scfv antibodies  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    QIAprep Spin Miniprep Kit
    Description:
    For purification of up to 20 μg molecular biology grade plasmid DNA Kit contents Qiagen QIAprep Spin Miniprep Kit 50 preps 1 to 100mL Culture Volume 50L Elution Volume Molecular Biology Grade Plasmid DNA Purification Silica Technology Spin Column Format Manual Processing 30 min Time Run 20g Yield Ideal for Fluorescent and Radioactive Sequencing Ligation Cloning Transformation etc For Purification of up to 20μg Molecular Biology Grade Plasmid DNA Includes 50 QIAprep Spin Columns Reagents Buffers 2mL Collection Tubes Benefits Ready to use plasmid DNA in minutes Reproducible yields of molecular biology grade plasmid DNA Single protocol for high and low copy vectors Even higher yields with the High Yield Supplementary Protocol Improved QIAprep 2 0 Spin Column GelPilot loading dye for convenient sample analysis
    Catalog Number:
    27104
    Price:
    92.8
    Category:
    QIAprep Spin Miniprep Kit
    Buy from Supplier


    Structured Review

    Qiagen scfv antibodies
    QIAprep Spin Miniprep Kit
    For purification of up to 20 μg molecular biology grade plasmid DNA Kit contents Qiagen QIAprep Spin Miniprep Kit 50 preps 1 to 100mL Culture Volume 50L Elution Volume Molecular Biology Grade Plasmid DNA Purification Silica Technology Spin Column Format Manual Processing 30 min Time Run 20g Yield Ideal for Fluorescent and Radioactive Sequencing Ligation Cloning Transformation etc For Purification of up to 20μg Molecular Biology Grade Plasmid DNA Includes 50 QIAprep Spin Columns Reagents Buffers 2mL Collection Tubes Benefits Ready to use plasmid DNA in minutes Reproducible yields of molecular biology grade plasmid DNA Single protocol for high and low copy vectors Even higher yields with the High Yield Supplementary Protocol Improved QIAprep 2 0 Spin Column GelPilot loading dye for convenient sample analysis
    https://www.bioz.com/result/scfv antibodies/product/Qiagen
    Average 90 stars, based on 41975 article reviews
    Price from $9.99 to $1999.99
    scfv antibodies - by Bioz Stars, 2020-04
    90/100 stars

    Images

    1) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay, Purification, Expressing, Flow Cytometry, Cytometry, Labeling, Multiplex Assay, Standard Deviation

    Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Clone Assay, Incubation, Labeling, Fluorescence, FACS, Standard Deviation

    Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Incubation, Binding Assay, Standard Deviation

    aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.
    Figure Legend Snippet: aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.

    Techniques Used: Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Recombinant, Luminex, Staining, Fluorescence, Binding Assay, Concentration Assay, Standard Deviation

    2) Product Images from "Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome"

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome

    Journal: Clinical Epigenetics

    doi: 10.1186/s13148-018-0546-4

    DNMT1 methyltransferase trapping activity. The relative trapping ability of each DNMT1 variant is shown as a percentage relative to wild type DNMT1. Proteins from pEGFP-C1 transfected HeLa cells and non-transfected HeLa cells acted as controls. Technical replicates were performed in each assay. Four biological replicate experiments were performed for each sample and controls, except for DNMT1-R136C variant for which only three biological replicate experiments were performed. Error bars: mean ± SE
    Figure Legend Snippet: DNMT1 methyltransferase trapping activity. The relative trapping ability of each DNMT1 variant is shown as a percentage relative to wild type DNMT1. Proteins from pEGFP-C1 transfected HeLa cells and non-transfected HeLa cells acted as controls. Technical replicates were performed in each assay. Four biological replicate experiments were performed for each sample and controls, except for DNMT1-R136C variant for which only three biological replicate experiments were performed. Error bars: mean ± SE

    Techniques Used: Activity Assay, Variant Assay, Transfection

    3) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    4) Product Images from "Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿"

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.03050-09

    Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).
    Figure Legend Snippet: Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Techniques Used: Agarose Gel Electrophoresis, Purification, Plasmid Preparation

    5) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay, Purification, Expressing, Flow Cytometry, Cytometry, Labeling, Multiplex Assay, Standard Deviation

    Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Clone Assay, Incubation, Labeling, Fluorescence, FACS, Standard Deviation

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Incubation, Binding Assay, Standard Deviation

    aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.
    Figure Legend Snippet: aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.

    Techniques Used: Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Recombinant, Luminex, Staining, Fluorescence, Binding Assay, Concentration Assay, Standard Deviation

    6) Product Images from "Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine"

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine

    Journal: Nature protocols

    doi: 10.1038/nprot.2012.137

    Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.
    Figure Legend Snippet: Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Techniques Used: Methylation Sequencing, Polymerase Chain Reaction, Amplification

    7) Product Images from "Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome"

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome

    Journal: Clinical Epigenetics

    doi: 10.1186/s13148-018-0546-4

    Structure of DNMT1 compiled from information in NCBI for NP_001124295.1 [ 45 ]. Replication fork targeting sequence (RFTS), nuclear localization signal (NLS), bromo-adjacent homology (BAH) domain, site-specific DNA cytosine methylase activity (SSMT), zinc finger domain (CXXC). The “*” symbol represents the translation start of the shorter DNMT1o form at amino acid 119. Conserved domains are DMAP1, RFTS, CXXC, BAH, KG linker sequence and SSMT. Numbers represent amino acid numbering
    Figure Legend Snippet: Structure of DNMT1 compiled from information in NCBI for NP_001124295.1 [ 45 ]. Replication fork targeting sequence (RFTS), nuclear localization signal (NLS), bromo-adjacent homology (BAH) domain, site-specific DNA cytosine methylase activity (SSMT), zinc finger domain (CXXC). The “*” symbol represents the translation start of the shorter DNMT1o form at amino acid 119. Conserved domains are DMAP1, RFTS, CXXC, BAH, KG linker sequence and SSMT. Numbers represent amino acid numbering

    Techniques Used: Sequencing, Activity Assay

    8) Product Images from "Experimental Estimation of the Effects of All Amino-Acid Mutations to HIV’s Envelope Protein on Viral Replication in Cell Culture"

    Article Title: Experimental Estimation of the Effects of All Amino-Acid Mutations to HIV’s Envelope Protein on Viral Replication in Cell Culture

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006114

    Deep mutational scanning workflow. (A) We created libraries of HIV proviral plasmids with random codon mutations in env , and generated mutant viruses by transfecting these plasmid libraries into 293T cells. Since cells receive multiple plasmids, there may not be a link between viral genotype and phenotype at this stage. To establish this link and select for functional variants, we passaged the viruses twice at low multiplicity of infection (MOI) in SupT1 cells. We deep sequenced env before and after selection to quantify the enrichment or depletion of each mutation, and used these data to estimate the preference of each site for each amino acid. Each mutant library was paired with a control in which cells were transfected with a wildtype HIV proviral plasmid to generate initially wildtype viruses that were passaged in parallel with the mutant viruses. Deep sequencing of these wildtype controls enabled estimation of the rates of apparent mutations arising from deep sequencing and viral replication. (B) We performed the entire experiment in triplicate. Additionally, we passaged the replicate-3 transfection supernatant in duplicate (replicate 3b). We also performed the second passage of replicate 3b in duplicate (replicates 3b-1 and 3b-2).
    Figure Legend Snippet: Deep mutational scanning workflow. (A) We created libraries of HIV proviral plasmids with random codon mutations in env , and generated mutant viruses by transfecting these plasmid libraries into 293T cells. Since cells receive multiple plasmids, there may not be a link between viral genotype and phenotype at this stage. To establish this link and select for functional variants, we passaged the viruses twice at low multiplicity of infection (MOI) in SupT1 cells. We deep sequenced env before and after selection to quantify the enrichment or depletion of each mutation, and used these data to estimate the preference of each site for each amino acid. Each mutant library was paired with a control in which cells were transfected with a wildtype HIV proviral plasmid to generate initially wildtype viruses that were passaged in parallel with the mutant viruses. Deep sequencing of these wildtype controls enabled estimation of the rates of apparent mutations arising from deep sequencing and viral replication. (B) We performed the entire experiment in triplicate. Additionally, we passaged the replicate-3 transfection supernatant in duplicate (replicate 3b). We also performed the second passage of replicate 3b in duplicate (replicates 3b-1 and 3b-2).

    Techniques Used: Generated, Mutagenesis, Plasmid Preparation, Functional Assay, Infection, Selection, Transfection, Sequencing

    9) Product Images from "A Transgenomic Cytogenetic Sorghum (Sorghum propinquum) Bacterial Artificial Chromosome Fluorescence in Situ Hybridization Map of Maize (Zea mays L.) Pachytene Chromosome 9, Evidence for Regions of Genome Hyperexpansion"

    Article Title: A Transgenomic Cytogenetic Sorghum (Sorghum propinquum) Bacterial Artificial Chromosome Fluorescence in Situ Hybridization Map of Maize (Zea mays L.) Pachytene Chromosome 9, Evidence for Regions of Genome Hyperexpansion

    Journal: Genetics

    doi: 10.1534/genetics.107.080846

    Identification, selection, and verification of maize RFLP marker csu145-selected sorghum BAC clones. (A) Autoradiographs of Sorghum propinquum YRL filters showing six detected clones in the first filter (left) and five in the second (right). BAC a0067L02
    Figure Legend Snippet: Identification, selection, and verification of maize RFLP marker csu145-selected sorghum BAC clones. (A) Autoradiographs of Sorghum propinquum YRL filters showing six detected clones in the first filter (left) and five in the second (right). BAC a0067L02

    Techniques Used: Selection, Marker, BAC Assay, Clone Assay

    10) Product Images from "Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine"

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine

    Journal: Nature protocols

    doi: 10.1038/nprot.2012.137

    Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.
    Figure Legend Snippet: Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Techniques Used: Methylation Sequencing, Polymerase Chain Reaction, Amplification

    11) Product Images from "Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides"

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides

    Journal: Journal of Biomolecular Techniques : JBT

    doi:

    DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,
    Figure Legend Snippet: DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Techniques Used: DNA Sequencing, Mutagenesis, Isolation, Labeling

    12) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay, Purification, Expressing, Flow Cytometry, Cytometry, Labeling, Multiplex Assay, Standard Deviation

    Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Clone Assay, Incubation, Labeling, Fluorescence, FACS, Standard Deviation

    Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Incubation, Binding Assay, Standard Deviation

    aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.
    Figure Legend Snippet: aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.

    Techniques Used: Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Recombinant, Luminex, Staining, Fluorescence, Binding Assay, Concentration Assay, Standard Deviation

    13) Product Images from "Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex"

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-599

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.
    Figure Legend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Techniques Used: Isolation, Plasmid Preparation

    14) Product Images from "Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex"

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-599

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.
    Figure Legend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Techniques Used: Isolation, Plasmid Preparation

    15) Product Images from "Effects of optional structural elements, including two alternative amino termini and a new splicing cassette IV, on the function of the sodium–bicarbonate cotransporter NBCn1 (SLC4A7)"

    Article Title: Effects of optional structural elements, including two alternative amino termini and a new splicing cassette IV, on the function of the sodium–bicarbonate cotransporter NBCn1 (SLC4A7)

    Journal: The Journal of Physiology

    doi: 10.1113/jphysiol.2013.258673

    Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing human NBCn1 EGFP-tagged constructs ( A ), untagged constructs ( B ) or various NBCn1-G constructs ( C )
    Figure Legend Snippet: Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing human NBCn1 EGFP-tagged constructs ( A ), untagged constructs ( B ) or various NBCn1-G constructs ( C )

    Techniques Used: Expressing, Construct

    Cloning and expression patterns of NBCn1 in human and mouse tissues
    Figure Legend Snippet: Cloning and expression patterns of NBCn1 in human and mouse tissues

    Techniques Used: Clone Assay, Expressing

    Western blots of total ( A ) and surface ( B ) NBCn1, and summary of relative surface abundance ( C ) of mouse NBCn1 variants in Xenopus oocytes
    Figure Legend Snippet: Western blots of total ( A ) and surface ( B ) NBCn1, and summary of relative surface abundance ( C ) of mouse NBCn1 variants in Xenopus oocytes

    Techniques Used: Western Blot

    Cloning and expression patterns of NBCn1 in human and mouse tissues
    Figure Legend Snippet: Cloning and expression patterns of NBCn1 in human and mouse tissues

    Techniques Used: Clone Assay, Expressing

    Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing different mouse NBCn1 variants
    Figure Legend Snippet: Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing different mouse NBCn1 variants

    Techniques Used: Expressing

    NBCn1-dependent functional expression ( A ) and intrinsic HCO 3 − transport activity ( B )
    Figure Legend Snippet: NBCn1-dependent functional expression ( A ) and intrinsic HCO 3 − transport activity ( B )

    Techniques Used: Functional Assay, Expressing, Activity Assay

    Representative recordings of intracellular pH (pH i ) and membrane potential ( V m ) from oocytes expressing human NBCn1-E-EGFP ( A ), NBCn1-G-EGFP ( B ) or H 2 O-injected control oocytes ( C )
    Figure Legend Snippet: Representative recordings of intracellular pH (pH i ) and membrane potential ( V m ) from oocytes expressing human NBCn1-E-EGFP ( A ), NBCn1-G-EGFP ( B ) or H 2 O-injected control oocytes ( C )

    Techniques Used: Expressing, Injection

    Cloning and expression patterns of NBCn1 in human and mouse tissues
    Figure Legend Snippet: Cloning and expression patterns of NBCn1 in human and mouse tissues

    Techniques Used: Clone Assay, Expressing

    Summary of known major NBCn1 variants
    Figure Legend Snippet: Summary of known major NBCn1 variants

    Techniques Used:

    PCR cloning of NBCn1 transcripts from human ( A and B ) and mouse ( C ) tissues
    Figure Legend Snippet: PCR cloning of NBCn1 transcripts from human ( A and B ) and mouse ( C ) tissues

    Techniques Used: Polymerase Chain Reaction, Clone Assay

    Related Articles

    Clone Assay:

    Article Title: Dietary n-3 fatty acids have suppressive effects on mucin upregulation in mice infected with Pseudomonas aeruginosa
    Article Snippet: For each mucin studied and for the 18s gene, reverse-transcribed RNA extracted from mouse lung was amplified (see below) and amplification products were cloned into the 3957-bp pCR4-TOPO vector (Invitrogen, France). .. Isolation of plasmid DNA was carried out with the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Pre-expression of a sulfhydryl oxidase significantly increases the yields of eukaryotic disulfide bond containing proteins expressed in the cytoplasm of E.coli
    Article Snippet: The genes of interest were then cloned NsiI/AvrII from this vector into the modified pLysS. .. All plasmid purification was performed using the QIAprep spin miniprep kit (Qiagen) and all purification from agarose gels was performed using the Gel extraction kit (Qiagen), both according to the manufacturers' instructions.

    Article Title: Ultrasound-mediated DNA transfer for bacteria
    Article Snippet: The broad-host-range cloning vector pBBR1MCS2 (5144 bp) ( , ), hosted in E. coli JM109 (pBBR1MCS2) was employed as delivery DNA. .. Plasmid DNA was extracted and purified from overnight cultures of E. coli JM109, DH5α, P. putida UWC1 or P. fluorescens SBW25 using a QIAprep Spin Miniprep kit (QIAGEN, UK).

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: After amplification, the ctx B fragment was electrophoresed on 1% (wv-1 ) agarose gel (Fermentas, Burlington, Canada) and then purified and cloned in the pGEM-T easy vector (Promega, Canada). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: DNA and PCR techniques E. coli DH5αMCR [ ] was used for cloning experiments. .. Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany).

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: The PCR product was ligated into the pDrive cloning vector, followed by transformation of Quiagen EZ chemically competent cells (Qiagen, Valencia, CA). .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Sequencing and bioinformatics analysis Preliminary sequence analysis was performed using a shotgun cloning protocol. .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis.

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: .. All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. Purified DNA was sequenced by the dye termination method at Cogenics [ ].

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: First, each PCR product was cloned into pGEM-T vector using the pGEM-T Easy Vector System II (Promega) and transformed in JM109 high efficiency competent cells. .. White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen).

    Amplification:

    Article Title: Dietary n-3 fatty acids have suppressive effects on mucin upregulation in mice infected with Pseudomonas aeruginosa
    Article Snippet: For each mucin studied and for the 18s gene, reverse-transcribed RNA extracted from mouse lung was amplified (see below) and amplification products were cloned into the 3957-bp pCR4-TOPO vector (Invitrogen, France). .. Isolation of plasmid DNA was carried out with the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: After amplification, the ctx B fragment was electrophoresed on 1% (wv-1 ) agarose gel (Fermentas, Burlington, Canada) and then purified and cloned in the pGEM-T easy vector (Promega, Canada). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: Primers for the consensus sequence were designed and used for PCR amplification of horse cDNA obtained from purified peripheral blood leukocyte RNA. .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: To monitor amplicon contamination, every run contained a "no template" control in which nuclease-free water was substituted for template Sequencing was performed on amplicons of bisulfite-treated templates to identify the methylated and unmethylated CpGs with or without 5aza treatment. .. White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen).

    Binding Assay:

    Article Title: Pre-expression of a sulfhydryl oxidase significantly increases the yields of eukaryotic disulfide bond containing proteins expressed in the cytoplasm of E.coli
    Article Snippet: Note that this takes the ribosome binding sites from pET23 and removes a fragment from pBAD102/D-TOPO that includes the ribosome binding site, his-patch thioredoxin, enterokinase site, TOPO sites and V5 epitope. .. All plasmid purification was performed using the QIAprep spin miniprep kit (Qiagen) and all purification from agarose gels was performed using the Gel extraction kit (Qiagen), both according to the manufacturers' instructions.

    Positive Control:

    Article Title: Dietary n-3 fatty acids have suppressive effects on mucin upregulation in mice infected with Pseudomonas aeruginosa
    Article Snippet: The 18s rRNA was chosen as an internal positive control. .. Isolation of plasmid DNA was carried out with the QIAprep Spin Miniprep Kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: PCR was performed using ctx B-F (5'GCG TCA TGA TTA AAT TAA AAT TTG GTG TTT TTT TTA CAG TTT TAC3')/ctx B-R (5'CGC CTC GAG GGA ACC GCG TGG CAC CAG ATT TGC CAT AGT AATTG 3') primers with the following program: denaturation step at 94°C for 5 min, 25 cycles at 94°C for 45 s, 58°C for 45 s, and 72°C for 1 min (using genomic DNA of V. cholerae O1 ATCC14035 as DNA template). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany). .. Lysogeny was predicted using PCR with KS14-specifc primers (KS14F: GCAGCTAACCGAGTCGCACG, KS14R: CTCTGAAAAGGTGGGCGGTGG) (Sigma-Genosys, Oakville, ON) and TopTaq DNA polymerase and buffers (Qiagen).

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: Paragraph title: DNA and PCR techniques ... Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany).

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: The PCR product was ligated into the pDrive cloning vector, followed by transformation of Quiagen EZ chemically competent cells (Qiagen, Valencia, CA). .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: .. All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. Purified DNA was sequenced by the dye termination method at Cogenics [ ].

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: First, each PCR product was cloned into pGEM-T vector using the pGEM-T Easy Vector System II (Promega) and transformed in JM109 high efficiency competent cells. .. White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen).

    Construct:

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: The construct was then transformed to Escherichia coli Top 10F' (Invitrogen, Carlsbad, CA). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Real-time Polymerase Chain Reaction:

    Article Title: Dietary n-3 fatty acids have suppressive effects on mucin upregulation in mice infected with Pseudomonas aeruginosa
    Article Snippet: Paragraph title: Quantitative real-time PCR ... Isolation of plasmid DNA was carried out with the QIAprep Spin Miniprep Kit (Qiagen).

    Incubation:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Following addition of 0.5 M EDTA (pH 8.0) to 20 mM, proteinase K to 50 μg/ml and SDS to 0.5%, the solution was mixed and incubated 1 hour at 37°C. .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany).

    Expressing:

    Article Title: Dietary n-3 fatty acids have suppressive effects on mucin upregulation in mice infected with Pseudomonas aeruginosa
    Article Snippet: To quantify mucin expression obtained by real-time PCR, we used the standard curve method. .. Isolation of plasmid DNA was carried out with the QIAprep Spin Miniprep Kit (Qiagen).

    Modification:

    Article Title: Pre-expression of a sulfhydryl oxidase significantly increases the yields of eukaryotic disulfide bond containing proteins expressed in the cytoplasm of E.coli
    Article Snippet: This results in a modified pLysS that includes not only the genes of interest under the pBAD arabinose promoter, but also the araC gene for regulation. .. All plasmid purification was performed using the QIAprep spin miniprep kit (Qiagen) and all purification from agarose gels was performed using the Gel extraction kit (Qiagen), both according to the manufacturers' instructions.

    Transformation Assay:

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: The construct was then transformed to Escherichia coli Top 10F' (Invitrogen, Carlsbad, CA). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. E. coli and C. glutamicum cells were transformed by electroporation [ , ].

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: The PCR product was ligated into the pDrive cloning vector, followed by transformation of Quiagen EZ chemically competent cells (Qiagen, Valencia, CA). .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Phage DNA was digested using EcoRI (Invitrogen), separated on 0.8% (wt/vol) agarose gels, purified using the GeneClean II kit (Qbiogene, Irvine, CA), ligated into pUC19 or pGEM-7Z and transformed into DH5α (Invitrogen). .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis.

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: First, each PCR product was cloned into pGEM-T vector using the pGEM-T Easy Vector System II (Promega) and transformed in JM109 high efficiency competent cells. .. White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen).

    Electroporation:

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. E. coli and C. glutamicum cells were transformed by electroporation [ , ].

    Cell Culture:

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: .. White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen). .. Sequencing was done on an ABI 3100 Genetic Analyzer using the ABI PRISM™ BigDye™ Version 1.1 Terminator Cycle Ready Reaction Kit with AmpliTaq DNA Polymerase and an M13R3 primer.

    Sequencing:

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: Thrombin sequence was designed within the 5' terminal of reverse primer. .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: Primers for the consensus sequence were designed and used for PCR amplification of horse cDNA obtained from purified peripheral blood leukocyte RNA. .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Paragraph title: Sequencing and bioinformatics analysis ... Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis.

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: Sequence chromatograms showing a defined region of mixed peaks indicated differential splicing. .. All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: Paragraph title: Demethylation Treatment and Sequencing of Bisulfite-modified DNA ... White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen).

    Recombinant:

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. All recombinant DNA techniques followed standard procedures [ ].

    Staining:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    DNA Extraction:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Paragraph title: Phage isolation, propagation and DNA isolation ... KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany).

    Nucleic Acid Electrophoresis:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: Paragraph title: (iv) Purification of bacterial DNA and separation of fragments by gel electrophoresis. ... Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels.

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: Gel electrophoresis of the PCR product using low melting point gel agar revealed a single band of expected size. .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Methylation:

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: To monitor amplicon contamination, every run contained a "no template" control in which nuclease-free water was substituted for template Sequencing was performed on amplicons of bisulfite-treated templates to identify the methylated and unmethylated CpGs with or without 5aza treatment. .. White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen).

    Mutagenesis:

    Article Title: Pre-expression of a sulfhydryl oxidase significantly increases the yields of eukaryotic disulfide bond containing proteins expressed in the cytoplasm of E.coli
    Article Snippet: Mutagenesis of plasmids was carried out using the QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturers' instructions. .. All plasmid purification was performed using the QIAprep spin miniprep kit (Qiagen) and all purification from agarose gels was performed using the Gel extraction kit (Qiagen), both according to the manufacturers' instructions.

    Article Title: Ultrasound-mediated DNA transfer for bacteria
    Article Snippet: P. putida UWC1 is a spontaneous rifampicin-resistant mutant of P. putida KT2440 ( ). .. Plasmid DNA was extracted and purified from overnight cultures of E. coli JM109, DH5α, P. putida UWC1 or P. fluorescens SBW25 using a QIAprep Spin Miniprep kit (QIAGEN, UK).

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. Mutagenesis reactions were performed in a 25-μL volume containing 1X Pfu reaction buffer (10 mM KCl, 10 mM (NH4 )2 SO4 , 20 mM Tris-HCl (pH 8.8), 2 mM MgSO4 , 0.1% Triton X-100, and 0.1 mg/mL BSA), 20 ng template plasmid DNA, 6 pmol of each primer, 200 μM of each dNTP, and 1 unit of PfuTurbo DNA polymerase (cloned Pfu and PfuUltra Hotstart [Stratagene, La Jolla, CA] have also been used successfully).

    Isolation:

    Article Title: Dietary n-3 fatty acids have suppressive effects on mucin upregulation in mice infected with Pseudomonas aeruginosa
    Article Snippet: .. Isolation of plasmid DNA was carried out with the QIAprep Spin Miniprep Kit (Qiagen). .. Positive clones were reconfirmed by digestion with the Eco RI restriction enzyme and inserts sequenced on both strands on Licor 4000 using universal oligonucleotides.

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany). .. Lysogeny was predicted using PCR with KS14-specifc primers (KS14F: GCAGCTAACCGAGTCGCACG, KS14R: CTCTGAAAAGGTGGGCGGTGG) (Sigma-Genosys, Oakville, ON) and TopTaq DNA polymerase and buffers (Qiagen).

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA). ..

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Purification:

    Article Title: Pre-expression of a sulfhydryl oxidase significantly increases the yields of eukaryotic disulfide bond containing proteins expressed in the cytoplasm of E.coli
    Article Snippet: .. All plasmid purification was performed using the QIAprep spin miniprep kit (Qiagen) and all purification from agarose gels was performed using the Gel extraction kit (Qiagen), both according to the manufacturers' instructions. ..

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: Ultrasound-mediated DNA transfer for bacteria
    Article Snippet: .. Plasmid DNA was extracted and purified from overnight cultures of E. coli JM109, DH5α, P. putida UWC1 or P. fluorescens SBW25 using a QIAprep Spin Miniprep kit (QIAGEN, UK). .. DNA concentration was determined using a GeneQuant Pro RNA/DNA calculator (Amersham Pharmacia Biotech, USA).

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: After amplification, the ctx B fragment was electrophoresed on 1% (wv-1 ) agarose gel (Fermentas, Burlington, Canada) and then purified and cloned in the pGEM-T easy vector (Promega, Canada). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. DNA restriction fragments required for cloning were purified from agarose gels by means of the QIAEX II Gel Extraction Kit (Qiagen).

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: The PCR product was purified using QIAquick PCR purification kit (Qiagen, Valencia, CA). .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Phage DNA was digested using EcoRI (Invitrogen), separated on 0.8% (wt/vol) agarose gels, purified using the GeneClean II kit (Qbiogene, Irvine, CA), ligated into pUC19 or pGEM-7Z and transformed into DH5α (Invitrogen). .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis.

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: .. All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. Purified DNA was sequenced by the dye termination method at Cogenics [ ].

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. For analyzing RNA editing levels in Tcasα6 splice variants, RT-PCR was performed using forward primers specific to either exon 3a or exon 3b and reverse primers recognising one of the three alternatives for exon 8 [see Additional file for primers used].

    Quantitative RT-PCR:

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA). .. Primers and probes were designed for the quantitative RT-PCR using the equine sequence and the PrimerExpress software (ABIPrism).

    Lysis:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Half-strength LB agarose plates (prepared with soft nutrient agarose) showing confluent phage lysis were overlaid with 3 ml of suspension media and incubated for 6 hours at 4°C on a platform rocker. .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany).

    Nested PCR:

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. A nested PCR approach was adopted since two rounds of PCR were required to amplify enough variant containing exon 8c for visualization on an agarose gel.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: PCR was performed using ctx B-F (5'GCG TCA TGA TTA AAT TAA AAT TTG GTG TTT TTT TTA CAG TTT TAC3')/ctx B-R (5'CGC CTC GAG GGA ACC GCG TGG CAC CAG ATT TGC CAT AGT AATTG 3') primers with the following program: denaturation step at 94°C for 5 min, 25 cycles at 94°C for 45 s, 58°C for 45 s, and 72°C for 1 min (using genomic DNA of V. cholerae O1 ATCC14035 as DNA template). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Plasmid Preparation:

    Article Title: Dietary n-3 fatty acids have suppressive effects on mucin upregulation in mice infected with Pseudomonas aeruginosa
    Article Snippet: .. Isolation of plasmid DNA was carried out with the QIAprep Spin Miniprep Kit (Qiagen). .. Positive clones were reconfirmed by digestion with the Eco RI restriction enzyme and inserts sequenced on both strands on Licor 4000 using universal oligonucleotides.

    Article Title: Pre-expression of a sulfhydryl oxidase significantly increases the yields of eukaryotic disulfide bond containing proteins expressed in the cytoplasm of E.coli
    Article Snippet: .. All plasmid purification was performed using the QIAprep spin miniprep kit (Qiagen) and all purification from agarose gels was performed using the Gel extraction kit (Qiagen), both according to the manufacturers' instructions. ..

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: Ultrasound-mediated DNA transfer for bacteria
    Article Snippet: .. Plasmid DNA was extracted and purified from overnight cultures of E. coli JM109, DH5α, P. putida UWC1 or P. fluorescens SBW25 using a QIAprep Spin Miniprep kit (QIAGEN, UK). .. DNA concentration was determined using a GeneQuant Pro RNA/DNA calculator (Amersham Pharmacia Biotech, USA).

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA). .. The ctx B sequence was confirmed by restriction fragment length polymorphism and sequence analysis (Genfanavaran, Macrogen, Seoul, Korea) of extracted plasmids with SP6 and T7-promoter universal primers.

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany). .. Lysogeny was predicted using PCR with KS14-specifc primers (KS14F: GCAGCTAACCGAGTCGCACG, KS14R: CTCTGAAAAGGTGGGCGGTGG) (Sigma-Genosys, Oakville, ON) and TopTaq DNA polymerase and buffers (Qiagen).

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: .. Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. DNA restriction fragments required for cloning were purified from agarose gels by means of the QIAEX II Gel Extraction Kit (Qiagen).

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA). ..

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: The corresponding cys-loop LGIC PCR products were cloned into the pGEM-T Easy vector (Promega) and between 10 to 20 transformants were sequenced to identify individual subunit isoforms. .. All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: .. White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen). .. Sequencing was done on an ABI 3100 Genetic Analyzer using the ABI PRISM™ BigDye™ Version 1.1 Terminator Cycle Ready Reaction Kit with AmpliTaq DNA Polymerase and an M13R3 primer.

    Software:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: The effect of CpG-ODN on antigen presenting cells of the foal
    Article Snippet: Toll-like receptor 9 (TLR9) Consensus sequence was obtained by aligning the human, bovine, ovine, canine, feline and murine TLR9 gene sequences using the gene alignment NTI software. .. Selected colonies were grown overnight and plasmid DNA was isolated with the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Epstein-Barr virus-specific methylation of human genes in gastric cancer cells
    Article Snippet: White colonies containing inserts were selected and cultured overnight, and plasmid DNA was extracted using the QiaPrep Spin Miniprep Kit (Qiagen). .. Results were downloaded into Sequencher software (Gene Codes, Ann Arbor, MI) to obtain the reverse compliment of each sequence, and both forward and reverse sequences were aligned and analyzed to distinguish unmethylated cytosines from methylated cytosines.

    Electrophoresis:

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: .. All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. Purified DNA was sequenced by the dye termination method at Cogenics [ ].

    Selection:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Agarose Gel Electrophoresis:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: A Single Point Mutation within the Coding Sequence of Cholera Toxin B Subunit Will Increase Its Expression Yield
    Article Snippet: After amplification, the ctx B fragment was electrophoresed on 1% (wv-1 ) agarose gel (Fermentas, Burlington, Canada) and then purified and cloned in the pGEM-T easy vector (Promega, Canada). .. White colonies on LB agar plate (100 µg l-1 ampicillin, 40 µg l-1 IPTG, and 30 µg -l X-gal) were selected and used for plasmid extraction using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA).

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. A nested PCR approach was adopted since two rounds of PCR were required to amplify enough variant containing exon 8c for visualization on an agarose gel.

    Ethanol Precipitation:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Standard phenol:chloroform extraction and ethanol precipitation were then used to purify the phage DNA. .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany).

    Spectrophotometry:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: Samples were resuspended in TE (pH 8.0) and quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Waltham, MA). .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany).

    Concentration Assay:

    Article Title: Ultrasound-mediated DNA transfer for bacteria
    Article Snippet: Plasmid DNA was extracted and purified from overnight cultures of E. coli JM109, DH5α, P. putida UWC1 or P. fluorescens SBW25 using a QIAprep Spin Miniprep kit (QIAGEN, UK). .. DNA concentration was determined using a GeneQuant Pro RNA/DNA calculator (Amersham Pharmacia Biotech, USA).

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: Desalted primers are dissolved in 0.1X TE (1 mM Tris, 0.1 mM EDTA, pH 8.0) and diluted in deionized H2 O to 2 μM concentration. .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA).

    Alkaline Lysis:

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: .. Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. DNA restriction fragments required for cloning were purified from agarose gels by means of the QIAEX II Gel Extraction Kit (Qiagen).

    Gel Extraction:

    Article Title: Pre-expression of a sulfhydryl oxidase significantly increases the yields of eukaryotic disulfide bond containing proteins expressed in the cytoplasm of E.coli
    Article Snippet: .. All plasmid purification was performed using the QIAprep spin miniprep kit (Qiagen) and all purification from agarose gels was performed using the Gel extraction kit (Qiagen), both according to the manufacturers' instructions. ..

    Article Title: The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
    Article Snippet: Vector DNA was prepared from E. coli cells by alkaline lysis using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. DNA restriction fragments required for cloning were purified from agarose gels by means of the QIAEX II Gel Extraction Kit (Qiagen).

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: .. All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. Purified DNA was sequenced by the dye termination method at Cogenics [ ].

    Variant Assay:

    Article Title: The cys-loop ligand-gated ion channel gene superfamily of the red flour beetle, Tribolium castaneum
    Article Snippet: All PCR products were analyzed by electrophoresis in a TAE gel and then purified using the QIAquick Gel Extraction Kit (Qiagen) while subunits cloned in pGEM-T Easy were purified using the QIAprep Spin Miniprep Kit (Qiagen). .. A nested PCR approach was adopted since two rounds of PCR were required to amplify enough variant containing exon 8c for visualization on an agarose gel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen qiaprep spin miniprep kit
    Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the <t>Qiaprep</t> Spin <t>Miniprep</t> kit for plasmid DNA (0.9% agarose).
    Qiaprep Spin Miniprep Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1691 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaprep spin miniprep kit/product/Qiagen
    Average 99 stars, based on 1691 article reviews
    Price from $9.99 to $1999.99
    qiaprep spin miniprep kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Journal: Applied and Environmental Microbiology

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿

    doi: 10.1128/AEM.03050-09

    Figure Lengend Snippet: Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Article Snippet: Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels.

    Techniques: Agarose Gel Electrophoresis, Purification, Plasmid Preparation

    DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Journal: Journal of Biomolecular Techniques : JBT

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides

    doi:

    Figure Lengend Snippet: DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Article Snippet: For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA).

    Techniques: DNA Sequencing, Mutagenesis, Isolation, Labeling

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Journal: BMC Genomics

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    doi: 10.1186/1471-2164-11-599

    Figure Lengend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Article Snippet: KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany).

    Techniques: Isolation, Plasmid Preparation