kit no 27104  (Qiagen)

Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    QIAprep Spin Miniprep Kit

    Catalog Number:
    Buy from Supplier

    Structured Review

    Qiagen kit no 27104 no 27104/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kit no 27104 - by Bioz Stars, 2019-12
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: The products of these two semi-nested reactions were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (QIAGEN), ligated into pJET 1.2 plasmids and cloned using a CloneJET PCR Cloning Kit (Life Technologies) in DH5α cells. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit. .. Sequencing reads were trimmed and assembled into a complete sequence using the program Sequencher 5.4.6 (Gene Codes Corporation).

    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: PCR products for pAcGFP1-C constructs were cloned into pre-linearized vector using the In-Fusion PCR Cloning Kit (Clontech), and transformants were selected by growth on LB agar with kanamycin. .. PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: Amplicons were then cloned using the pGEM-T Easy System (Promega, Madison, WI, USA) and transformed into X10-Gold Ultracompetent Cells (Agilent, Santa Clara, CA, USA). .. Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon. .. All sequences were deposited in the European Nucleotide Archive: BbVV-1 strain EABb 01/33-Su accession number LR028007; BbVV-1 strain EABb 01/112-Su accession number LR028008; BbVV-1 strain EABb 00/13-Su accession number LR028009; BbVV-1 strain EABb 07/06-Rf accession number LR028010; BbVV-1 strain EABb 10/57-Fil accession number LR028011; BbVV-1 strain EABb 11/01-Mg accession number LR028012; BbVV-1 strain EABb 00/11-Su accession number LR028013; BbPV-2 strain EABb 10/57-Fil accession number LR028014; BbPV-2 strain EABb 09/07-Fil accession number LR028015; BbPV-2 strain EABb 00/13-Su accession number LR028016; BbPV-2 strain EABb 11/01-Mg accession number LR028017; BbPV-2 strain EABb 07/06-Su accession number LR028018; BbPV-2 strain EABb 00/11-Su accession number LR028019; BbPmV-1 strain EABb 10/57-Fil accession number LR028020; BbPmV-1 strain EABb 10/28-Su accession number LR028021; BbPmV-1 strain EABb 00/13-Su accession number LR028022; BbPmV-1 strain EABb 00/11-Su accession number LR028023; BbPmV-1 strain EABb 07/06-Rf accession number LR028024; BbPmV-1 strain EABb 11/01-Mg accession number LR028025; BbPmV-1 strain EABb 10/01-Fil accession number LR028026; BbPmV-1 strain EABb 10/30-Fil accession number LR028027; ITS strain EABb 10/01-Fil accession number LR028032; ITS strain EABb 09/07-Fil accession number LR028033; ITS strain EABb 00/11-Su accession number LR028034; ITS strain EABb 01/112-Su accession number LR028035; ITS strain EABb 11/01-Mg accession number LR028036; ITS strain EABb 07/06-Rf accession number LR028037; ITS strain EABb 00/13-Su accession number LR028038; ITS strain EABb 10/28-Su accession number LR028039; ITS strain EABb 10/57-Fil accession number LR028040; ITS strain EABb 10/30-Fil accession number LR028041.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany). .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: RT-PCR products were ligated into pCR2.1 vector and transformed into Top-10 E. coli cells (Topo-TA cloning kit, Invitrogen). .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: 3′-A-overhangs were generated by DyNAzyme EXT (Finnzymes) at 72°C for 15 min. Amplified PCR fragments were purified from agarose gels and cloned into pCR2.1-TOPO vector (Invitrogen) followed by DNA purification and sequencing. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: Real-Time PCR was performed on an ABI Prism 7000 Sequence Detection System machine. .. A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. Plasmid concentration was quantified using Nanodrop 2000 (Thermo Scientific) and a standard curve with 1:10 serial dilutions was prepared as reference for DNA quantification.

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Paragraph title: Cloning and site-directed mutagenesis ... Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Antibody Repertoire in Paraneoplastic Cerebellar Degeneration and Small Cell Lung Cancer
    Article Snippet: Phage clones were subcloned in pBluescript plasmid using the in vivo excision phage rescue protocol (Stratagene, La Jolla, CA). .. Plasmid DNA was purified with the QIAprep Spin Miniprep Kit (Qiagen, Santa Clarita, CA), and sequenced with the DNA sequencer ABI 377 (Applied Biosystems, Foster City, CA) using the Big Dye terminator ready mix (Applied Biosystems).

    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). .. Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA).

    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions
    Article Snippet: Serum was also analyzed using a quantitative colorimetric kit for triglycerides measurement (Wako, Osaka, Japan). .. Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions. .. Mutated human APP770 (hAPP770) was PCR amplified using Genomic DNA from the CAA mouse as a DNA template and using Phusion® High-Fidelity DNA Polymerase (NEB, Cat. No. M0530) for PCR amplification, with primer pairs: ATAAGAATGCGGCCGCATGCTGCCCGGTTTGGCAC (forward) and ACGCGTCGACGGTCTAGTTCTGCATCTGCTCAAAGAACTTGTAGG (reversal).

    Article Title: Evidence that the Ceratobasidium-like white-thread blight and black rot fungal pathogens from persimmon and tea crops in the Brazilian Atlantic Forest agroecosystem are two distinct phylospecies
    Article Snippet: To separate distinct alleles of the ITS-5.8S rDNA operon from the same heterogeneous PCR product the heterogeneous amplicons were cloned into the vector PCR2.1-TOPO (Invitrogen). .. Selected recombinant plasmids from Escherichia coli One Shot DH5a-T1R (Invitrogen) were extracted from each one of the cloned heterogeneous samples and purified using QIAprep Spin Miniprep kits (Qiagen). .. Primers for one of the multiple cloning sites of the vector were used for reamplification and sequencing.


    Article Title: The Deinococcus radiodurans DR1245 Protein, a DdrB Partner Homologous to YbjN Proteins and Reminiscent of Type III Secretion System Chaperones
    Article Snippet: Plasmid DNA was extracted from E. coli using the QIAprep spin miniprep kit (Qiagen). .. Chromosomal DNA of D. radiodurans was isolated from stationary phase cells in TGY2x medium.


    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: Paragraph title: DNA Amplification and Sequencing ... Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit.

    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: A PCR product encoding TRP47 without the MYND-binding domain (No Motif construct) was amplified from a commercially synthesized pUc57 plasmid (GenScript) using the forward and reverse primers for the full-length GFP construct. .. PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: Amplicons were then cloned using the pGEM-T Easy System (Promega, Madison, WI, USA) and transformed into X10-Gold Ultracompetent Cells (Agilent, Santa Clara, CA, USA). .. Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon. .. All sequences were deposited in the European Nucleotide Archive: BbVV-1 strain EABb 01/33-Su accession number LR028007; BbVV-1 strain EABb 01/112-Su accession number LR028008; BbVV-1 strain EABb 00/13-Su accession number LR028009; BbVV-1 strain EABb 07/06-Rf accession number LR028010; BbVV-1 strain EABb 10/57-Fil accession number LR028011; BbVV-1 strain EABb 11/01-Mg accession number LR028012; BbVV-1 strain EABb 00/11-Su accession number LR028013; BbPV-2 strain EABb 10/57-Fil accession number LR028014; BbPV-2 strain EABb 09/07-Fil accession number LR028015; BbPV-2 strain EABb 00/13-Su accession number LR028016; BbPV-2 strain EABb 11/01-Mg accession number LR028017; BbPV-2 strain EABb 07/06-Su accession number LR028018; BbPV-2 strain EABb 00/11-Su accession number LR028019; BbPmV-1 strain EABb 10/57-Fil accession number LR028020; BbPmV-1 strain EABb 10/28-Su accession number LR028021; BbPmV-1 strain EABb 00/13-Su accession number LR028022; BbPmV-1 strain EABb 00/11-Su accession number LR028023; BbPmV-1 strain EABb 07/06-Rf accession number LR028024; BbPmV-1 strain EABb 11/01-Mg accession number LR028025; BbPmV-1 strain EABb 10/01-Fil accession number LR028026; BbPmV-1 strain EABb 10/30-Fil accession number LR028027; ITS strain EABb 10/01-Fil accession number LR028032; ITS strain EABb 09/07-Fil accession number LR028033; ITS strain EABb 00/11-Su accession number LR028034; ITS strain EABb 01/112-Su accession number LR028035; ITS strain EABb 11/01-Mg accession number LR028036; ITS strain EABb 07/06-Rf accession number LR028037; ITS strain EABb 00/13-Su accession number LR028038; ITS strain EABb 10/28-Su accession number LR028039; ITS strain EABb 10/57-Fil accession number LR028040; ITS strain EABb 10/30-Fil accession number LR028041.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: The genes were amplified by PCR (primers 01 and 02 for bsr and 03 and 04 for tmr B, ) using KapaHifi polymerase (Roche, Basel, Switzerland). .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: 3′-A-overhangs were generated by DyNAzyme EXT (Finnzymes) at 72°C for 15 min. Amplified PCR fragments were purified from agarose gels and cloned into pCR2.1-TOPO vector (Invitrogen) followed by DNA purification and sequencing. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Amplification of the man5B ORF (GenBank Accession ID: HM241690; protein ID: ADK22147) from C. polysaccharolyticus genomic DNA and cloning into the pET-46b Ek/LIC vector (Novagen, San Diego, CA) were described previously [ ]. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Burkholderia cenocepacia conditional growth mutant library created by random promoter replacement of essential genes
    Article Snippet: PCR products and plasmids were purified using QIAquick PCR Purification Kit (Qiagen) and QIAprep Spin Miniprep Kit (Qiagen), respectively. .. PCR products and plasmids were purified using QIAquick PCR Purification Kit (Qiagen) and QIAprep Spin Miniprep Kit (Qiagen), respectively.

    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). .. DNA fragments were recovered from agarose gel slices using a QIAquick Gel Extraction kit (Qiagen).

    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions
    Article Snippet: Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions. .. Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions.

    Positive Control:

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: Real-Time PCR was performed on an ABI Prism 7000 Sequence Detection System machine. .. A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. Plasmid concentration was quantified using Nanodrop 2000 (Thermo Scientific) and a standard curve with 1:10 serial dilutions was prepared as reference for DNA quantification.


    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: A PCR product encoding TRP47 without the MYND-binding domain (No Motif construct) was amplified from a commercially synthesized pUc57 plasmid (GenScript) using the forward and reverse primers for the full-length GFP construct. .. PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany). .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).


    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: Paragraph title: Expression constructs and site-directed mutagenesis ... PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany). .. The plasmid DNA was treated with the restriction enzyme Mss I (Thermo Fisher, Waltham, MA, USA) and ligated with the amplified resistance genes using T4 DNA ligase (Thermo Fisher, Waltham, MA, USA).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: Fragments of interest were purified from agarose gels and the porcine ATP1A3 promoter was subcloned into Tol2 -vector, pT2AL200R150G, resulting in the construct, Tol2-pATP1A3:GFP ( ). .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Amino acid substitutions (Y12A, Y12F, Y12Q, H84A, H84E, H84M, H84Q, N92A, N136A, R196A, and R196H) were constructed by introducing site-specific mutations into the coding sequence of man5B using either the QuikChange II or QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA) according to the supplier’s instructions. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Screening of retroviral cDNA libraries for factors involved in protein phosphorylation in signaling cascades
    Article Snippet: For the expansion of bacteria transformed using pCR-Blunt II TOPO-based constructs, LB supplemented with 50 μg/ml kanamycin was used. .. Purification of plasmid DNA was performed using QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen).

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: Paragraph title: Molecular Cloning of (m)EETI-II Constructs ... Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.

    Real-time Polymerase Chain Reaction:

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: Paragraph title: Real time PCR ... A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany).


    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Escherichia coli XL10 competent cells were transformed with the product from the DpnI restriction digestion and plated onto lysogeny broth (LB) solidified with Bacto-agar (Difco) containing 100 μg mL-1 ampicillin sodium salt, and the plates were incubated at 37 °C overnight. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Structural and DNA-binding studies on the bovine antimicrobial peptide, indolicidin: evidence for multiple conformations involved in binding to membranes and DNA
    Article Snippet: Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH). .. Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH).

    Cell Culture:

    Article Title: Improving Acetate Tolerance of Escherichia coli by Rewiring Its Global Regulator cAMP Receptor Protein (CRP)
    Article Snippet: M9 minimal medium was used for cells cultured under acetate stress, which is composed of the following chemicals (per liter): 6.78 g Na2 HPO4 , 3 g KH2 PO4 , 0.5 g NaCl, 1 g NH4 Cl, 0.49 g MgSO4 .7H2 O, 0.011 g CaCl2 , 2 g glucose and 1 ml of trace metal stock solution. .. Gel purification and plasmid extraction were performed using the QIAquick gel extraction kit and the QIAprep spin miniprep kit (QIAGEN, Germany), respectively.


    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: Paragraph title: Expression constructs and site-directed mutagenesis ... PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Antibody Repertoire in Paraneoplastic Cerebellar Degeneration and Small Cell Lung Cancer
    Article Snippet: Paragraph title: Screening of cDNA expression libraries ... Plasmid DNA was purified with the QIAprep Spin Miniprep Kit (Qiagen, Santa Clarita, CA), and sequenced with the DNA sequencer ABI 377 (Applied Biosystems, Foster City, CA) using the Big Dye terminator ready mix (Applied Biosystems).

    Transformation Assay:

    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: Constructs were transformed into TOP10 E . coli (Invitrogen, Carlsbad, Calif.), and transformants were selected by growth on LB agar with ampicillin. .. PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: Amplicons were then cloned using the pGEM-T Easy System (Promega, Madison, WI, USA) and transformed into X10-Gold Ultracompetent Cells (Agilent, Santa Clara, CA, USA). .. Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany). .. The plasmid DNA was treated with the restriction enzyme Mss I (Thermo Fisher, Waltham, MA, USA) and ligated with the amplified resistance genes using T4 DNA ligase (Thermo Fisher, Waltham, MA, USA).

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: RT-PCR products were ligated into pCR2.1 vector and transformed into Top-10 E. coli cells (Topo-TA cloning kit, Invitrogen). .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: Finally, the Tol2-pATP1A3:GFP plasmid was sequenced in both directions to ensure correct insertion of the ATP1A3 promoter. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen). .. The pCS-zT2TP plasmid , kindly provided by Koichi Kawakami, National Institute of Genetics, Japan, was linearized with Not I, gel purified, and used as template for in vitro transcription of the Tol2 transposase mRNA.

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Escherichia coli XL10 competent cells were transformed with the product from the DpnI restriction digestion and plated onto lysogeny broth (LB) solidified with Bacto-agar (Difco) containing 100 μg mL-1 ampicillin sodium salt, and the plates were incubated at 37 °C overnight. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Screening of retroviral cDNA libraries for factors involved in protein phosphorylation in signaling cascades
    Article Snippet: For the expansion of bacteria transformed using pCR-Blunt II TOPO-based constructs, LB supplemented with 50 μg/ml kanamycin was used. .. Purification of plasmid DNA was performed using QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen).

    Article Title: Burkholderia cenocepacia conditional growth mutant library created by random promoter replacement of essential genes
    Article Snippet: Escherichia coli SY327 cells were transformed using the Z-competent buffer kit protocol (Zymo Research, Irvine, CA). .. PCR products and plasmids were purified using QIAquick PCR Purification Kit (Qiagen) and QIAprep Spin Miniprep Kit (Qiagen), respectively.

    Article Title: Characterisation of plasmid-mediated rmtB-1 in Enterobacteriaceae clinical isolates from São Paulo, Brazil
    Article Snippet: Cells were grown on MacConkey agar plates supplemented with azide or nalidixic acid (150 mg/L) plus amikacin (8 mg/L) or ampicillin (50 mg/L) for selection of transconjugant cells carrying rmtB-1 or β-lactamase encoding genes, respectively. .. Additionally, the DNA plasmids obtained of the extraction by QIAprep spin miniprep were transferred by electroporation and transformation into E. coli DH5α. .. The transformant cells were selected according to the colony growth on Luria Bertani agar (LB agar) plates supplemented with amikacin (8 mg/L), imipenem (1 mg/L) or ampicillin (50 mg/L) for selection of colonies carrying 16S RMTases or β-lactamase encoding genes.

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: The resulting pET15b TFP-knottin plasmids were transformed to NovaBlue ultracompetent cells (Novagen) and grown overnight on LB agar plates containing 100 mg/L ampicillin. .. Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.

    Derivative Assay:

    Article Title: Screening of retroviral cDNA libraries for factors involved in protein phosphorylation in signaling cascades
    Article Snippet: The retroviral cDNA library derived from human peripheral blood lymphocytes of 52 healthy human donors (pLib PBL cDNA; Clontech, Heidelberg, Germany) and the plasmids, BMN-I-GFPand BMN-I-GFP-cDNA1.2, were transformed into and expanded in the Escherichia coli strain XL1-blue in Luria–Bertani (LB) medium containing ampicillin (100 μg/ml). .. Purification of plasmid DNA was performed using QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen).

    Gel Purification:

    Article Title: Improving Acetate Tolerance of Escherichia coli by Rewiring Its Global Regulator cAMP Receptor Protein (CRP)
    Article Snippet: Restriction enzymes were from Fermentas (Burlington, Canada), while T4 DNA ligase was purchased from New England Biolabs (Ipswich, MA, USA). .. Gel purification and plasmid extraction were performed using the QIAquick gel extraction kit and the QIAprep spin miniprep kit (QIAGEN, Germany), respectively. .. Error-prone PCR was carried out using the GeneMorph® II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) with the following primers: 5’- GAGA GGATCC ATAACAGAGGATAACCGCGCATG-3’ , and 5’- AGAT GGTACC AAACAAAATGGCGCGCTACCAGGTAACGCGCCA-3’ (the underlined sequences correspond to Bam HI and Kpn I restrictions sites respectively), with 30 ng template to yield 1-3 amino acid substitutions per crp gene.

    Conjugation Assay:

    Article Title: Burkholderia cenocepacia conditional growth mutant library created by random promoter replacement of essential genes
    Article Snippet: Conjugation into B. cenocepacia K56-2 was accomplished by triparental mating (Craig et al. ) with E. coli DH5α carrying the helper plasmid pRK2013 (Figurski and Helinski ). .. PCR products and plasmids were purified using QIAquick PCR Purification Kit (Qiagen) and QIAprep Spin Miniprep Kit (Qiagen), respectively.


    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions
    Article Snippet: Serum was also analyzed using a quantitative colorimetric kit for triglycerides measurement (Wako, Osaka, Japan). .. Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions. .. Mutated human APP770 (hAPP770) was PCR amplified using Genomic DNA from the CAA mouse as a DNA template and using Phusion® High-Fidelity DNA Polymerase (NEB, Cat. No. M0530) for PCR amplification, with primer pairs: ATAAGAATGCGGCCGCATGCTGCCCGGTTTGGCAC (forward) and ACGCGTCGACGGTCTAGTTCTGCATCTGCTCAAAGAACTTGTAGG (reversal).

    Gas Chromatography:

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: For fungal identification, DNA was extracted using a phenol/Sevag treatment, following disruption of the mycelia in liquid nitrogen [ ], and the universal primers ITS1F (5′-CTT GGT CAT TTA GAG GAA GTA A-3′ [ ] and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′ [ ]) were used to amplify the complete sequence of internal transcribed spacer (ITS) 1, the 5.8S ribosomal RNA gene, and the internal transcribed spacer 2, flanked by the partial sequence of the 18S and 28S ribosomal RNA genes. .. Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon.


    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: The samples were purified with agarose gel electrophoresis, using Wizard SV Gel and a PCR Clean-Up System (Promega) followed by ligation with T4 DNA ligase (New England Biolabs Inc.). .. Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.


    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: The PCR product (12.5 μL) was incubated with methylation-dependent restriction enzyme DpnI at 37 °C for 8 hours to digest the parental plasmid DNA. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).


    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: The plasmid pPha-T1 ( ) was used as a template for a deletion PCR (primers 05 and 06, ) to remove the Sh Ble gene and to introduce recognition sites for the restriction enzymes Mss I and Eco RI. .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).


    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: Sequences were then concatenated into a single sequence with the “Combine FASTA” tool of a locally installed version of SMS , and the codon table was generated using the tool “Codon Usage” of SMS ( ). .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: 3′-A-overhangs were generated by DyNAzyme EXT (Finnzymes) at 72°C for 15 min. Amplified PCR fragments were purified from agarose gels and cloned into pCR2.1-TOPO vector (Invitrogen) followed by DNA purification and sequencing. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: The products of these two semi-nested reactions were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (QIAGEN), ligated into pJET 1.2 plasmids and cloned using a CloneJET PCR Cloning Kit (Life Technologies) in DH5α cells. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit. .. Sequencing reads were trimmed and assembled into a complete sequence using the program Sequencher 5.4.6 (Gene Codes Corporation).

    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: A PCR product encoding TRP47 without the MYND-binding domain (No Motif construct) was amplified from a commercially synthesized pUc57 plasmid (GenScript) using the forward and reverse primers for the full-length GFP construct. .. PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame. .. Lysine-to-arginine mutation of the full-length TRP47 pAcGFP1-C construct was performed using the QuikChange II SiteDirected Mutagenesis Kit (Agilent, Santa Clara, Calif.) according to the manufacturer’s instructions.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: The resulting PCR product was ligated and delivered to E. coli XL1 Blue by electroporation, followed by selection on ampicillin plates. .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: Paragraph title: RNA extraction and reverse-transcription PCR ... Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: 3′-A-overhangs were generated by DyNAzyme EXT (Finnzymes) at 72°C for 15 min. Amplified PCR fragments were purified from agarose gels and cloned into pCR2.1-TOPO vector (Invitrogen) followed by DNA purification and sequencing. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: Real-Time PCR was performed on an ABI Prism 7000 Sequence Detection System machine. .. A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. Plasmid concentration was quantified using Nanodrop 2000 (Thermo Scientific) and a standard curve with 1:10 serial dilutions was prepared as reference for DNA quantification.

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: The PCR product (12.5 μL) was incubated with methylation-dependent restriction enzyme DpnI at 37 °C for 8 hours to digest the parental plasmid DNA. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Screening of retroviral cDNA libraries for factors involved in protein phosphorylation in signaling cascades
    Article Snippet: For the expansion of bacteria transformed using pCR-Blunt II TOPO-based constructs, LB supplemented with 50 μg/ml kanamycin was used. .. Purification of plasmid DNA was performed using QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen).

    Article Title: Burkholderia cenocepacia conditional growth mutant library created by random promoter replacement of essential genes
    Article Snippet: Amplification conditions were optimized for each primer pair. .. PCR products and plasmids were purified using QIAquick PCR Purification Kit (Qiagen) and QIAprep Spin Miniprep Kit (Qiagen), respectively. .. DNA sequencing was performed by The Center for Applied Genomics (TCAG) at The Hospital for Sick Children, Toronto, Ontario.

    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). .. Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA).

    Article Title: Evidence that the Ceratobasidium-like white-thread blight and black rot fungal pathogens from persimmon and tea crops in the Brazilian Atlantic Forest agroecosystem are two distinct phylospecies
    Article Snippet: Paragraph title: Cloning of PCR amplicons ... Selected recombinant plasmids from Escherichia coli One Shot DH5a-T1R (Invitrogen) were extracted from each one of the cloned heterogeneous samples and purified using QIAprep Spin Miniprep kits (Qiagen).

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: The samples were purified with agarose gel electrophoresis, using Wizard SV Gel and a PCR Clean-Up System (Promega) followed by ligation with T4 DNA ligase (New England Biolabs Inc.). .. Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.


    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: The products of these two semi-nested reactions were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (QIAGEN), ligated into pJET 1.2 plasmids and cloned using a CloneJET PCR Cloning Kit (Life Technologies) in DH5α cells. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit. .. Sequencing reads were trimmed and assembled into a complete sequence using the program Sequencher 5.4.6 (Gene Codes Corporation).

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: For fungal identification, DNA was extracted using a phenol/Sevag treatment, following disruption of the mycelia in liquid nitrogen [ ], and the universal primers ITS1F (5′-CTT GGT CAT TTA GAG GAA GTA A-3′ [ ] and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′ [ ]) were used to amplify the complete sequence of internal transcribed spacer (ITS) 1, the 5.8S ribosomal RNA gene, and the internal transcribed spacer 2, flanked by the partial sequence of the 18S and 28S ribosomal RNA genes. .. Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: Sequences were then concatenated into a single sequence with the “Combine FASTA” tool of a locally installed version of SMS , and the codon table was generated using the tool “Codon Usage” of SMS ( ). .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: To confirm the nbs1 gene structure and sequence as predicted by the Broad Institute genome sequence, reverse-transcription (RT) PCR was used on purified poly-A RNA from a J6;5x4 K+6 mushroom (SuperScript One-Step RT-PCR for Long Templates, Invitrogen; PolyATtract mRNA Isolation System III, Promega). .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: 3′-A-overhangs were generated by DyNAzyme EXT (Finnzymes) at 72°C for 15 min. Amplified PCR fragments were purified from agarose gels and cloned into pCR2.1-TOPO vector (Invitrogen) followed by DNA purification and sequencing. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: Real-Time PCR was performed on an ABI Prism 7000 Sequence Detection System machine. .. A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany).

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Amino acid substitutions (Y12A, Y12F, Y12Q, H84A, H84E, H84M, H84Q, N92A, N136A, R196A, and R196H) were constructed by introducing site-specific mutations into the coding sequence of man5B using either the QuikChange II or QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA) according to the supplier’s instructions. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Paragraph title: DNA manipulation and sequencing ... Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA).

    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions
    Article Snippet: Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions. .. Both empty vector and vector-hAPP770 were amplified in DH-5α cells (Strategene).


    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Recombinant DNA techniques were carried out as described [ ] or according to supplier instructions. .. Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA).

    Article Title: Evidence that the Ceratobasidium-like white-thread blight and black rot fungal pathogens from persimmon and tea crops in the Brazilian Atlantic Forest agroecosystem are two distinct phylospecies
    Article Snippet: To separate distinct alleles of the ITS-5.8S rDNA operon from the same heterogeneous PCR product the heterogeneous amplicons were cloned into the vector PCR2.1-TOPO (Invitrogen). .. Selected recombinant plasmids from Escherichia coli One Shot DH5a-T1R (Invitrogen) were extracted from each one of the cloned heterogeneous samples and purified using QIAprep Spin Miniprep kits (Qiagen). .. Primers for one of the multiple cloning sites of the vector were used for reamplification and sequencing.

    Cellular Antioxidant Activity Assay:

    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions
    Article Snippet: Serum was also analyzed using a quantitative colorimetric kit for triglycerides measurement (Wako, Osaka, Japan). .. Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions. .. Mutated human APP770 (hAPP770) was PCR amplified using Genomic DNA from the CAA mouse as a DNA template and using Phusion® High-Fidelity DNA Polymerase (NEB, Cat. No. M0530) for PCR amplification, with primer pairs: ATAAGAATGCGGCCGCATGCTGCCCGGTTTGGCAC (forward) and ACGCGTCGACGGTCTAGTTCTGCATCTGCTCAAAGAACTTGTAGG (reversal).

    Boom Method:

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany).

    DNA Extraction:

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: Real-Time PCR was performed on an ABI Prism 7000 Sequence Detection System machine. .. A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. Plasmid concentration was quantified using Nanodrop 2000 (Thermo Scientific) and a standard curve with 1:10 serial dilutions was prepared as reference for DNA quantification.

    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). .. DNA was amplified by PCR using VentR DNA polymerase (NEB).

    Molecular Cloning:

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: Paragraph title: 2.1. Screening of Fungal Isolates and Molecular Cloning ... Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon.

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: Paragraph title: Molecular Cloning of (m)EETI-II Constructs ... Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.

    In Vivo:

    Article Title: Antibody Repertoire in Paraneoplastic Cerebellar Degeneration and Small Cell Lung Cancer
    Article Snippet: Phage clones were subcloned in pBluescript plasmid using the in vivo excision phage rescue protocol (Stratagene, La Jolla, CA). .. Plasmid DNA was purified with the QIAprep Spin Miniprep Kit (Qiagen, Santa Clarita, CA), and sequenced with the DNA sequencer ABI 377 (Applied Biosystems, Foster City, CA) using the Big Dye terminator ready mix (Applied Biosystems).


    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: The resulting PCR product was ligated and delivered to E. coli XL1 Blue by electroporation, followed by selection on ampicillin plates. .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).

    Article Title: Characterisation of plasmid-mediated rmtB-1 in Enterobacteriaceae clinical isolates from São Paulo, Brazil
    Article Snippet: Cells were grown on MacConkey agar plates supplemented with azide or nalidixic acid (150 mg/L) plus amikacin (8 mg/L) or ampicillin (50 mg/L) for selection of transconjugant cells carrying rmtB-1 or β-lactamase encoding genes, respectively. .. Additionally, the DNA plasmids obtained of the extraction by QIAprep spin miniprep were transferred by electroporation and transformation into E. coli DH5α. .. The transformant cells were selected according to the colony growth on Luria Bertani agar (LB agar) plates supplemented with amikacin (8 mg/L), imipenem (1 mg/L) or ampicillin (50 mg/L) for selection of colonies carrying 16S RMTases or β-lactamase encoding genes.


    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: Paragraph title: Expression constructs and site-directed mutagenesis ... PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Paragraph title: Cloning and site-directed mutagenesis ... Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).


    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: A PCR product encoding TRP47 without the MYND-binding domain (No Motif construct) was amplified from a commercially synthesized pUc57 plasmid (GenScript) using the forward and reverse primers for the full-length GFP construct. .. PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame. .. Lysine-to-arginine mutation of the full-length TRP47 pAcGFP1-C construct was performed using the QuikChange II SiteDirected Mutagenesis Kit (Agilent, Santa Clara, Calif.) according to the manufacturer’s instructions.

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: To confirm the nbs1 gene structure and sequence as predicted by the Broad Institute genome sequence, reverse-transcription (RT) PCR was used on purified poly-A RNA from a J6;5x4 K+6 mushroom (SuperScript One-Step RT-PCR for Long Templates, Invitrogen; PolyATtract mRNA Isolation System III, Promega). .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Antibody Repertoire in Paraneoplastic Cerebellar Degeneration and Small Cell Lung Cancer
    Article Snippet: Briefly, immunoscreening of the cDNA library with sera (dilution 1∶1000) was performed to reach isolated positive plaques. .. Plasmid DNA was purified with the QIAprep Spin Miniprep Kit (Qiagen, Santa Clarita, CA), and sequenced with the DNA sequencer ABI 377 (Applied Biosystems, Foster City, CA) using the Big Dye terminator ready mix (Applied Biosystems).

    Article Title: The Escherichia coli GcvB sRNA Uses Genetic Redundancy to Control cycA Expression
    Article Snippet: X-gal was added at 40 μ g mL−1 . .. Plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (Qiagen, Santa Clara, CA). .. Vent DNA polymerase, Taq DNA polymerase, and restriction enzymes were from New England Biolabs, Inc. (Beverly, MA).

    Microelectrode Array:

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: All isolates were grown on malt agar extract (MEA) medium at 25 °C and screened for the presence of dsRNA elements using phenol/Sevag treatment and enzymatic digestions with DNase I (Promega) and S1 nuclease (Promega) as described previously [ ]. .. Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon.

    Size-exclusion Chromatography:

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: Thermocycler conditions were 50° for 30 min, 94° for 2 min, then 40 cycles of 94° for 30 sec, 55° for 30 sec, and 68° for 3.5 min, then a final extension at 72° for 7 min, and a 4° hold. .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: The PCR was performed in a total volume of 10 µL containing 100 ng DNA (pCR2.1-TOPO® Vector (Invitrogen) containing the porcine ATP1A3 promoter sequence), 1X PCR buffer, 0.02 U Phusion polymerase, 0.25 mM dNTP and 0.5 µM of each primer under the following conditions: Initial denaturing at 98°C for 1 min, followed by 10 cycles at 98°C for 5 sec, touch-down from 67–62°C for 10 sec and extension at 72°C for 10 sec, followed by 25 cycles at 98°C for 5 sec, 62°C for 10 sec, 72°C for 10 sec, and the final extension step for 5 min at 72°C. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).

    Electrophoretic Mobility Shift Assay:

    Article Title: Structural and DNA-binding studies on the bovine antimicrobial peptide, indolicidin: evidence for multiple conformations involved in binding to membranes and DNA
    Article Snippet: Paragraph title: DNA/RNA gel retardation assay ... Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH).


    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: The products of these two semi-nested reactions were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (QIAGEN), ligated into pJET 1.2 plasmids and cloned using a CloneJET PCR Cloning Kit (Life Technologies) in DH5α cells. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit. .. Sequencing reads were trimmed and assembled into a complete sequence using the program Sequencher 5.4.6 (Gene Codes Corporation).

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: To confirm the nbs1 gene structure and sequence as predicted by the Broad Institute genome sequence, reverse-transcription (RT) PCR was used on purified poly-A RNA from a J6;5x4 K+6 mushroom (SuperScript One-Step RT-PCR for Long Templates, Invitrogen; PolyATtract mRNA Isolation System III, Promega). .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: Finally, the Tol2-pATP1A3:GFP plasmid was sequenced in both directions to ensure correct insertion of the ATP1A3 promoter. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen). .. The pCS-zT2TP plasmid , kindly provided by Koichi Kawakami, National Institute of Genetics, Japan, was linearized with Not I, gel purified, and used as template for in vitro transcription of the Tol2 transposase mRNA.

    Article Title: Screening of retroviral cDNA libraries for factors involved in protein phosphorylation in signaling cascades
    Article Snippet: For the expansion of bacteria transformed using pCR-Blunt II TOPO-based constructs, LB supplemented with 50 μg/ml kanamycin was used. .. Purification of plasmid DNA was performed using QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen). .. Wild-type (wt) human promonocytic U937 cells were purchased from ATCC (CRL-1593).

    Article Title: Antibody Repertoire in Paraneoplastic Cerebellar Degeneration and Small Cell Lung Cancer
    Article Snippet: Phage clones were subcloned in pBluescript plasmid using the in vivo excision phage rescue protocol (Stratagene, La Jolla, CA). .. Plasmid DNA was purified with the QIAprep Spin Miniprep Kit (Qiagen, Santa Clarita, CA), and sequenced with the DNA sequencer ABI 377 (Applied Biosystems, Foster City, CA) using the Big Dye terminator ready mix (Applied Biosystems). .. Positive clones were sequenced on both strands.

    Article Title: Structural and DNA-binding studies on the bovine antimicrobial peptide, indolicidin: evidence for multiple conformations involved in binding to membranes and DNA
    Article Snippet: The distributions of the backbone dihedral angles of the final converged structures were evaluated by the representation of the Ramachandran dihedral pattern, indicating the deviations from the sterically allowed (φ, ψ) angle limits, using PROCHECK-NMR ( ). .. Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH). .. Yeast RNA was resuspended in RNase-free water.

    Article Title: Burkholderia cenocepacia conditional growth mutant library created by random promoter replacement of essential genes
    Article Snippet: Amplification conditions were optimized for each primer pair. .. PCR products and plasmids were purified using QIAquick PCR Purification Kit (Qiagen) and QIAprep Spin Miniprep Kit (Qiagen), respectively. .. DNA sequencing was performed by The Center for Applied Genomics (TCAG) at The Hospital for Sick Children, Toronto, Ontario.

    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). .. DNA was amplified by PCR using VentR DNA polymerase (NEB).

    Article Title: Evidence that the Ceratobasidium-like white-thread blight and black rot fungal pathogens from persimmon and tea crops in the Brazilian Atlantic Forest agroecosystem are two distinct phylospecies
    Article Snippet: To separate distinct alleles of the ITS-5.8S rDNA operon from the same heterogeneous PCR product the heterogeneous amplicons were cloned into the vector PCR2.1-TOPO (Invitrogen). .. Selected recombinant plasmids from Escherichia coli One Shot DH5a-T1R (Invitrogen) were extracted from each one of the cloned heterogeneous samples and purified using QIAprep Spin Miniprep kits (Qiagen). .. Primers for one of the multiple cloning sites of the vector were used for reamplification and sequencing.

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: The samples were purified with agarose gel electrophoresis, using Wizard SV Gel and a PCR Clean-Up System (Promega) followed by ligation with T4 DNA ligase (New England Biolabs Inc.). .. Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: RT-PCR products were ligated into pCR2.1 vector and transformed into Top-10 E. coli cells (Topo-TA cloning kit, Invitrogen). .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).


    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: The resulting PCR product was ligated and delivered to E. coli XL1 Blue by electroporation, followed by selection on ampicillin plates. .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany).

    Gel Extraction:

    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: The products of these two semi-nested reactions were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (QIAGEN), ligated into pJET 1.2 plasmids and cloned using a CloneJET PCR Cloning Kit (Life Technologies) in DH5α cells. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit.

    Article Title: Improving Acetate Tolerance of Escherichia coli by Rewiring Its Global Regulator cAMP Receptor Protein (CRP)
    Article Snippet: Restriction enzymes were from Fermentas (Burlington, Canada), while T4 DNA ligase was purchased from New England Biolabs (Ipswich, MA, USA). .. Gel purification and plasmid extraction were performed using the QIAquick gel extraction kit and the QIAprep spin miniprep kit (QIAGEN, Germany), respectively. .. Error-prone PCR was carried out using the GeneMorph® II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) with the following primers: 5’- GAGA GGATCC ATAACAGAGGATAACCGCGCATG-3’ , and 5’- AGAT GGTACC AAACAAAATGGCGCGCTACCAGGTAACGCGCCA-3’ (the underlined sequences correspond to Bam HI and Kpn I restrictions sites respectively), with 30 ng template to yield 1-3 amino acid substitutions per crp gene.

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA). .. Caldicellulosiruptor bescii DSM6725 ORF0234 (Athe_0234; GenPept Accession ID: YP_002572157) was amplified with PrimeStar® DNA polymerase (Takara Bio Inc., Shiga, Japan) using primers Cb234F and Cb234R (Table S1 in ).

    cDNA Library Assay:

    Article Title: Screening of retroviral cDNA libraries for factors involved in protein phosphorylation in signaling cascades
    Article Snippet: Paragraph title: cDNA library, plasmids and bacteria strains ... Purification of plasmid DNA was performed using QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen).

    Article Title: Antibody Repertoire in Paraneoplastic Cerebellar Degeneration and Small Cell Lung Cancer
    Article Snippet: Briefly, immunoscreening of the cDNA library with sera (dilution 1∶1000) was performed to reach isolated positive plaques. .. Plasmid DNA was purified with the QIAprep Spin Miniprep Kit (Qiagen, Santa Clarita, CA), and sequenced with the DNA sequencer ABI 377 (Applied Biosystems, Foster City, CA) using the Big Dye terminator ready mix (Applied Biosystems).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Mycoviral Population Dynamics in Spanish Isolates of the Entomopathogenic Fungus Beauveria bassiana
    Article Snippet: For fungal identification, DNA was extracted using a phenol/Sevag treatment, following disruption of the mycelia in liquid nitrogen [ ], and the universal primers ITS1F (5′-CTT GGT CAT TTA GAG GAA GTA A-3′ [ ] and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′ [ ]) were used to amplify the complete sequence of internal transcribed spacer (ITS) 1, the 5.8S ribosomal RNA gene, and the internal transcribed spacer 2, flanked by the partial sequence of the 18S and 28S ribosomal RNA genes. .. Plasmids were extracted using the QIAprep Spin Miniprep Kit (QIAGEN, Hilden, Germany) and at least three independent clones were sequenced for each amplicon.

    Mouse Assay:

    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions
    Article Snippet: Serum was also analyzed using a quantitative colorimetric kit for triglycerides measurement (Wako, Osaka, Japan). .. Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions. .. Mutated human APP770 (hAPP770) was PCR amplified using Genomic DNA from the CAA mouse as a DNA template and using Phusion® High-Fidelity DNA Polymerase (NEB, Cat. No. M0530) for PCR amplification, with primer pairs: ATAAGAATGCGGCCGCATGCTGCCCGGTTTGGCAC (forward) and ACGCGTCGACGGTCTAGTTCTGCATCTGCTCAAAGAACTTGTAGG (reversal).

    Plasmid Preparation:

    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: The products of these two semi-nested reactions were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (QIAGEN), ligated into pJET 1.2 plasmids and cloned using a CloneJET PCR Cloning Kit (Life Technologies) in DH5α cells. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit. .. Sequencing reads were trimmed and assembled into a complete sequence using the program Sequencher 5.4.6 (Gene Codes Corporation).

    Article Title: Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response
    Article Snippet: A PCR product encoding TRP47 without the MYND-binding domain (No Motif construct) was amplified from a commercially synthesized pUc57 plasmid (GenScript) using the forward and reverse primers for the full-length GFP construct. .. PCR screening was used to verify correct insert size, and plasmids from positive colonies were isolated (QIAprep Spin Miniprep Kit, Qiagen) and sequenced to verify proper orientation and frame.

    Article Title: Blasticidin-S deaminase, a new selection marker for genetic transformation of the diatom Phaeodactylum tricornutum
    Article Snippet: The resulting PCR product was ligated and delivered to E. coli XL1 Blue by electroporation, followed by selection on ampicillin plates. .. Plasmid preparation was done according to the manufacturer’s protocol using “QIAprep Spin Miniprep Kit” (QIAGEN, Hilden, Germany). .. The plasmid DNA was treated with the restriction enzyme Mss I (Thermo Fisher, Waltham, MA, USA) and ligated with the amplified resistance genes using T4 DNA ligase (Thermo Fisher, Waltham, MA, USA).

    Article Title: Improving Acetate Tolerance of Escherichia coli by Rewiring Its Global Regulator cAMP Receptor Protein (CRP)
    Article Snippet: Restriction enzymes were from Fermentas (Burlington, Canada), while T4 DNA ligase was purchased from New England Biolabs (Ipswich, MA, USA). .. Gel purification and plasmid extraction were performed using the QIAquick gel extraction kit and the QIAprep spin miniprep kit (QIAGEN, Germany), respectively. .. Error-prone PCR was carried out using the GeneMorph® II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) with the following primers: 5’- GAGA GGATCC ATAACAGAGGATAACCGCGCATG-3’ , and 5’- AGAT GGTACC AAACAAAATGGCGCGCTACCAGGTAACGCGCCA-3’ (the underlined sequences correspond to Bam HI and Kpn I restrictions sites respectively), with 30 ng template to yield 1-3 amino acid substitutions per crp gene.

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: RT-PCR products were ligated into pCR2.1 vector and transformed into Top-10 E. coli cells (Topo-TA cloning kit, Invitrogen). .. Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen). .. The plasmid containing the cDNA of nbs1 was then sequenced using primers from .

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: Finally, the Tol2-pATP1A3:GFP plasmid was sequenced in both directions to ensure correct insertion of the ATP1A3 promoter. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen). .. The pCS-zT2TP plasmid , kindly provided by Koichi Kawakami, National Institute of Genetics, Japan, was linearized with Not I, gel purified, and used as template for in vitro transcription of the Tol2 transposase mRNA.

    Article Title: Identification of a new genotype of Torque Teno Mini virus
    Article Snippet: Real-Time PCR was performed on an ABI Prism 7000 Sequence Detection System machine. .. A positive control was prepared by cloning PCR products into the pCR2-TOPO plasmid vector according to the instructions of the manufacturer (Invitrogen, Karlsruhe, Germany) followed by plasmid DNA isolation with QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). .. Plasmid concentration was quantified using Nanodrop 2000 (Thermo Scientific) and a standard curve with 1:10 serial dilutions was prepared as reference for DNA quantification.

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: The PCR product (12.5 μL) was incubated with methylation-dependent restriction enzyme DpnI at 37 °C for 8 hours to digest the parental plasmid DNA. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Screening of retroviral cDNA libraries for factors involved in protein phosphorylation in signaling cascades
    Article Snippet: For the expansion of bacteria transformed using pCR-Blunt II TOPO-based constructs, LB supplemented with 50 μg/ml kanamycin was used. .. Purification of plasmid DNA was performed using QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen). .. Wild-type (wt) human promonocytic U937 cells were purchased from ATCC (CRL-1593).

    Article Title: The Deinococcus radiodurans DR1245 Protein, a DdrB Partner Homologous to YbjN Proteins and Reminiscent of Type III Secretion System Chaperones
    Article Snippet: When necessary, media were supplemented with the appropriate antibiotics used at the following final concentrations: kanamycin, 6 µg/mL; chloramphenicol, 3 µg/mL; spectinomycin, 75 µg/mL for D. radiodurans and 40 µg/mL for E. coli ; and ampicillin, 100 µg/mL. .. Plasmid DNA was extracted from E. coli using the QIAprep spin miniprep kit (Qiagen). .. Chromosomal DNA of D. radiodurans was isolated from stationary phase cells in TGY2x medium.

    Article Title: Antibody Repertoire in Paraneoplastic Cerebellar Degeneration and Small Cell Lung Cancer
    Article Snippet: Phage clones were subcloned in pBluescript plasmid using the in vivo excision phage rescue protocol (Stratagene, La Jolla, CA). .. Plasmid DNA was purified with the QIAprep Spin Miniprep Kit (Qiagen, Santa Clarita, CA), and sequenced with the DNA sequencer ABI 377 (Applied Biosystems, Foster City, CA) using the Big Dye terminator ready mix (Applied Biosystems). .. Positive clones were sequenced on both strands.

    Article Title: Structural and DNA-binding studies on the bovine antimicrobial peptide, indolicidin: evidence for multiple conformations involved in binding to membranes and DNA
    Article Snippet: The distributions of the backbone dihedral angles of the final converged structures were evaluated by the representation of the Ramachandran dihedral pattern, indicating the deviations from the sterically allowed (φ, ψ) angle limits, using PROCHECK-NMR ( ). .. Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH). .. Yeast RNA was resuspended in RNase-free water.

    Article Title: Burkholderia cenocepacia conditional growth mutant library created by random promoter replacement of essential genes
    Article Snippet: Conjugation into B. cenocepacia K56-2 was accomplished by triparental mating (Craig et al. ) with E. coli DH5α carrying the helper plasmid pRK2013 (Figurski and Helinski ). .. PCR products and plasmids were purified using QIAquick PCR Purification Kit (Qiagen) and QIAprep Spin Miniprep Kit (Qiagen), respectively.

    Article Title: Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
    Article Snippet: Restriction enzymes and DNA modifying enzymes were purchased from Invitrogen (Carlsbad, CA), New England Biolabs (Ipswich, MA), and Promega (Madison, WI). .. Plasmid DNA was extracted using a QIAprep Spin Miniprep kit (Qiagen, Valencia, CA). .. DNA fragments were recovered from agarose gel slices using a QIAquick Gel Extraction kit (Qiagen).

    Article Title: The Escherichia coli GcvB sRNA Uses Genetic Redundancy to Control cycA Expression
    Article Snippet: X-gal was added at 40 μ g mL−1 . .. Plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (Qiagen, Santa Clara, CA). .. Vent DNA polymerase, Taq DNA polymerase, and restriction enzymes were from New England Biolabs, Inc. (Beverly, MA).

    Article Title: Mutant Amyloid Precursor Protein Differentially Alters Adipose Biology under Obesogenic and Non-Obesogenic Conditions
    Article Snippet: Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions. .. Cell Cloning and Transfection Genomic DNA from CAA mice was extracted from the tails using QIAprep® Spin Miniprep Kit (Qiagen, Cat. No. 27104) according to the manufacturer’s instructions.

    Article Title: Evidence that the Ceratobasidium-like white-thread blight and black rot fungal pathogens from persimmon and tea crops in the Brazilian Atlantic Forest agroecosystem are two distinct phylospecies
    Article Snippet: To separate distinct alleles of the ITS-5.8S rDNA operon from the same heterogeneous PCR product the heterogeneous amplicons were cloned into the vector PCR2.1-TOPO (Invitrogen). .. Selected recombinant plasmids from Escherichia coli One Shot DH5a-T1R (Invitrogen) were extracted from each one of the cloned heterogeneous samples and purified using QIAprep Spin Miniprep kits (Qiagen).

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: The genetic constructs had 5′ BsrGI and 3′ NheI restriction sites, which were used to insert the gene behind the gene for TFP through restriction digestion enzymes on the suppliers’ and the pET-15b plasmid. .. Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.


    Article Title: Structural and DNA-binding studies on the bovine antimicrobial peptide, indolicidin: evidence for multiple conformations involved in binding to membranes and DNA
    Article Snippet: Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH). .. Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH).

    RNA Extraction:

    Article Title: A Mutation in the FHA Domain of Coprinus cinereus Nbs1 Leads to Spo11-Independent Meiotic Recombination and Chromosome Segregation
    Article Snippet: Paragraph title: RNA extraction and reverse-transcription PCR ... Individual colonies were picked, grown in 5 ml LB media overnight, and then the plasmid was extracted using the Qiaprep Spin Miniprep Kit (Qiagen).

    Positron Emission Tomography:

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Amplification of the man5B ORF (GenBank Accession ID: HM241690; protein ID: ADK22147) from C. polysaccharolyticus genomic DNA and cloning into the pET-46b Ek/LIC vector (Novagen, San Diego, CA) were described previously [ ]. .. Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA).

    Article Title: Structural and DNA-binding studies on the bovine antimicrobial peptide, indolicidin: evidence for multiple conformations involved in binding to membranes and DNA
    Article Snippet: The distributions of the backbone dihedral angles of the final converged structures were evaluated by the representation of the Ramachandran dihedral pattern, indicating the deviations from the sterically allowed (φ, ψ) angle limits, using PROCHECK-NMR ( ). .. Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH). .. Yeast RNA was resuspended in RNase-free water.

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: The genetic constructs had 5′ BsrGI and 3′ NheI restriction sites, which were used to insert the gene behind the gene for TFP through restriction digestion enzymes on the suppliers’ and the pET-15b plasmid. .. Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.

    Agarose Gel Electrophoresis:

    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: The products of these two semi-nested reactions were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (QIAGEN), ligated into pJET 1.2 plasmids and cloned using a CloneJET PCR Cloning Kit (Life Technologies) in DH5α cells. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit.

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA). .. Caldicellulosiruptor bescii DSM6725 ORF0234 (Athe_0234; GenPept Accession ID: YP_002572157) was amplified with PrimeStar® DNA polymerase (Takara Bio Inc., Shiga, Japan) using primers Cb234F and Cb234R (Table S1 in ).

    Article Title: Structural and DNA-binding studies on the bovine antimicrobial peptide, indolicidin: evidence for multiple conformations involved in binding to membranes and DNA
    Article Snippet: Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH). .. Plasmid PET-16b was purified using a QIAprep Spin Miniprep Kit (Qiagen, GMbH).

    Article Title: Protecting Encapsulin Nanoparticles with Cysteine-Knot Miniproteins
    Article Snippet: The samples were purified with agarose gel electrophoresis, using Wizard SV Gel and a PCR Clean-Up System (Promega) followed by ligation with T4 DNA ligase (New England Biolabs Inc.). .. Plasmids were extracted from individual colonies using a Qiagen spin miniprep kit and sequenced by Eurofins using a standard T7 terminal reverse primer.

    Functional Assay:

    Article Title: Mutational and Structural Analyses of Caldanaerobius polysaccharolyticus Man5B Reveal Novel Active Site Residues for Family 5 Glycoside Hydrolases
    Article Snippet: Individual colonies were cultivated in LB medium supplemented with ampicillin until stationary phase was reached, and plasmids were extracted using a QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA). .. The presence of the site-directed mutations was confirmed by DNA sequencing (W.M.

    Activation Assay:

    Article Title: Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens
    Article Snippet: Thermal cycling conditions used in all PCR reactions were the same as those described by , except with the addition of an initial heating step at 95°C for 2 min, which was required for the activation of the KOD polymerase. .. Plasmids were purified from overnight cultures using a QIAprep Spin Miniprep Kit (QIAGEN) and five clones for each PCR product were Sanger sequenced in both directions by GATC Biotech using plasmid-specific sequencing primers provided in the cloning kit.

    DNA Purification:

    Article Title: Molecular Cloning and Characterization of Porcine Na+/K+-ATPase Isoforms ?1, ?2, ?3 and the ATP1A3 Promoter
    Article Snippet: 3′-A-overhangs were generated by DyNAzyme EXT (Finnzymes) at 72°C for 15 min. Amplified PCR fragments were purified from agarose gels and cloned into pCR2.1-TOPO vector (Invitrogen) followed by DNA purification and sequencing. .. Plasmid DNA for microinjection was purified from culture of transformed DH5α cells (Invitrogen) using the QIAprep Spin Miniprep Kit (Qiagen).


    Article Title: The Deinococcus radiodurans DR1245 Protein, a DdrB Partner Homologous to YbjN Proteins and Reminiscent of Type III Secretion System Chaperones
    Article Snippet: Plasmid DNA was extracted from E. coli using the QIAprep spin miniprep kit (Qiagen). .. Plasmid DNA was extracted from E. coli using the QIAprep spin miniprep kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen plasmid spin mini preparation column
    Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after <t>transfection</t> by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p
    Plasmid Spin Mini Preparation Column, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more spin mini preparation column/product/Qiagen
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    plasmid spin mini preparation column - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results

    Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p

    Journal: PLoS ONE

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability

    doi: 10.1371/journal.pone.0121581

    Figure Lengend Snippet: Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p

    Article Snippet: Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells.

    Techniques: Non-Homologous End Joining, Modification, Transfection, FACS, Plasmid Preparation

    Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p

    Journal: PLoS ONE

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability

    doi: 10.1371/journal.pone.0121581

    Figure Lengend Snippet: Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p

    Article Snippet: Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells.

    Techniques: Plasmid Preparation, Transfection, FACS

    Agarose gel electrophoresis image showing selected plasmids isolated via Qiaprep spin column alkaline lysis method. M, DNA marker; Lane 1, C. jejuni 81–176; lane 2, E. coli 50192; lane 3, E. coli 50193; lanes 4–18 Plasmid mini preps of selected Campylobacter isolates.

    Journal: Pathogens

    Article Title: Exploring PFGE for Detecting Large Plasmids in Campylobacter jejuni and Campylobacter coli Isolated from Various Retail Meats

    doi: 10.3390/pathogens3040833

    Figure Lengend Snippet: Agarose gel electrophoresis image showing selected plasmids isolated via Qiaprep spin column alkaline lysis method. M, DNA marker; Lane 1, C. jejuni 81–176; lane 2, E. coli 50192; lane 3, E. coli 50193; lanes 4–18 Plasmid mini preps of selected Campylobacter isolates.

    Article Snippet: Plasmids were first isolated using plasmid spin Mini-preparation column (Qiaprep Miniprep, Qiagen Inc., Valencia, CA, USA).

    Techniques: Agarose Gel Electrophoresis, Electrophoresis, Isolation, Alkaline Lysis, Marker, Plasmid Preparation

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Journal: BMC Genomics

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    doi: 10.1186/1471-2164-11-599

    Figure Lengend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Article Snippet: KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany).

    Techniques: Isolation, Plasmid Preparation