using primers to mouse GAPDH, human GAPDH, CDH1 and ZEB1 (Real Time Primers, Elkins Park, PA), and ZEB2, FWD 5′CAAGAGGCGCAAACAAGC and REV 5′GGTTGGCAATACCGTCATCC . miRNA was copied using the miRCURY LNA Universal cDNA synthesis kit (Exiqon) followed by PCR using iQ SYBR Green Supermix (Biorad) with miRNA LNA PCR primer sets to hsa-miR-200a, has-miR-200b, hsa-miR-200c, hsa-miR-141, hsa-miR-424 and the reference gene primer sets; U6 snRNA (hsa, mmu, rno) and SNORD38B (hsa) (Exiqon). .. Animal studies and development of metastatic DU145-LN model Orthotopic prostate injection of 8 week male nu/nu mice with DU145 cells and sublines was performed.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: .. For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions. .. MicroRNA expression was normalized on the expression levels of 5S rRNA.

    Polymerase Chain Reaction:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: Regulation of epithelial plasticity by miR-424 and miR-200 in a new prostate cancer metastasis model
    Article Snippet: .. Real time PCR was performed using a DNA Engine Opticon 2 machine (MJ Research) and analyzed using Opticon 3.1 software (Biorad Laboratories). cDNA was amplified using primers to mouse GAPDH, human GAPDH, CDH1 and ZEB1 (Real Time Primers, Elkins Park, PA), and ZEB2, FWD 5′CAAGAGGCGCAAACAAGC and REV 5′GGTTGGCAATACCGTCATCC . miRNA was copied using the miRCURY LNA Universal cDNA synthesis kit (Exiqon) followed by PCR using iQ SYBR Green Supermix (Biorad) with miRNA LNA PCR primer sets to hsa-miR-200a, has-miR-200b, hsa-miR-200c, hsa-miR-141, hsa-miR-424 and the reference gene primer sets; U6 snRNA (hsa, mmu, rno) and SNORD38B (hsa) (Exiqon). .. Animal studies and development of metastatic DU145-LN model Orthotopic prostate injection of 8 week male nu/nu mice with DU145 cells and sublines was performed.

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Article Title: MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs
    Article Snippet: .. For miR-199a-3p quantification, total RNA was reverse transcribed using miRCURY LNA PCR synthesis kit (Exiqon) and qRT-PCR was performed with pre-designed miRCURY LNA PCR primer sets (Exiqon) and miRCURY LNA SYBR Green master mix according to the manufacturer’s instructions. .. MicroRNA expression was normalized on the expression levels of 5S rRNA.

    miRNA RT:

    Article Title: MicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axis
    Article Snippet: .. Quantitative real-time PCR (QPCR) was performed using a miRCURY LNA™ Universal RT miRNA PCR Kit and SYBR Green master mix (Exiqon, Denmark) in an ABI 7500 system (Applied Biosystems). .. The miR-141 probes (product no. 204504) and SNORD48, the reference gene (product no. 203903), were purchased from Exiqon.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Development and characterisation of a panel of phosphatidylinositide 3-kinase – mammalian target of rapamycin inhibitor resistant lung cancer cell lines
    Article Snippet: .. miRNA validation by RT-PCR RNA was diluted to 5 ng/μl using RNase-free water. cDNA was synthesised using the miRCURY LNA™ Universal RT microRNA PCR, Starter Kit (Exiqon), briefly 2 μl 5X reaction buffer, 4.5 μl nuclease-free water, 1 μl enzyme mix, 0.5 μl synthetic UniSp6 RNA spike-in and 2 μl template RNA (5 ng/μl). cDNA was amplified using Exilent SYBR Green Master Mix and microRNA LNA™ PCR primer sets U6 snRNA (endogenous control), hsa-miR-205-5p, and UniSp6 (quality control) (Exiqon). .. Fold change in miRNA expression was calculated using the ∆∆Ct method.

    Software:

    Article Title: Regulation of epithelial plasticity by miR-424 and miR-200 in a new prostate cancer metastasis model
    Article Snippet: .. Real time PCR was performed using a DNA Engine Opticon 2 machine (MJ Research) and analyzed using Opticon 3.1 software (Biorad Laboratories). cDNA was amplified using primers to mouse GAPDH, human GAPDH, CDH1 and ZEB1 (Real Time Primers, Elkins Park, PA), and ZEB2, FWD 5′CAAGAGGCGCAAACAAGC and REV 5′GGTTGGCAATACCGTCATCC . miRNA was copied using the miRCURY LNA Universal cDNA synthesis kit (Exiqon) followed by PCR using iQ SYBR Green Supermix (Biorad) with miRNA LNA PCR primer sets to hsa-miR-200a, has-miR-200b, hsa-miR-200c, hsa-miR-141, hsa-miR-424 and the reference gene primer sets; U6 snRNA (hsa, mmu, rno) and SNORD38B (hsa) (Exiqon). .. Animal studies and development of metastatic DU145-LN model Orthotopic prostate injection of 8 week male nu/nu mice with DU145 cells and sublines was performed.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • mircury lna rt kit  (Qiagen)
    99
    Qiagen mircury lna rt kit
    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or <t>miRCURY</t> <t>LNA</t> assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.
    Mircury Lna Rt Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mircury lna rt kit/product/Qiagen
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    mircury lna rt kit - by Bioz Stars, 2020-09
    99/100 stars
    		  Buy from Supplier
    mircury lna sybr green pcr kit  (Qiagen)
    99
    Qiagen mircury lna sybr green pcr kit
    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or <t>miRCURY</t> <t>LNA</t> assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.
    Mircury Lna Sybr Green Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mircury lna sybr green pcr kit/product/Qiagen
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    mircury lna sybr green pcr kit - by Bioz Stars, 2020-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.

    Journal: Frontiers in Genetics

    Article Title: Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms

    doi: 10.3389/fgene.2018.00011

    Figure Lengend Snippet: Forward primer 3′-extension increases selectivity toward short isomiRs. (A) Schematic of the selective amplification of poly-A reversed-transcribed 21 nt (in green) or 24 nt (in red) miR-222-3p isomiRs using a PCR approach with a forward primer of 21 nt comprising a stretch of 4 adenosines in its 3′-end. The 4A stretch creates a structural distortion in the 3′-end of the primer that is not favorable to 5′-3′ extension by Taq polymerase when the primer binds to the 24 nt miRNA variant. (B) Polyadenylated, reverse-transcribed miR-221-3p 24 nt isomiR was amplified with a non-modified 21 nt forward primer (F222-21), or two 21 nt forward primers with 2 or 5 terminal adenosines in their 3′-end (F222-21-2A and F222-21-5A). The amplification values are normalized to the Cq value obtained for the non-modified 21 nt primer, and are displayed as percentages (mean ± SEM is shown). (C) Amplification of the polyadenylated, reverse transcribed synthetic 25 nt RNA#1, which contains a 3′-end with a high proportion of adenosine residues. The amplification values are normalized to the Cq value obtained for the non-modified 25 nt primer, and are displayed as percentages (mean ± SEM is shown). (D) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward primers of different length. (E) Synthetic miRNA variants of miR-222-3p were analyzed by polyadenylation RT-qPCR with 4A-modified forward (F222-21-4A), Taqman stem loop assay (TM-222-21) or miRCURY LNA assay (LNA-222-21), all targeted to the 21 nt isoform. (D,E) The amplification values on the heatmap are normalized per line, to the amplification obtained with the primer targeting the isomiR on this line (D) or the 21 nt isoform (E) . Red = amplified; White = not amplified. The reddest color reflects values of 100% or more. (C–E) The forward primer names start with an “F”, and are ended by the length of the isomiR there are designed to amplify, with “4A” denoting a 4A 3′-terminal stretch. (B–E) Data shown is averaged from two independent RT-qPCR analyses.

    Article Snippet: For detection with the miRCURY LNA hsa-miR-222-3p (YP00204551 – targeted to the 21 nt isoform), 1.125 pmol of synthetic miRNA was polyadenylated and reverse transcribed with the miRCURY LNA RT Kit, following the manufacturer’s instructions (Qiagen).

    Techniques: Amplification, Polymerase Chain Reaction, Variant Assay, Modification, Quantitative RT-PCR