scfv antibodies  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    QIAprep Spin Miniprep Kit
    Description:
    For purification of up to 20 μg molecular biology grade plasmid DNA Kit contents Qiagen QIAprep Spin Miniprep Kit 50 preps 1 to 100mL Culture Volume 50L Elution Volume Molecular Biology Grade Plasmid DNA Purification Silica Technology Spin Column Format Manual Processing 30 min Time Run 20g Yield Ideal for Fluorescent and Radioactive Sequencing Ligation Cloning Transformation etc For Purification of up to 20μg Molecular Biology Grade Plasmid DNA Includes 50 QIAprep Spin Columns Reagents Buffers 2mL Collection Tubes Benefits Ready to use plasmid DNA in minutes Reproducible yields of molecular biology grade plasmid DNA Single protocol for high and low copy vectors Even higher yields with the High Yield Supplementary Protocol Improved QIAprep 2 0 Spin Column GelPilot loading dye for convenient sample analysis
    Catalog Number:
    27104
    Price:
    92.8
    Category:
    QIAprep Spin Miniprep Kit
    Buy from Supplier


    Structured Review

    Qiagen scfv antibodies
    QIAprep Spin Miniprep Kit
    For purification of up to 20 μg molecular biology grade plasmid DNA Kit contents Qiagen QIAprep Spin Miniprep Kit 50 preps 1 to 100mL Culture Volume 50L Elution Volume Molecular Biology Grade Plasmid DNA Purification Silica Technology Spin Column Format Manual Processing 30 min Time Run 20g Yield Ideal for Fluorescent and Radioactive Sequencing Ligation Cloning Transformation etc For Purification of up to 20μg Molecular Biology Grade Plasmid DNA Includes 50 QIAprep Spin Columns Reagents Buffers 2mL Collection Tubes Benefits Ready to use plasmid DNA in minutes Reproducible yields of molecular biology grade plasmid DNA Single protocol for high and low copy vectors Even higher yields with the High Yield Supplementary Protocol Improved QIAprep 2 0 Spin Column GelPilot loading dye for convenient sample analysis
    https://www.bioz.com/result/scfv antibodies/product/Qiagen
    Average 90 stars, based on 55583 article reviews
    Price from $9.99 to $1999.99
    scfv antibodies - by Bioz Stars, 2020-07
    90/100 stars

    Images

    1) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay, Purification, Expressing, Flow Cytometry, Cytometry, Labeling, Multiplex Assay, Standard Deviation

    Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Clone Assay, Incubation, Labeling, Fluorescence, FACS, Standard Deviation

    Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Incubation, Binding Assay, Standard Deviation

    aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.
    Figure Legend Snippet: aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.

    Techniques Used: Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Recombinant, Luminex, Staining, Fluorescence, Binding Assay, Concentration Assay, Standard Deviation

    2) Product Images from "Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome"

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome

    Journal: Clinical Epigenetics

    doi: 10.1186/s13148-018-0546-4

    DNMT1 methyltransferase trapping activity. The relative trapping ability of each DNMT1 variant is shown as a percentage relative to wild type DNMT1. Proteins from pEGFP-C1 transfected HeLa cells and non-transfected HeLa cells acted as controls. Technical replicates were performed in each assay. Four biological replicate experiments were performed for each sample and controls, except for DNMT1-R136C variant for which only three biological replicate experiments were performed. Error bars: mean ± SE
    Figure Legend Snippet: DNMT1 methyltransferase trapping activity. The relative trapping ability of each DNMT1 variant is shown as a percentage relative to wild type DNMT1. Proteins from pEGFP-C1 transfected HeLa cells and non-transfected HeLa cells acted as controls. Technical replicates were performed in each assay. Four biological replicate experiments were performed for each sample and controls, except for DNMT1-R136C variant for which only three biological replicate experiments were performed. Error bars: mean ± SE

    Techniques Used: Activity Assay, Variant Assay, Transfection

    3) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    4) Product Images from "Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability"

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0121581

    Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p
    Figure Legend Snippet: Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p

    Techniques Used: Non-Homologous End Joining, Modification, Transfection, FACS, Plasmid Preparation

    Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p
    Figure Legend Snippet: Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p

    Techniques Used: Plasmid Preparation, Transfection, FACS

    5) Product Images from "Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿"

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.03050-09

    Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).
    Figure Legend Snippet: Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Techniques Used: Agarose Gel Electrophoresis, Purification, Plasmid Preparation

    6) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay, Purification, Expressing, Flow Cytometry, Cytometry, Labeling, Multiplex Assay, Standard Deviation

    Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Clone Assay, Incubation, Labeling, Fluorescence, FACS, Standard Deviation

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Incubation, Binding Assay, Standard Deviation

    aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.
    Figure Legend Snippet: aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.

    Techniques Used: Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Recombinant, Luminex, Staining, Fluorescence, Binding Assay, Concentration Assay, Standard Deviation

    7) Product Images from "Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine"

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine

    Journal: Nature protocols

    doi: 10.1038/nprot.2012.137

    Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.
    Figure Legend Snippet: Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Techniques Used: Methylation Sequencing, Polymerase Chain Reaction, Amplification

    8) Product Images from "Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome"

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome

    Journal: Clinical Epigenetics

    doi: 10.1186/s13148-018-0546-4

    Structure of DNMT1 compiled from information in NCBI for NP_001124295.1 [ 45 ]. Replication fork targeting sequence (RFTS), nuclear localization signal (NLS), bromo-adjacent homology (BAH) domain, site-specific DNA cytosine methylase activity (SSMT), zinc finger domain (CXXC). The “*” symbol represents the translation start of the shorter DNMT1o form at amino acid 119. Conserved domains are DMAP1, RFTS, CXXC, BAH, KG linker sequence and SSMT. Numbers represent amino acid numbering
    Figure Legend Snippet: Structure of DNMT1 compiled from information in NCBI for NP_001124295.1 [ 45 ]. Replication fork targeting sequence (RFTS), nuclear localization signal (NLS), bromo-adjacent homology (BAH) domain, site-specific DNA cytosine methylase activity (SSMT), zinc finger domain (CXXC). The “*” symbol represents the translation start of the shorter DNMT1o form at amino acid 119. Conserved domains are DMAP1, RFTS, CXXC, BAH, KG linker sequence and SSMT. Numbers represent amino acid numbering

    Techniques Used: Sequencing, Activity Assay

    9) Product Images from "Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine"

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine

    Journal: Nature protocols

    doi: 10.1038/nprot.2012.137

    Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.
    Figure Legend Snippet: Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Techniques Used: Methylation Sequencing, Polymerase Chain Reaction, Amplification

    10) Product Images from "Experimental Estimation of the Effects of All Amino-Acid Mutations to HIV’s Envelope Protein on Viral Replication in Cell Culture"

    Article Title: Experimental Estimation of the Effects of All Amino-Acid Mutations to HIV’s Envelope Protein on Viral Replication in Cell Culture

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006114

    Deep mutational scanning workflow. (A) We created libraries of HIV proviral plasmids with random codon mutations in env , and generated mutant viruses by transfecting these plasmid libraries into 293T cells. Since cells receive multiple plasmids, there may not be a link between viral genotype and phenotype at this stage. To establish this link and select for functional variants, we passaged the viruses twice at low multiplicity of infection (MOI) in SupT1 cells. We deep sequenced env before and after selection to quantify the enrichment or depletion of each mutation, and used these data to estimate the preference of each site for each amino acid. Each mutant library was paired with a control in which cells were transfected with a wildtype HIV proviral plasmid to generate initially wildtype viruses that were passaged in parallel with the mutant viruses. Deep sequencing of these wildtype controls enabled estimation of the rates of apparent mutations arising from deep sequencing and viral replication. (B) We performed the entire experiment in triplicate. Additionally, we passaged the replicate-3 transfection supernatant in duplicate (replicate 3b). We also performed the second passage of replicate 3b in duplicate (replicates 3b-1 and 3b-2).
    Figure Legend Snippet: Deep mutational scanning workflow. (A) We created libraries of HIV proviral plasmids with random codon mutations in env , and generated mutant viruses by transfecting these plasmid libraries into 293T cells. Since cells receive multiple plasmids, there may not be a link between viral genotype and phenotype at this stage. To establish this link and select for functional variants, we passaged the viruses twice at low multiplicity of infection (MOI) in SupT1 cells. We deep sequenced env before and after selection to quantify the enrichment or depletion of each mutation, and used these data to estimate the preference of each site for each amino acid. Each mutant library was paired with a control in which cells were transfected with a wildtype HIV proviral plasmid to generate initially wildtype viruses that were passaged in parallel with the mutant viruses. Deep sequencing of these wildtype controls enabled estimation of the rates of apparent mutations arising from deep sequencing and viral replication. (B) We performed the entire experiment in triplicate. Additionally, we passaged the replicate-3 transfection supernatant in duplicate (replicate 3b). We also performed the second passage of replicate 3b in duplicate (replicates 3b-1 and 3b-2).

    Techniques Used: Generated, Mutagenesis, Plasmid Preparation, Functional Assay, Infection, Selection, Transfection, Sequencing

    11) Product Images from "A Transgenomic Cytogenetic Sorghum (Sorghum propinquum) Bacterial Artificial Chromosome Fluorescence in Situ Hybridization Map of Maize (Zea mays L.) Pachytene Chromosome 9, Evidence for Regions of Genome Hyperexpansion"

    Article Title: A Transgenomic Cytogenetic Sorghum (Sorghum propinquum) Bacterial Artificial Chromosome Fluorescence in Situ Hybridization Map of Maize (Zea mays L.) Pachytene Chromosome 9, Evidence for Regions of Genome Hyperexpansion

    Journal: Genetics

    doi: 10.1534/genetics.107.080846

    Identification, selection, and verification of maize RFLP marker csu145-selected sorghum BAC clones. (A) Autoradiographs of Sorghum propinquum YRL filters showing six detected clones in the first filter (left) and five in the second (right). BAC a0067L02
    Figure Legend Snippet: Identification, selection, and verification of maize RFLP marker csu145-selected sorghum BAC clones. (A) Autoradiographs of Sorghum propinquum YRL filters showing six detected clones in the first filter (left) and five in the second (right). BAC a0067L02

    Techniques Used: Selection, Marker, BAC Assay, Clone Assay

    12) Product Images from "Estrogen and sex-dependent loss of the vocal learning system in female zebra finches"

    Article Title: Estrogen and sex-dependent loss of the vocal learning system in female zebra finches

    Journal: bioRxiv

    doi: 10.1101/2020.03.28.011932

    Effects of estrogen manipulation on CADPS2 expression and sizes of song nuclei. (A) CADPS2 mRNA expression (white) in the brains of example animals from each treatment group. Anterior is right, dorsal is up. (B) Adjacent cresyl violet stained sections to A. (C-F) Relative song nuclei sizes for HVC, Area X, RA, and LMAN respectively. Aligned ranks transformation ANOVA with post-hoc Wilcoxon rank sum. Statistics in Supplemental Table 4 .
    Figure Legend Snippet: Effects of estrogen manipulation on CADPS2 expression and sizes of song nuclei. (A) CADPS2 mRNA expression (white) in the brains of example animals from each treatment group. Anterior is right, dorsal is up. (B) Adjacent cresyl violet stained sections to A. (C-F) Relative song nuclei sizes for HVC, Area X, RA, and LMAN respectively. Aligned ranks transformation ANOVA with post-hoc Wilcoxon rank sum. Statistics in Supplemental Table 4 .

    Techniques Used: Expressing, Staining, Transformation Assay

    13) Product Images from "Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides"

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides

    Journal: Journal of Biomolecular Techniques : JBT

    doi:

    DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,
    Figure Legend Snippet: DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Techniques Used: DNA Sequencing, Mutagenesis, Isolation, Labeling

    14) Product Images from "Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis"

    Article Title: Development of Phage-Based Single Chain Fv Antibody Reagents for Detection of Yersinia pestis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027756

    Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.
    Figure Legend Snippet: Amino acid sequence alignment of the 8 different αF1 scFv. 36% of the 252 clones that were screened by ELISA specifically bound recombinant F1 antigen. 62 of the 90 positive clones were successfully sequenced. Eight different αF1 scFv groups were identified following alignment of the full-length amino acid sequences obtained by translating the DNA sequences. One clone per group was selected. Here presented are the amino acid sequences of the selected clones. Letters indicated in the following combination of foreground/background: black/white, blue/torquoise, black/green, red/yellow and green/white, correspond to amino acids that are non-similar, conservative, similar, identical or weakly similar respectively. The consensus sequence corresponds to amino acids that are represented at least in 3 of the 8 sequences. The boxed portions of the consensus correspond to the CDRs (Kabat definition). With the red, green, blue, orange, black and pink boxes defining CDRL1 through 3 and CDRH 1 through 3 respectively.

    Techniques Used: Sequencing, Clone Assay, Enzyme-linked Immunosorbent Assay, Recombinant

    Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Binding analysis of αF1 scFv to recombinant F1 antigen. A ) ELISA analysis: The αF1 scFv proteins were expressed as alkaline phosphatase (AP) fusion proteins, recovered from the periplasmic fraction, and tested by one-step ELISA for binding to either recombinant F1 or chicken Lysozyme, without further purification. The binding profile of each αF1 scFv clone presented, was not normalized for expression. B ) Bead-based flow cytometry analysis: The αF1 scFv proteins were expressed as AP-Ecoil fusion proteins, recovered from the periplasmic fraction and directly labeled with Kcoil-A488. The fluorescently labeled αF1 were tested for binding to recombinant biotinylated F1 and ubiquitin by multiplex bead-based flow cytometry, without further purification. The binding profile of each αF1-APEcoil scFv clone presented was not normalized for expression. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay, Purification, Expressing, Flow Cytometry, Cytometry, Labeling, Multiplex Assay, Standard Deviation

    Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Cell-based flow cytometry analysis: Fluorescent aF1 phage reactivity with fixed Yersinia cells. A ) Reactivity of all aF1 scFv phage clones with 3 fixed Yersinia strains: F1-positive Y. pestis A1122 and F1-negative strains Y. enterocolytica 0107 and Y. pseudotubeculosis 0104 were incubated with either αLysozyme (CTD1.3) or αF1 scFv-displaying FITC-labeled phage (CT1 through 8). The fluorescence associated with each cell type was measured using FACS Calibur and data were analyzed by CellQuest. B ) Reactivity of αF1 CT8 and CTD1.3 with 8 fixed Yersinia strains. F1-positive Y. pestis strains A1122, C092, India, India 15 and Kim, and F1-negative strains Y. pestis Nairobi, Y. enterocolytica 0107 and Y. pseudotuberculosis 0104 were incubated with FITC-labeled phage. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Clone Assay, Incubation, Labeling, Fluorescence, FACS, Standard Deviation

    Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Whole-cell ELISA analysis: aF1 phage reactivity with live or fixed Yersinia cells . Each phage-displayed αF1 (CT1 through 8) or αLysozyme (CTD1.3) scFv was incubated with blocked live ( A ) or fixed ( B ) F1-positive Yersinia pestis (YP) A1122, Kim, India and India 195 or F1-negative YP Nairobi, Yersinia pseudotuberculosis 0104 (YPT 0104) and Yersinia enterocolytica 0107 (YE 0107). Phage-binding events were reported using αM13-HRP antibody. Background noise coming from buffers, secondary antibody or the cells was evaluated by including wells with no added phage (no phage). The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Incubation, Binding Assay, Standard Deviation

    aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.
    Figure Legend Snippet: aF1 CT phage are stable, and reactive, following prolonged storage. Phage-displayed αF1 scFv CT4, CT6 and CT5 (inactive control) were treated with a preservative solution and tested for reactivity following different storage conditions; A) freshly prepared phage, B) 6 months at 4°C, C) 9 months at 4°C followed by 1 month at room temperature (RT) and D) 9 months at 4°C followed by 2 months at RT. Phage was tested for activity at non-saturating concentrations by whole-cell ELISA using live Yersinia pestis A1122 cells. Each value is an average of 3 experiments with corresponding standard deviation.

    Techniques Used: Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.
    Figure Legend Snippet: Bead-based flow cytometry analysis: aF1 phage reactivity with recombinant F1 antigen. A ) Schematic of analysis: a set of 3 distinct luminex beads was bound to biotinylated Lysozyme, biotinylated F1 or biotin respectively. Bound phage was stained with αM13 mouse IgG and phycoerythrin (PE)-conjugated goat αMouse. Beads were separated based on their intrinsic fluorescence (APC-A, APC-cyt7), and the associated PE stain was measured to assess specificity of binding to F1 antigen. B ) Assay results: Eight different αF1 scFv were expressed in phage format (CT1 through 8). Phage preparations were normalized to a concentration of 5×10 +12 cfu/mL and analyzed for specific binding. The value associated to each bar is an average of three experiments with corresponding standard deviation.

    Techniques Used: Flow Cytometry, Cytometry, Recombinant, Luminex, Staining, Fluorescence, Binding Assay, Concentration Assay, Standard Deviation

    15) Product Images from "Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex"

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-599

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.
    Figure Legend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Techniques Used: Isolation, Plasmid Preparation

    16) Product Images from "Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex"

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-599

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.
    Figure Legend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Techniques Used: Isolation, Plasmid Preparation

    17) Product Images from "Effects of optional structural elements, including two alternative amino termini and a new splicing cassette IV, on the function of the sodium–bicarbonate cotransporter NBCn1 (SLC4A7)"

    Article Title: Effects of optional structural elements, including two alternative amino termini and a new splicing cassette IV, on the function of the sodium–bicarbonate cotransporter NBCn1 (SLC4A7)

    Journal: The Journal of Physiology

    doi: 10.1113/jphysiol.2013.258673

    Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing human NBCn1 EGFP-tagged constructs ( A ), untagged constructs ( B ) or various NBCn1-G constructs ( C )
    Figure Legend Snippet: Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing human NBCn1 EGFP-tagged constructs ( A ), untagged constructs ( B ) or various NBCn1-G constructs ( C )

    Techniques Used: Expressing, Construct

    Cloning and expression patterns of NBCn1 in human and mouse tissues
    Figure Legend Snippet: Cloning and expression patterns of NBCn1 in human and mouse tissues

    Techniques Used: Clone Assay, Expressing

    Western blots of total ( A ) and surface ( B ) NBCn1, and summary of relative surface abundance ( C ) of mouse NBCn1 variants in Xenopus oocytes
    Figure Legend Snippet: Western blots of total ( A ) and surface ( B ) NBCn1, and summary of relative surface abundance ( C ) of mouse NBCn1 variants in Xenopus oocytes

    Techniques Used: Western Blot

    Cloning and expression patterns of NBCn1 in human and mouse tissues
    Figure Legend Snippet: Cloning and expression patterns of NBCn1 in human and mouse tissues

    Techniques Used: Clone Assay, Expressing

    Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing different mouse NBCn1 variants
    Figure Legend Snippet: Summary of pH i recovery rates (dpH i /d t ) of oocytes expressing different mouse NBCn1 variants

    Techniques Used: Expressing

    NBCn1-dependent functional expression ( A ) and intrinsic HCO 3 − transport activity ( B )
    Figure Legend Snippet: NBCn1-dependent functional expression ( A ) and intrinsic HCO 3 − transport activity ( B )

    Techniques Used: Functional Assay, Expressing, Activity Assay

    Representative recordings of intracellular pH (pH i ) and membrane potential ( V m ) from oocytes expressing human NBCn1-E-EGFP ( A ), NBCn1-G-EGFP ( B ) or H 2 O-injected control oocytes ( C )
    Figure Legend Snippet: Representative recordings of intracellular pH (pH i ) and membrane potential ( V m ) from oocytes expressing human NBCn1-E-EGFP ( A ), NBCn1-G-EGFP ( B ) or H 2 O-injected control oocytes ( C )

    Techniques Used: Expressing, Injection

    Cloning and expression patterns of NBCn1 in human and mouse tissues
    Figure Legend Snippet: Cloning and expression patterns of NBCn1 in human and mouse tissues

    Techniques Used: Clone Assay, Expressing

    Summary of known major NBCn1 variants
    Figure Legend Snippet: Summary of known major NBCn1 variants

    Techniques Used:

    PCR cloning of NBCn1 transcripts from human ( A and B ) and mouse ( C ) tissues
    Figure Legend Snippet: PCR cloning of NBCn1 transcripts from human ( A and B ) and mouse ( C ) tissues

    Techniques Used: Polymerase Chain Reaction, Clone Assay

    Related Articles

    Nucleic Acid Electrophoresis:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Selection:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Agarose Gel Electrophoresis:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Synthesized:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Isolation:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany). .. Lysogeny was predicted using PCR with KS14-specifc primers (KS14F: GCAGCTAACCGAGTCGCACG, KS14R: CTCTGAAAAGGTGGGCGGTGG) (Sigma-Genosys, Oakville, ON) and TopTaq DNA polymerase and buffers (Qiagen).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Construct:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Purification:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: Isolation of Predation-Deficient Mutants of Bdellovibrio bacteriovorus by Using Transposon Mutagenesis ▿
    Article Snippet: .. The plasmid pRL27 was purified from E. coli BW20767 using the QIAprep spin miniprep kit (Qiagen, Valencia, CA) and stored at 4°C. .. Frozen cultures of E. coli BW20767 kept at −75°C were streaked onto fresh L agar-Km plates and incubated overnight.

    Produced:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Modification:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Clone Assay:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Staining:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Polymerase Chain Reaction:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Gel Extraction:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Transformation Assay:

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability
    Article Snippet: .. Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells. .. After plating on agar plates containing IPTG and X-Gal (Sigma-Aldrich), numbers of white and blue colonies were counted.

    Recombinant:

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Plasmid Preparation:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability
    Article Snippet: .. Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells. .. After plating on agar plates containing IPTG and X-Gal (Sigma-Aldrich), numbers of white and blue colonies were counted.

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany). .. Lysogeny was predicted using PCR with KS14-specifc primers (KS14F: GCAGCTAACCGAGTCGCACG, KS14R: CTCTGAAAAGGTGGGCGGTGG) (Sigma-Genosys, Oakville, ON) and TopTaq DNA polymerase and buffers (Qiagen).

    Article Title: Isolation of Predation-Deficient Mutants of Bdellovibrio bacteriovorus by Using Transposon Mutagenesis ▿
    Article Snippet: .. The plasmid pRL27 was purified from E. coli BW20767 using the QIAprep spin miniprep kit (Qiagen, Valencia, CA) and stored at 4°C. .. Frozen cultures of E. coli BW20767 kept at −75°C were streaked onto fresh L agar-Km plates and incubated overnight.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen post transfection
    Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after <t>transfection</t> by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p
    Post Transfection, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/post transfection/product/Qiagen
    Average 99 stars, based on 2287 article reviews
    Price from $9.99 to $1999.99
    post transfection - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p

    Journal: PLoS ONE

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability

    doi: 10.1371/journal.pone.0121581

    Figure Lengend Snippet: Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p

    Article Snippet: Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells.

    Techniques: Non-Homologous End Joining, Modification, Transfection, FACS, Plasmid Preparation

    Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p

    Journal: PLoS ONE

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability

    doi: 10.1371/journal.pone.0121581

    Figure Lengend Snippet: Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p

    Article Snippet: Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells.

    Techniques: Plasmid Preparation, Transfection, FACS

    Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Journal: Applied and Environmental Microbiology

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿

    doi: 10.1128/AEM.03050-09

    Figure Lengend Snippet: Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Article Snippet: Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels.

    Techniques: Agarose Gel Electrophoresis, Purification, Plasmid Preparation

    Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Journal: Nature protocols

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine

    doi: 10.1038/nprot.2012.137

    Figure Lengend Snippet: Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Article Snippet: NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050).

    Techniques: Methylation Sequencing, Polymerase Chain Reaction, Amplification

    DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Journal: Journal of Biomolecular Techniques : JBT

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides

    doi:

    Figure Lengend Snippet: DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Article Snippet: For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA).

    Techniques: DNA Sequencing, Mutagenesis, Isolation, Labeling