rt pcr amplifications  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    QIAGEN OneStep RT PCR Kit
    Description:
    For highly sensitive and specific one step RT PCR Kit contents Qiagen OneStep RT PCR Kit 25 x 50L rxns RNA Template Sample Reverse Transcription Enzyme Activity One step RT PCR Reaction With Hotstart Ideal for Gene expression Analysis Virus Detection For Highly Sensitive and Specific One step RT PCR Includes Qiagen OneStep RT PCR Enzyme Mix 1 x 50L 5x Qiagen OneStep RT PCR Buffer 1 x 250L dNTP Mix 1 x 50L 10mM Each 5x Q Solution 1 x 400L RNase free Water 1 x 1 9mL Benefits Fast and easy one tube setup Efficient one step RT PCR of any RNA template without optimization Unique enzyme mix for high specificity and sensitivity Balanced mixture of enzymes with optimized reverse transcription buffer
    Catalog Number:
    210210
    Price:
    161
    Category:
    QIAGEN OneStep RT PCR Kit
    Buy from Supplier


    Structured Review

    Qiagen rt pcr amplifications
    QIAGEN OneStep RT PCR Kit
    For highly sensitive and specific one step RT PCR Kit contents Qiagen OneStep RT PCR Kit 25 x 50L rxns RNA Template Sample Reverse Transcription Enzyme Activity One step RT PCR Reaction With Hotstart Ideal for Gene expression Analysis Virus Detection For Highly Sensitive and Specific One step RT PCR Includes Qiagen OneStep RT PCR Enzyme Mix 1 x 50L 5x Qiagen OneStep RT PCR Buffer 1 x 250L dNTP Mix 1 x 50L 10mM Each 5x Q Solution 1 x 400L RNase free Water 1 x 1 9mL Benefits Fast and easy one tube setup Efficient one step RT PCR of any RNA template without optimization Unique enzyme mix for high specificity and sensitivity Balanced mixture of enzymes with optimized reverse transcription buffer
    https://www.bioz.com/result/rt pcr amplifications/product/Qiagen
    Average 95 stars, based on 4659 article reviews
    Price from $9.99 to $1999.99
    rt pcr amplifications - by Bioz Stars, 2020-04
    95/100 stars

    Images

    1) Product Images from "Simultaneous Extraction from Bacterioplankton of Total RNA and DNA Suitable for Quantitative Structure and Function Analyses"

    Article Title: Simultaneous Extraction from Bacterioplankton of Total RNA and DNA Suitable for Quantitative Structure and Function Analyses

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.68.3.1082-1087.2002

    SSCP patterns obtained with single-stranded PCR products of 16S rRNA genes (lanes 2 to 9) and single-stranded RT-PCR products (lanes 11 to 17) amplified from pond bacterioplankton extracted by the SLS-phenol and DivoLab-phenol methods [(a) and (b) in the lane descriptions refer to duplicate extracted filters]. Lanes 1, 10, and 18, DNA ladders; lane 2, SLS-phenol undiluted (a); lane 3, SLS-phenol diluted 1:10 (a); lane 4, SLS-phenol undiluted (b); lane 5, SLS-phenol diluted 1:10 (b); lane 6, DivoLab-phenol undiluted (a); lane 7, DivoLab-phenol diluted 1:10 (a); lane 8, DivoLab-phenol undiluted (b); lane 9, DivoLab-phenol diluted 1:10 (b); lane 11, SLS-phenol undiluted (a); lane 12, SLS-phenol diluted 1:10 (a); lane 13, SLS-phenol undiluted (b); lane 14, SLS-phenol diluted 1:10 (b); lane 15, DivoLab-phenol undiluted (a); lane 16, DivoLab-phenol diluted 1:10 (a); lane 17, DivoLab-phenol undiluted (b). Between lanes 17 and 18, a lane with a different marker was excised by using Adobe Photoshop.
    Figure Legend Snippet: SSCP patterns obtained with single-stranded PCR products of 16S rRNA genes (lanes 2 to 9) and single-stranded RT-PCR products (lanes 11 to 17) amplified from pond bacterioplankton extracted by the SLS-phenol and DivoLab-phenol methods [(a) and (b) in the lane descriptions refer to duplicate extracted filters]. Lanes 1, 10, and 18, DNA ladders; lane 2, SLS-phenol undiluted (a); lane 3, SLS-phenol diluted 1:10 (a); lane 4, SLS-phenol undiluted (b); lane 5, SLS-phenol diluted 1:10 (b); lane 6, DivoLab-phenol undiluted (a); lane 7, DivoLab-phenol diluted 1:10 (a); lane 8, DivoLab-phenol undiluted (b); lane 9, DivoLab-phenol diluted 1:10 (b); lane 11, SLS-phenol undiluted (a); lane 12, SLS-phenol diluted 1:10 (a); lane 13, SLS-phenol undiluted (b); lane 14, SLS-phenol diluted 1:10 (b); lane 15, DivoLab-phenol undiluted (a); lane 16, DivoLab-phenol diluted 1:10 (a); lane 17, DivoLab-phenol undiluted (b). Between lanes 17 and 18, a lane with a different marker was excised by using Adobe Photoshop.

    Techniques Used: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Amplification, Marker

    2) Product Images from "RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †"

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00925-08

    Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).
    Figure Legend Snippet: Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Staining, Marker, Sequencing

    3) Product Images from "EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]"

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]

    Journal: Plant Physiology

    doi: 10.1104/pp.111.176248

    qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental
    Figure Legend Snippet: qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental

    Techniques Used: Quantitative RT-PCR

    4) Product Images from "PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !"

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.1001445

    T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.
    Figure Legend Snippet: T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.

    Techniques Used: Mouse Assay, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Knock-Out, Expressing

    5) Product Images from "Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia"

    Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia

    Journal: The American Journal of Tropical Medicine and Hygiene

    doi: 10.4269/ajtmh.2012.11-0655

    Flavivirus detection by reverse transcription-polymerase chain reaction (RT-PCR).
    Figure Legend Snippet: Flavivirus detection by reverse transcription-polymerase chain reaction (RT-PCR).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    6) Product Images from "Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish"

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish

    Journal: General and comparative endocrinology

    doi: 10.1016/j.ygcen.2010.10.010

    Temporal and spatial expression of pck1 during zebrafish development. (A) Phylogenetic analysis distinguishes Pck1- from Pck2-related proteins. (B) Semiquantitative RT-PCR showing onset of pck1 and pck2 gene expression. Note that a small amount of maternally provided pck1 is present in 16 cell embryos. Low-level zygotic expression of pck2 is first detectable at 6 hpf. (C) RNA:RNA in situ hybridization demonstrates pck1 expression in the 11 hpf YSL, brain, and tail. In 24 hpf embryos, pck1 is expressed in the eye and tail. By 48 hpf pck1 is expressed at the margin between the yolk extension and the embryo proper (red arrow). Expression in discrete YSL clusters (black arrows) as well as fin buds and pharyngeal arches is also seen. At 72 and 96 hpf, pck1 expression is seen in the liver, YSL, and cranial neuromasts. b, brain; e, eye; fb, fin bud; nm, neuromasts; pa, pharyngeal arch; tb, and tail bud.
    Figure Legend Snippet: Temporal and spatial expression of pck1 during zebrafish development. (A) Phylogenetic analysis distinguishes Pck1- from Pck2-related proteins. (B) Semiquantitative RT-PCR showing onset of pck1 and pck2 gene expression. Note that a small amount of maternally provided pck1 is present in 16 cell embryos. Low-level zygotic expression of pck2 is first detectable at 6 hpf. (C) RNA:RNA in situ hybridization demonstrates pck1 expression in the 11 hpf YSL, brain, and tail. In 24 hpf embryos, pck1 is expressed in the eye and tail. By 48 hpf pck1 is expressed at the margin between the yolk extension and the embryo proper (red arrow). Expression in discrete YSL clusters (black arrows) as well as fin buds and pharyngeal arches is also seen. At 72 and 96 hpf, pck1 expression is seen in the liver, YSL, and cranial neuromasts. b, brain; e, eye; fb, fin bud; nm, neuromasts; pa, pharyngeal arch; tb, and tail bud.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, RNA In Situ Hybridization

    Gene expression during zebrafish development. (A) Relative, quantitative expression of insa (open bars) and insb (black bars) during development. (B). Relative, quantitative expression of pck1 during development. (C) Non-quantitative RT-PCR demonstrates early expression of insulin receptors a and b .
    Figure Legend Snippet: Gene expression during zebrafish development. (A) Relative, quantitative expression of insa (open bars) and insb (black bars) during development. (B). Relative, quantitative expression of pck1 during development. (C) Non-quantitative RT-PCR demonstrates early expression of insulin receptors a and b .

    Techniques Used: Expressing, Quantitative RT-PCR

    7) Product Images from "A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis"

    Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis

    Journal: mBio

    doi: 10.1128/mBio.01388-17

    Ca 2+ negatively regulates expression of ctpE . Role of Ca 2+ on expression of ctpE in Mycobacterium smegmatis mc 2 155 strains. Strains were grown to mid-log phase in Sauton’s medium without any supplementation or supplemented with 1.0 mM EGTA or CaCl 2 and used for uptake assays. (A and B) Uptake of 45 Ca 2+ in M. smegmatis mc 2 155 (WT) (A) and in the mutant (MHK1+pSMT3) and mutant complemented with M. smegmatis ctpE (MHK1+pRHK2) (B). (C) Semiquantitative reverse transcriptase PCR analysis of the M. smegmatis mc 2 155 ctpE and echA . M. smegmatis mc 2 155 was grown to mid-log phase in Sauton’s medium and treated with EGTA or CaCl 2 for 2 h. RNA was isolated, and RT-PCR was carried out for ctpE , echA , and sigA . (D) Transcription profile of ctpE and echA . Quantification of amplified PCR product ( Fig. 6C ) was done by densitometry. sigA was taken as an endogenous control. The experiment was performed three times independently; values are averages, and standard deviations are shown as error bars. Values that are significantly different are indicated by asterisks as follows: *, P
    Figure Legend Snippet: Ca 2+ negatively regulates expression of ctpE . Role of Ca 2+ on expression of ctpE in Mycobacterium smegmatis mc 2 155 strains. Strains were grown to mid-log phase in Sauton’s medium without any supplementation or supplemented with 1.0 mM EGTA or CaCl 2 and used for uptake assays. (A and B) Uptake of 45 Ca 2+ in M. smegmatis mc 2 155 (WT) (A) and in the mutant (MHK1+pSMT3) and mutant complemented with M. smegmatis ctpE (MHK1+pRHK2) (B). (C) Semiquantitative reverse transcriptase PCR analysis of the M. smegmatis mc 2 155 ctpE and echA . M. smegmatis mc 2 155 was grown to mid-log phase in Sauton’s medium and treated with EGTA or CaCl 2 for 2 h. RNA was isolated, and RT-PCR was carried out for ctpE , echA , and sigA . (D) Transcription profile of ctpE and echA . Quantification of amplified PCR product ( Fig. 6C ) was done by densitometry. sigA was taken as an endogenous control. The experiment was performed three times independently; values are averages, and standard deviations are shown as error bars. Values that are significantly different are indicated by asterisks as follows: *, P

    Techniques Used: Expressing, Mutagenesis, Polymerase Chain Reaction, Isolation, Reverse Transcription Polymerase Chain Reaction, Amplification

    8) Product Images from "Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation"

    Article Title: Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007572

    Cse4 is subject to efficient ubiquitin-dependent degradation in the fission yeast. A, RT-PCR analysis of cells expressing Cnp1-GFP or Cse4-GFP. Total RNA extracted from cells overexpressing Cnp1-GFP or Cse4-GFP was used. Cnp1-GFP or Cse4-GFP transcripts were analyzed with primers specific for GFP. Actin was used as an internal control. B, Lysates from cells collected at indicated time points (hrs) following cycloheximide treatment were analyzed by western blotting with an anti-GFP antibody. C, Cse4 level is enhanced after proteasome inactivation in fission yeast. Cells overexpressing Cse4-GFP in wild type or mts2-1 background were incubated at 37°C for 4 hours, and were subject to western blot analysis using an anti-GFP antibody. Tubulin was used as a loading control. D, Extracts from cells expressing indicated proteins were split, and subject to TUBE pull-down and reverse pull-down assays, respectively. For TUBE pull-down assays, extracts were immunoprecipitated with tandem ubiquitin-binding entities (+TUBE), or control Argarose beads (-TUBE), followed by western blot analysis using an anti-GFP antibody. For reverse pull-down assays (right panel), extracts were immunoprecipitated with an anti-GFP antibody, then analyzed by western blotting using a pan ubiquitin antibody. Induction time: 20 hours for Cnp1-GFP; 24 hours for Cse4-GFP.
    Figure Legend Snippet: Cse4 is subject to efficient ubiquitin-dependent degradation in the fission yeast. A, RT-PCR analysis of cells expressing Cnp1-GFP or Cse4-GFP. Total RNA extracted from cells overexpressing Cnp1-GFP or Cse4-GFP was used. Cnp1-GFP or Cse4-GFP transcripts were analyzed with primers specific for GFP. Actin was used as an internal control. B, Lysates from cells collected at indicated time points (hrs) following cycloheximide treatment were analyzed by western blotting with an anti-GFP antibody. C, Cse4 level is enhanced after proteasome inactivation in fission yeast. Cells overexpressing Cse4-GFP in wild type or mts2-1 background were incubated at 37°C for 4 hours, and were subject to western blot analysis using an anti-GFP antibody. Tubulin was used as a loading control. D, Extracts from cells expressing indicated proteins were split, and subject to TUBE pull-down and reverse pull-down assays, respectively. For TUBE pull-down assays, extracts were immunoprecipitated with tandem ubiquitin-binding entities (+TUBE), or control Argarose beads (-TUBE), followed by western blot analysis using an anti-GFP antibody. For reverse pull-down assays (right panel), extracts were immunoprecipitated with an anti-GFP antibody, then analyzed by western blotting using a pan ubiquitin antibody. Induction time: 20 hours for Cnp1-GFP; 24 hours for Cse4-GFP.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Western Blot, Incubation, Immunoprecipitation, Binding Assay

    9) Product Images from "RNA editing generates cellular subsets with diverse sequence within populations"

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations

    Journal: Nature Communications

    doi: 10.1038/ncomms12145

    Validation of model predictions using targeted amplification of editable sites from single cells. ( a ) Wiggle plots showing coverage in 3′-untranslated regions for B2m, Anxa5 and Cybb in the 24 bone marrow-derived macrophages profiled. ( b – d ) Sequence alignments from targeted RT–PCR amplification and Sanger sequencing of bacterial colonies for ( b ) B2m, ( c ) Anxa5 and ( d ) Cybb transcripts from gDNA and cDNA from a bulk sample (amplified using standard PCR), and cDNA of single cells (amplified using a modified OneStep RT–PCR protocol, per Supplementary Fig. 4 ). Alignments, showing the sequence space surrounding a particular editable site, are clustered by sample. Alignments are colour-coded to indicate whether the sequence aligned contained (red) or lacked (grey) editing in the length of the amplicon. Though a C-to-U change may not be shown in the narrow window illustrated, a red sequence would indicate that the amplicon sequence contained at least one C-to-U edit elsewhere (red). Lack of editing in the gDNA indicates that the C-to-U transitions observed are bona fide APOBEC1-mediated RNA editing events.
    Figure Legend Snippet: Validation of model predictions using targeted amplification of editable sites from single cells. ( a ) Wiggle plots showing coverage in 3′-untranslated regions for B2m, Anxa5 and Cybb in the 24 bone marrow-derived macrophages profiled. ( b – d ) Sequence alignments from targeted RT–PCR amplification and Sanger sequencing of bacterial colonies for ( b ) B2m, ( c ) Anxa5 and ( d ) Cybb transcripts from gDNA and cDNA from a bulk sample (amplified using standard PCR), and cDNA of single cells (amplified using a modified OneStep RT–PCR protocol, per Supplementary Fig. 4 ). Alignments, showing the sequence space surrounding a particular editable site, are clustered by sample. Alignments are colour-coded to indicate whether the sequence aligned contained (red) or lacked (grey) editing in the length of the amplicon. Though a C-to-U change may not be shown in the narrow window illustrated, a red sequence would indicate that the amplicon sequence contained at least one C-to-U edit elsewhere (red). Lack of editing in the gDNA indicates that the C-to-U transitions observed are bona fide APOBEC1-mediated RNA editing events.

    Techniques Used: Amplification, Derivative Assay, Sequencing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Modification

    10) Product Images from "Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1"

    Article Title: Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1

    Journal: Archaea

    doi:

    Transcriptional analysis of the M. mazei nif gene cluster. (A) Northern blot analysis of total RNA isolated from M. mazei cells grown under conditions of nitrogen limitation (N 2 ) and nitrogen sufficiency ( NH 4 + ) using probes for nifH , nifK and nifN . Each lane was loaded with 0.25 µg total RNA from cells grown under nitrogen limitation (-) or nitrogen sufficiency (+); numbers on the left are molecular sizes in kilobases. (B) RT-PCR analysis. Reverse transcription was carried out on 0.1 µg RNA isolated from cells grown under conditions of nitrogen limitation (-) or nitrogen sufficiency (+) using the OneStep RT-PCR Kit from Qiagen and primers as described in Materials and methods. Control PCR reactions with RNA in the absence of reverse transcriptase showed that the isolated RNA preparations were free of genomic DNA. As a control, a 16S rDNA-specific RT-PCR was carried out on 10 ng of RNA from cells from each growth condition. Products of the expected size (450 bp ( nifH ), 417 bp ( nifK ), 438 bp ( nifN ), 415 bp ( glnK 1 ) and 420 bp (16S rDNA)) were separated in 1.5% agarose gels and visualized by ethidium bromide staining.
    Figure Legend Snippet: Transcriptional analysis of the M. mazei nif gene cluster. (A) Northern blot analysis of total RNA isolated from M. mazei cells grown under conditions of nitrogen limitation (N 2 ) and nitrogen sufficiency ( NH 4 + ) using probes for nifH , nifK and nifN . Each lane was loaded with 0.25 µg total RNA from cells grown under nitrogen limitation (-) or nitrogen sufficiency (+); numbers on the left are molecular sizes in kilobases. (B) RT-PCR analysis. Reverse transcription was carried out on 0.1 µg RNA isolated from cells grown under conditions of nitrogen limitation (-) or nitrogen sufficiency (+) using the OneStep RT-PCR Kit from Qiagen and primers as described in Materials and methods. Control PCR reactions with RNA in the absence of reverse transcriptase showed that the isolated RNA preparations were free of genomic DNA. As a control, a 16S rDNA-specific RT-PCR was carried out on 10 ng of RNA from cells from each growth condition. Products of the expected size (450 bp ( nifH ), 417 bp ( nifK ), 438 bp ( nifN ), 415 bp ( glnK 1 ) and 420 bp (16S rDNA)) were separated in 1.5% agarose gels and visualized by ethidium bromide staining.

    Techniques Used: Northern Blot, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Staining

    11) Product Images from "Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types"

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1003464

    Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).
    Figure Legend Snippet: Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Sequencing, Expressing, Negative Control

    DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P
    Figure Legend Snippet: DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Microarray, Expressing

    Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P
    Figure Legend Snippet: Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P

    Techniques Used: RNA Sequencing Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Amplification

    Discovery of APIP/SLC1A2 in colon cancer. ( A ) Array CGH heatmap displaying genomic breakpoints disrupting SLC1A2 in the SNU-C1 colon cancer cell line and the SNU-16 gastric cancer cell line. SNU-16 is known to harbor CD44/SLC1A2 and its array CGH profile is depicted for comparison. Unsmoothed log 2 ratios are displayed. ( B ) Paired-end RNA seq uncovers APIP/SLC1A2 in SNU-C1. A subset of paired-end reads mapping to APIP/SLC1A2 as well as the gene fusion structure are displayed (left panel). The structure of the known gastric cancer gene fusion CD44/SLC1A2 is depicted for comparison (right panel). An internal start codon within exon 2 of SLC1A2 is predicted to initiate translation in both rearrangements. Inset : experimental validation of APIP/SLC1A2 by RT-PCR with primers flanking the gene fusion junction. ( C , D ) Gene expression profiling depicts high-level expression of APIP in normal colon ( C ) and overexpression of SLC1A2 in SNU-C1 ( D ). Mean-centered gene expression ratios are depicted by a log 2 pseudocolor scale and ranked in descending order from left to right.
    Figure Legend Snippet: Discovery of APIP/SLC1A2 in colon cancer. ( A ) Array CGH heatmap displaying genomic breakpoints disrupting SLC1A2 in the SNU-C1 colon cancer cell line and the SNU-16 gastric cancer cell line. SNU-16 is known to harbor CD44/SLC1A2 and its array CGH profile is depicted for comparison. Unsmoothed log 2 ratios are displayed. ( B ) Paired-end RNA seq uncovers APIP/SLC1A2 in SNU-C1. A subset of paired-end reads mapping to APIP/SLC1A2 as well as the gene fusion structure are displayed (left panel). The structure of the known gastric cancer gene fusion CD44/SLC1A2 is depicted for comparison (right panel). An internal start codon within exon 2 of SLC1A2 is predicted to initiate translation in both rearrangements. Inset : experimental validation of APIP/SLC1A2 by RT-PCR with primers flanking the gene fusion junction. ( C , D ) Gene expression profiling depicts high-level expression of APIP in normal colon ( C ) and overexpression of SLC1A2 in SNU-C1 ( D ). Mean-centered gene expression ratios are depicted by a log 2 pseudocolor scale and ranked in descending order from left to right.

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Over Expression

    Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P
    Figure Legend Snippet: Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P

    Techniques Used: RNA Sequencing Assay, Activation Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Transfection

    Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P
    Figure Legend Snippet: Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection

    12) Product Images from "Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1"

    Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0004873

    Optimization of KIN5 sh RNA. A. Degradation of KIN5 message after sh RNA induction in KO cells using 0–0.5 µg/ml Cd 2+ . Above: RT-PCR products resolved on a 1% agarose gel. At Cd 2+ concentrations lower than 0.5 µg/ml, KIN5 mRNA is stable for 24 h. After 24 h in 0.5 µg/ml Cd 2+ , KIN5 mRNA is dramatically decreased, while PGM1 is unaffected. B. Effect of 0.5 µg/ml Cd 2+ on KIN5 and PGM1 messages in Inv2 cells. KIN5 and PGM1 mRNA levels remain unaffected after 24 h. DNA markers shown: lines indicate 600 and 300 bp. C. Effect of 0.5 µg/ml Cd 2+ on Kin5 protein levels in KO and Inv2 cells. Corresponding KO (left) and Inv2 (right) cell homogenates 12 h post-induction at either 0 or 0.5 µg/ml Cd 2+ and blotted with K5T1 Ab to Kin5. While the Kin5 protein is severely knocked down in the KO cells upon sh RNA induction, Kin5 levels remain unaffected in Inv2 cells under similar conditions.
    Figure Legend Snippet: Optimization of KIN5 sh RNA. A. Degradation of KIN5 message after sh RNA induction in KO cells using 0–0.5 µg/ml Cd 2+ . Above: RT-PCR products resolved on a 1% agarose gel. At Cd 2+ concentrations lower than 0.5 µg/ml, KIN5 mRNA is stable for 24 h. After 24 h in 0.5 µg/ml Cd 2+ , KIN5 mRNA is dramatically decreased, while PGM1 is unaffected. B. Effect of 0.5 µg/ml Cd 2+ on KIN5 and PGM1 messages in Inv2 cells. KIN5 and PGM1 mRNA levels remain unaffected after 24 h. DNA markers shown: lines indicate 600 and 300 bp. C. Effect of 0.5 µg/ml Cd 2+ on Kin5 protein levels in KO and Inv2 cells. Corresponding KO (left) and Inv2 (right) cell homogenates 12 h post-induction at either 0 or 0.5 µg/ml Cd 2+ and blotted with K5T1 Ab to Kin5. While the Kin5 protein is severely knocked down in the KO cells upon sh RNA induction, Kin5 levels remain unaffected in Inv2 cells under similar conditions.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Stability of KIN5 and PGM1 messages. A. CU522 cells grown in starvation conditions+5.0 µg/ml Cd 2+ prior to transformation showing comparable relative stabilities of the KIN5 and PGM1 mRNA. B. Time course of degradation of KIN5 message after sh RNA induction in K5KOAs.40 cells using 5.0 µg/ml Cd 2+ . RT-PCR products resolved on a 1% agarose gel. Left lane: DNA markers. The KIN5 message decreases at 45 min post-induction and is eliminated at 60 min. The PGM1 message remains constant.
    Figure Legend Snippet: Stability of KIN5 and PGM1 messages. A. CU522 cells grown in starvation conditions+5.0 µg/ml Cd 2+ prior to transformation showing comparable relative stabilities of the KIN5 and PGM1 mRNA. B. Time course of degradation of KIN5 message after sh RNA induction in K5KOAs.40 cells using 5.0 µg/ml Cd 2+ . RT-PCR products resolved on a 1% agarose gel. Left lane: DNA markers. The KIN5 message decreases at 45 min post-induction and is eliminated at 60 min. The PGM1 message remains constant.

    Techniques Used: Transformation Assay, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

    13) Product Images from "Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore"

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore

    Journal: Biomarker Insights

    doi:

    Nested PCR for WT1 expression.
    Figure Legend Snippet: Nested PCR for WT1 expression.

    Techniques Used: Nested PCR, Expressing

    14) Product Images from "The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development"

    Article Title: The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erw158

    Domain structure and cellular localization of the Arabidopsis homolog of human U11-48K protein and generation of artificial miRNA-mediated knockdown plants. (A) Schematic representation of the domain structure of the Arabidopsis homolog of human U11-48K. The conserved CHHC-type zinc finger (ZF) motif and arginine (Arg)-rich region are shown. (B) GFP signals from the 48K–GFP-expressing tobacco plant were observed using a confocal microscope. DAPI was used to stain the nucleus. Scale bar=10 μm. (C) Position of the artificial miRNA1 (amiR1) target site and the sequences of amiR1, along with its target, U11-48K (48K). Exons and introns are represented as gray boxes and thick lines, respectively, and the untranslated regions are represented as white boxes. (D) Confirmation of mature amiR1 generation. Total RNA extracted from each transgenic line (amiR1-1, amiR1-2, and amiR1-3) was separated via denaturing 12% PAGE, and the expression of 21 nucleotide long mature amiR1 in each line was confirmed by northern blotting. (E, F) Down-regulation of U11-48K in the transgenic plants. The levels of U11-48K in each transgenic plant were confirmed by (E) RT–PCR and (F) real-time RT–PCR analysis. The numbers 1, 2, and 3 in (F) indicate amiR1-1, amiR1-2, and amiR1-3, respectively. Values are means ±SE obtained from three independent biological replicates. (This figure is available in colour at JXB online.)
    Figure Legend Snippet: Domain structure and cellular localization of the Arabidopsis homolog of human U11-48K protein and generation of artificial miRNA-mediated knockdown plants. (A) Schematic representation of the domain structure of the Arabidopsis homolog of human U11-48K. The conserved CHHC-type zinc finger (ZF) motif and arginine (Arg)-rich region are shown. (B) GFP signals from the 48K–GFP-expressing tobacco plant were observed using a confocal microscope. DAPI was used to stain the nucleus. Scale bar=10 μm. (C) Position of the artificial miRNA1 (amiR1) target site and the sequences of amiR1, along with its target, U11-48K (48K). Exons and introns are represented as gray boxes and thick lines, respectively, and the untranslated regions are represented as white boxes. (D) Confirmation of mature amiR1 generation. Total RNA extracted from each transgenic line (amiR1-1, amiR1-2, and amiR1-3) was separated via denaturing 12% PAGE, and the expression of 21 nucleotide long mature amiR1 in each line was confirmed by northern blotting. (E, F) Down-regulation of U11-48K in the transgenic plants. The levels of U11-48K in each transgenic plant were confirmed by (E) RT–PCR and (F) real-time RT–PCR analysis. The numbers 1, 2, and 3 in (F) indicate amiR1-1, amiR1-2, and amiR1-3, respectively. Values are means ±SE obtained from three independent biological replicates. (This figure is available in colour at JXB online.)

    Techniques Used: Expressing, Microscopy, Staining, Transgenic Assay, Polyacrylamide Gel Electrophoresis, Northern Blot, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    15) Product Images from "Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)"

    Article Title: Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)

    Journal: Emerging Microbes & Infections

    doi: 10.1038/emi.2016.56

    Assessing the role of the mSCARB2 protein in CDV:BS M-P1 and CDV:BS-VP1 K98E,E145A,L169F infection of murine cells. ( A – D ) Pre-incubation of 10 6 CCID 50 CDVs with the mSCARB2 protein for in vitro uncoating ( A, B ) or for cellular infection studies of NIH/3T3 cells ( C , D ). The viral RNA in the samples was extracted and quantified by RT–PCR (qRT–PCR). ( E–H ) Blocking viral entry by incubating NIH/3T3 cells with anti-mSCARB2 sera prior to inoculation with virus at an MOI of 10. Infection was assessed by determining viral titers in culture supernatant with dilutions of 10 -1 to 10 −10 in Vero cells at three days p.i. following chloroform viral disaggregation ( E , F ), and relative quantitation of EV71 RNA in extracted total cellular RNA by the ΔΔC T method using β-actin as an internal control ( G , H ). Tests were separately performed for CDV:BS M-P1 ( A , C , E , H ) and CDV:BS-VP1 K98E,E145A,L169F ( B , D , F , G ). For A – H , a t -test with Welch's correction for unequal variance was used to compare mean values ( n =4). Error bars represent the s.d.; * P
    Figure Legend Snippet: Assessing the role of the mSCARB2 protein in CDV:BS M-P1 and CDV:BS-VP1 K98E,E145A,L169F infection of murine cells. ( A – D ) Pre-incubation of 10 6 CCID 50 CDVs with the mSCARB2 protein for in vitro uncoating ( A, B ) or for cellular infection studies of NIH/3T3 cells ( C , D ). The viral RNA in the samples was extracted and quantified by RT–PCR (qRT–PCR). ( E–H ) Blocking viral entry by incubating NIH/3T3 cells with anti-mSCARB2 sera prior to inoculation with virus at an MOI of 10. Infection was assessed by determining viral titers in culture supernatant with dilutions of 10 -1 to 10 −10 in Vero cells at three days p.i. following chloroform viral disaggregation ( E , F ), and relative quantitation of EV71 RNA in extracted total cellular RNA by the ΔΔC T method using β-actin as an internal control ( G , H ). Tests were separately performed for CDV:BS M-P1 ( A , C , E , H ) and CDV:BS-VP1 K98E,E145A,L169F ( B , D , F , G ). For A – H , a t -test with Welch's correction for unequal variance was used to compare mean values ( n =4). Error bars represent the s.d.; * P

    Techniques Used: Infection, Incubation, In Vitro, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Blocking Assay, Quantitation Assay

    16) Product Images from "Sensitive Genotyping of Foodborne-Associated Human Noroviruses and Hepatitis A Virus Using an Array-Based Platform"

    Article Title: Sensitive Genotyping of Foodborne-Associated Human Noroviruses and Hepatitis A Virus Using an Array-Based Platform

    Journal: Sensors (Basel, Switzerland)

    doi: 10.3390/s17092157

    Steps of the array-based method for detecting distinct genotypes of NoV or HAV. The starting material was an RNA sample subjected to RT-PCR, purified, and enzymatically digested to remove the non-complementary strand. The hybridization steps was followed by the microarray labeling and signal amplification and quantification steps. Sample-to-result time is below 8 h.
    Figure Legend Snippet: Steps of the array-based method for detecting distinct genotypes of NoV or HAV. The starting material was an RNA sample subjected to RT-PCR, purified, and enzymatically digested to remove the non-complementary strand. The hybridization steps was followed by the microarray labeling and signal amplification and quantification steps. Sample-to-result time is below 8 h.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Purification, Hybridization, Microarray, Labeling, Amplification

    17) Product Images from "The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes"

    Article Title: The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv152

    Characterization of dsRBP gene structure, expression and localization. ( A ) Structures of loqs-ra, loqs-rb , and l oqs-rc splice variants and r2d2 mRNA. Solid boxes represent ORFs, unfilled boxes represent UTRs, and gray bars represent predicted DRMs. Primer locations used for RT-PCR and cDNA sequencing are marked by block arrows; 3′ RACE primers indicated by open arrows. ( B ) One-step RT-PCR using head (H), thorax (T), midgut (M), sugar-fed ovaries (SFO), blood-fed ovaries (BFO), male pupae (MP), female pupae (FP) and L4 larvae (L4) total RNA as templates to detect dsRBP transcripts. ( C ) Localization of overexpressed HA or FLAG-tagged dsRBPs in Aag2 cells. HA-EGFP and HA-R2D2 were expressed via dsSINV; HA-Loqs-PA and HA-Loqs-PB were expressed via plasmid transfection. ( D ) Localization of mosquito Dcr and Ago proteins in uninfected and infected Aag2 cell fractions: cytoplasm (CP), membrane (M), nucleus (N), and cytoskeleton (CS). Antibodies recognizing β-actin (cytoplasmic) and heterochromatin protein 1 (HP1, nuclear) were used to verify the success of each fractionation experiment.
    Figure Legend Snippet: Characterization of dsRBP gene structure, expression and localization. ( A ) Structures of loqs-ra, loqs-rb , and l oqs-rc splice variants and r2d2 mRNA. Solid boxes represent ORFs, unfilled boxes represent UTRs, and gray bars represent predicted DRMs. Primer locations used for RT-PCR and cDNA sequencing are marked by block arrows; 3′ RACE primers indicated by open arrows. ( B ) One-step RT-PCR using head (H), thorax (T), midgut (M), sugar-fed ovaries (SFO), blood-fed ovaries (BFO), male pupae (MP), female pupae (FP) and L4 larvae (L4) total RNA as templates to detect dsRBP transcripts. ( C ) Localization of overexpressed HA or FLAG-tagged dsRBPs in Aag2 cells. HA-EGFP and HA-R2D2 were expressed via dsSINV; HA-Loqs-PA and HA-Loqs-PB were expressed via plasmid transfection. ( D ) Localization of mosquito Dcr and Ago proteins in uninfected and infected Aag2 cell fractions: cytoplasm (CP), membrane (M), nucleus (N), and cytoskeleton (CS). Antibodies recognizing β-actin (cytoplasmic) and heterochromatin protein 1 (HP1, nuclear) were used to verify the success of each fractionation experiment.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Sequencing, Blocking Assay, Plasmid Preparation, Transfection, Infection, Fractionation

    18) Product Images from "Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers"

    Article Title: Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers

    Journal: Cancer Cell International

    doi: 10.1186/1475-2867-12-17

    Tumor tissues and breast cell lines express a higher proportion of the Δ exon 8 splice variant of paralemmin-1 than do reduction mammoplasty tissues. RNA was isolated and amplified with RT-PCR analysis using a primer set to detect Δ exon 8 splice variant. RT-PCR products were separated on a 2% low melting agarose gel and visualized by ethidium bromide. The full abbreviations of the cell lines are in Table 1 . Tumor tissue samples are represented by the prefix T and reduction mammoplasty tissue samples are represented by the prefix R. Numbers on the left of the figures represent the full length product (275 bp) and the Δ exon 8 splice variant (143 bp).
    Figure Legend Snippet: Tumor tissues and breast cell lines express a higher proportion of the Δ exon 8 splice variant of paralemmin-1 than do reduction mammoplasty tissues. RNA was isolated and amplified with RT-PCR analysis using a primer set to detect Δ exon 8 splice variant. RT-PCR products were separated on a 2% low melting agarose gel and visualized by ethidium bromide. The full abbreviations of the cell lines are in Table 1 . Tumor tissue samples are represented by the prefix T and reduction mammoplasty tissue samples are represented by the prefix R. Numbers on the left of the figures represent the full length product (275 bp) and the Δ exon 8 splice variant (143 bp).

    Techniques Used: Variant Assay, Isolation, Amplification, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Paralemmin-1 is differentially expressed in breast epithelial cell lines. RNA and protein lysates were isolated from tumorigenic and non-tumorigenic breast cell lines. Top: Real time qRT-PCR shows mRNA expression of paralemmin-1; means and S.E. from three separate cell cultures are presented; ER-positive cell lines, (hatched bars), ER-negative cell lines (solid bars). Bottom: Protein lysates (15 μg) were probed for paralemmin-1 expression by Western immunoblotting. Image is a representative of at least three separate experiments with different biological samples.
    Figure Legend Snippet: Paralemmin-1 is differentially expressed in breast epithelial cell lines. RNA and protein lysates were isolated from tumorigenic and non-tumorigenic breast cell lines. Top: Real time qRT-PCR shows mRNA expression of paralemmin-1; means and S.E. from three separate cell cultures are presented; ER-positive cell lines, (hatched bars), ER-negative cell lines (solid bars). Bottom: Protein lysates (15 μg) were probed for paralemmin-1 expression by Western immunoblotting. Image is a representative of at least three separate experiments with different biological samples.

    Techniques Used: Isolation, Quantitative RT-PCR, Expressing, Western Blot

    19) Product Images from "The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun"

    Article Title: The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun

    Journal: Cellular Signalling

    doi: 10.1016/j.cellsig.2012.04.016

    Protein kinase C inhibitors block human SOCS-3 gene induction in HUVECs. A). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either a combination of 10 μM forskolin plus 10 μM rolipram (F/R; upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the protein kinase C (PKC) inhibitors Ro-31-7549 or GF-109203X. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. B). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the PKC inhibitors Ro-31-7549 or Gö-6983. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. C). HUVECs were stimulated for 5 h in the presence or absence of F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus Ro-31-7549 (5 μM), Gö-6983 (25 μM) or GF-109203X (25 μM). Total RNA was then extracted from cells and subjected to one-step RT-PCR, with specific primers towards SOCS-3 or actin, as described in Materials and methods . Amplified DNA fragments were visualised by agarose gel electrophoresis.
    Figure Legend Snippet: Protein kinase C inhibitors block human SOCS-3 gene induction in HUVECs. A). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either a combination of 10 μM forskolin plus 10 μM rolipram (F/R; upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the protein kinase C (PKC) inhibitors Ro-31-7549 or GF-109203X. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. B). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the PKC inhibitors Ro-31-7549 or Gö-6983. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. C). HUVECs were stimulated for 5 h in the presence or absence of F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus Ro-31-7549 (5 μM), Gö-6983 (25 μM) or GF-109203X (25 μM). Total RNA was then extracted from cells and subjected to one-step RT-PCR, with specific primers towards SOCS-3 or actin, as described in Materials and methods . Amplified DNA fragments were visualised by agarose gel electrophoresis.

    Techniques Used: Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    20) Product Images from "A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower"

    Article Title: A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/ers153

    PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcript analyzed is PhAAE (mean±SE; n =3).
    Figure Legend Snippet: PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcript analyzed is PhAAE (mean±SE; n =3).

    Techniques Used: Quantitative RT-PCR, Isolation

    PhAAE transcript accumulation analysis (one-step qRT-PCR). Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16.00h (A). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00h (B). Ethylene treatment (2 µl l –1 analysis used excised MD and 44 568 whole flowers treated for 0, 1, 2, 4, and 8h (C, D). 50ng total RNA was used per reaction in all cases. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references (mean±SE; n =3).
    Figure Legend Snippet: PhAAE transcript accumulation analysis (one-step qRT-PCR). Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16.00h (A). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00h (B). Ethylene treatment (2 µl l –1 analysis used excised MD and 44 568 whole flowers treated for 0, 1, 2, 4, and 8h (C, D). 50ng total RNA was used per reaction in all cases. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references (mean±SE; n =3).

    Techniques Used: Quantitative RT-PCR

    PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcripts analyzed are PhBSMT , PhBPBT , PhCFAT , PhIGS1 , PhPAAS , PhKAT1 , PhCM1 , PhPAL1 , PhPAL2 , PhODO1 , PhC4H1 , PhC4H2 , and PhMYB4 (mean±SE; n =3).
    Figure Legend Snippet: PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcripts analyzed are PhBSMT , PhBPBT , PhCFAT , PhIGS1 , PhPAAS , PhKAT1 , PhCM1 , PhPAL1 , PhPAL2 , PhODO1 , PhC4H1 , PhC4H2 , and PhMYB4 (mean±SE; n =3).

    Techniques Used: Quantitative RT-PCR, Isolation

    21) Product Images from "Modeling the neuropsychiatric manifestations of Lowe syndrome using induced pluripotent stem cells: defective F-actin polymerization and WAVE-1 expression in neuronal cells"

    Article Title: Modeling the neuropsychiatric manifestations of Lowe syndrome using induced pluripotent stem cells: defective F-actin polymerization and WAVE-1 expression in neuronal cells

    Journal: Molecular Autism

    doi: 10.1186/s13229-018-0227-3

    DNA and cDNA sequencing. a Genomic DNA sequences showing mutations in the CRISPR-engineered knockout line (690KO) and the LS samples (LS100, LS300, and LS500) along with controls. The arrows point to the mutations. b The LS100 splice acceptor mutation predicts the loss of the natural splice site at the intron 23/exon 24 border, as well as a cryptic splice site 16 bases into exon 24. c cDNA sequencing showing normal exon 22/23 and exon 23/24 combinations in controls, and aberrant splicing in LS300, which leads to the exclusion of exon 23, thereby connecting exon 22 to 24; and the cryptic splice in LS100, as predicted in panel b
    Figure Legend Snippet: DNA and cDNA sequencing. a Genomic DNA sequences showing mutations in the CRISPR-engineered knockout line (690KO) and the LS samples (LS100, LS300, and LS500) along with controls. The arrows point to the mutations. b The LS100 splice acceptor mutation predicts the loss of the natural splice site at the intron 23/exon 24 border, as well as a cryptic splice site 16 bases into exon 24. c cDNA sequencing showing normal exon 22/23 and exon 23/24 combinations in controls, and aberrant splicing in LS300, which leads to the exclusion of exon 23, thereby connecting exon 22 to 24; and the cryptic splice in LS100, as predicted in panel b

    Techniques Used: Sequencing, CRISPR, Knock-Out, Mutagenesis

    22) Product Images from "High-Throughput Detection of West Nile Virus RNA"

    Article Title: High-Throughput Detection of West Nile Virus RNA

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.39.4.1264-1271.2001

    ABI Prism 6700 workstation extracts RNA as efficiently as the RNeasy method. Uninfected bird tissues spiked with titrated amounts of WNV were extracted by RNeasy methods (left panels) or with the ABI Prism 6700 workstation (right panels). The recovered RNA was subjected to standard RT-PCR amplification and analyzed on agarose gels stained with ethidium bromide. The amounts of WNV spiked into the sample (in PFU) are indicated above each lane. (A and B) Samples extracted from kidney and heart tissues, respectively. Lanes 1, 100-bp markers.
    Figure Legend Snippet: ABI Prism 6700 workstation extracts RNA as efficiently as the RNeasy method. Uninfected bird tissues spiked with titrated amounts of WNV were extracted by RNeasy methods (left panels) or with the ABI Prism 6700 workstation (right panels). The recovered RNA was subjected to standard RT-PCR amplification and analyzed on agarose gels stained with ethidium bromide. The amounts of WNV spiked into the sample (in PFU) are indicated above each lane. (A and B) Samples extracted from kidney and heart tissues, respectively. Lanes 1, 100-bp markers.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Staining

    Quantitation of WNV by real-time RT-PCR assay. C T values are plotted versus the log of a known amount of WNV (in PFU) (A) or in vitro transcribed RNA (B).
    Figure Legend Snippet: Quantitation of WNV by real-time RT-PCR assay. C T values are plotted versus the log of a known amount of WNV (in PFU) (A) or in vitro transcribed RNA (B).

    Techniques Used: Quantitation Assay, Quantitative RT-PCR, In Vitro

    23) Product Images from "Biochemical and Morphological Properties of Hepatitis C Virus Particles and Determination of Their Lipidome *"

    Article Title: Biochemical and Morphological Properties of Hepatitis C Virus Particles and Determination of Their Lipidome *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.175018

    Biochemical characterization of Jc1 particles. Huh7.5 cells were infected with an multiplicity of infection of 2 TCID 50 /cell for 24 h, and culture supernatants were collected 72 and 96 h later. Supernatants were concentrated by ultrafiltration, and concentrates were subjected to ultracentrifugation by using a 0–80% Optiprep density gradient. A, Western blot analysis of each density gradient fraction by using antibodies specified at the left . The blot is based on a preparation that was generated independently from the ones shown in B and C . As apoAI protein levels were too low for detection by Western blot, absolute amounts of apoAI as determined by ELISA are given at the bottom (fmol/ml). Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel. B, for each fraction, viral RNA, infectivity titer, and amounts of core protein, apoB, and apoE were determined. Results shown in panels 1 and 2 were obtained with the same gradient; core protein amounts are shown in both panels for ease of comparison only. Mean values and standard deviations of at least two measurements within one representative experiment are shown. Total amounts of HCV RNA, core protein, infectivity, apoB, or apoE contained in all gradient fractions shown in panels 1 and 2 were each set to 100% to calculate the relative values that are plotted against the density of the fractions ( panels 3 and 4 ). C, equal amounts of Jc1 particles (corresponding to 2 × 10 6 HCV RNA copies) contained in fractions of densities specified in the bottom were subjected to immuno-capture assay by using antibodies denoted in the legend on the top . In case of apoB- and apoE-specific antibodies, two different commercial sources were used, respectively ( CB, Calbiochem; ChC, Chemicon; PG, Progen; MP .). An antibody specific for the envelope protein of DENV served as a negative control and was used to determine the assay background and for normalization. HCV RNA contained in each captured sample was quantified by qRT-PCR and normalized to the capture efficiency of the negative control of the respective fraction. Error bars represent S.E. of duplicate measurements. A representative example of three independent experiments is shown.
    Figure Legend Snippet: Biochemical characterization of Jc1 particles. Huh7.5 cells were infected with an multiplicity of infection of 2 TCID 50 /cell for 24 h, and culture supernatants were collected 72 and 96 h later. Supernatants were concentrated by ultrafiltration, and concentrates were subjected to ultracentrifugation by using a 0–80% Optiprep density gradient. A, Western blot analysis of each density gradient fraction by using antibodies specified at the left . The blot is based on a preparation that was generated independently from the ones shown in B and C . As apoAI protein levels were too low for detection by Western blot, absolute amounts of apoAI as determined by ELISA are given at the bottom (fmol/ml). Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel. B, for each fraction, viral RNA, infectivity titer, and amounts of core protein, apoB, and apoE were determined. Results shown in panels 1 and 2 were obtained with the same gradient; core protein amounts are shown in both panels for ease of comparison only. Mean values and standard deviations of at least two measurements within one representative experiment are shown. Total amounts of HCV RNA, core protein, infectivity, apoB, or apoE contained in all gradient fractions shown in panels 1 and 2 were each set to 100% to calculate the relative values that are plotted against the density of the fractions ( panels 3 and 4 ). C, equal amounts of Jc1 particles (corresponding to 2 × 10 6 HCV RNA copies) contained in fractions of densities specified in the bottom were subjected to immuno-capture assay by using antibodies denoted in the legend on the top . In case of apoB- and apoE-specific antibodies, two different commercial sources were used, respectively ( CB, Calbiochem; ChC, Chemicon; PG, Progen; MP .). An antibody specific for the envelope protein of DENV served as a negative control and was used to determine the assay background and for normalization. HCV RNA contained in each captured sample was quantified by qRT-PCR and normalized to the capture efficiency of the negative control of the respective fraction. Error bars represent S.E. of duplicate measurements. A representative example of three independent experiments is shown.

    Techniques Used: Infection, Western Blot, Generated, Enzyme-linked Immunosorbent Assay, Molecular Weight, Marker, Negative Control, Quantitative RT-PCR

    Comparison of Jc1 and Jc1E2 FLAG particle production and analysis of density profiles. A, schematic representation of the Jc1E2 FLAG virus genome and amino acid sequence of the fusion site. The putative signalase cleavage site ( sig ) is indicated with a dotted arrow. B, comparative analysis of the kinetics of infectivity release from Huh7.5 cells after transfection with Jc1 or Jc1E2 FLAG . Virus titers were determined by TCID 50 assay. Note the indistinguishable production kinetics and amounts of infectious virus achieved with the two HCV genomes. Error bars represent standard deviations of two measurements. C, upper panel, density distribution of infectious Jc1 and Jc1E2 FLAG particles. A representative example of two independent experiments is shown. Lower panel, vRNA and infectivity of Jc1 and Jc1E2 FLAG contained in density fractions were determined by qRT-PCR or TCID 50 assay, respectively. The ratios of vRNA and TCID 50 indicating specific infectivity were calculated. D, lipoprotein association of Jc1E2 FLAG as determined by immuno-capture. In brief, 1 × 10 7 ( left ) or 2 × 10 6 vRNA ( right ) per fraction were used for immuno-capture with antibody-coated protein G-Sepharose beads for 4 h at 4 °C, and capture efficiency was assessed by qRT-PCR. Antibodies are specified at the top and densities of gradient fractions at the bottom , respectively. The DENV-E antibody served as a negative control. Error bars were used. E, Jc1E2 FLAG released from Huh7.5-transfected cells was concentrated by ultracentrifugation and used for density gradient centrifugation. Fractions with densities given at the top were analyzed by Western blot using antibodies specified on the left. Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel.
    Figure Legend Snippet: Comparison of Jc1 and Jc1E2 FLAG particle production and analysis of density profiles. A, schematic representation of the Jc1E2 FLAG virus genome and amino acid sequence of the fusion site. The putative signalase cleavage site ( sig ) is indicated with a dotted arrow. B, comparative analysis of the kinetics of infectivity release from Huh7.5 cells after transfection with Jc1 or Jc1E2 FLAG . Virus titers were determined by TCID 50 assay. Note the indistinguishable production kinetics and amounts of infectious virus achieved with the two HCV genomes. Error bars represent standard deviations of two measurements. C, upper panel, density distribution of infectious Jc1 and Jc1E2 FLAG particles. A representative example of two independent experiments is shown. Lower panel, vRNA and infectivity of Jc1 and Jc1E2 FLAG contained in density fractions were determined by qRT-PCR or TCID 50 assay, respectively. The ratios of vRNA and TCID 50 indicating specific infectivity were calculated. D, lipoprotein association of Jc1E2 FLAG as determined by immuno-capture. In brief, 1 × 10 7 ( left ) or 2 × 10 6 vRNA ( right ) per fraction were used for immuno-capture with antibody-coated protein G-Sepharose beads for 4 h at 4 °C, and capture efficiency was assessed by qRT-PCR. Antibodies are specified at the top and densities of gradient fractions at the bottom , respectively. The DENV-E antibody served as a negative control. Error bars were used. E, Jc1E2 FLAG released from Huh7.5-transfected cells was concentrated by ultracentrifugation and used for density gradient centrifugation. Fractions with densities given at the top were analyzed by Western blot using antibodies specified on the left. Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel.

    Techniques Used: Sequencing, Infection, Transfection, Quantitative RT-PCR, Negative Control, Gradient Centrifugation, Western Blot, Molecular Weight, Marker

    24) Product Images from "Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-targeted T-cells"

    Article Title: Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-targeted T-cells

    Journal: Nature

    doi: 10.1038/s41586-018-0178-z

    Detection of TET2 chimaeric transcripts in Patient-10 CAR T cells and DNA sequencing for mutation detection. a, The strategy for detection of polyadenylated RNA corresponding to truncated TET2 transcripts is depicted. Boxes represent the genomic regions between TET2 exons 9 and 10 with the integrated vector present. Blue and red arrows indicate general locations of the forward and reverse primers, which are listed below the diagram. LTR, long terminal repeat; cPPT, polypurine tract; EF1α, elongation factor 1-α promoter. Sequences corresponding to the splice junctions for the three chimaeric messages (five total junctions) are listed in the bottom chart. Underlines indicate consensus splice donors and acceptors. b, Visualization of chimaeric TET2 RT–PCR products. PCR products were separated on a native agarose gel and stained with ethidium bromide. Expected sizes of amplicons are listed above the gel. Truncated transcripts are highlighted by blue boxes. A key to the RT–PCR reactions is shown below the diagram. *Band size not determined (two independent experiments). c, Genes interrogated by the next generation sequencing panel used to analyse DNA isolated from CD8 + CAR + T cells and CAR − T cells in Patient-10 at the peak of his response. d, Sanger sequencing of specific amplifications corresponding to the allele that was disrupted by integration of the CAR lentivirus is shown. The mutation that was detected by next generation sequencing of total genomic DNA from CAR + T cells () is not present in the TET2 allele hosting the lentiviral integration site. Fig. 3c
    Figure Legend Snippet: Detection of TET2 chimaeric transcripts in Patient-10 CAR T cells and DNA sequencing for mutation detection. a, The strategy for detection of polyadenylated RNA corresponding to truncated TET2 transcripts is depicted. Boxes represent the genomic regions between TET2 exons 9 and 10 with the integrated vector present. Blue and red arrows indicate general locations of the forward and reverse primers, which are listed below the diagram. LTR, long terminal repeat; cPPT, polypurine tract; EF1α, elongation factor 1-α promoter. Sequences corresponding to the splice junctions for the three chimaeric messages (five total junctions) are listed in the bottom chart. Underlines indicate consensus splice donors and acceptors. b, Visualization of chimaeric TET2 RT–PCR products. PCR products were separated on a native agarose gel and stained with ethidium bromide. Expected sizes of amplicons are listed above the gel. Truncated transcripts are highlighted by blue boxes. A key to the RT–PCR reactions is shown below the diagram. *Band size not determined (two independent experiments). c, Genes interrogated by the next generation sequencing panel used to analyse DNA isolated from CD8 + CAR + T cells and CAR − T cells in Patient-10 at the peak of his response. d, Sanger sequencing of specific amplifications corresponding to the allele that was disrupted by integration of the CAR lentivirus is shown. The mutation that was detected by next generation sequencing of total genomic DNA from CAR + T cells () is not present in the TET2 allele hosting the lentiviral integration site. Fig. 3c

    Techniques Used: DNA Sequencing, Mutagenesis, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Next-Generation Sequencing, Isolation, Sequencing

    25) Product Images from "TIP39/parathyroid hormone type 2 receptor signaling is a potent inhibitor of chondrocyte proliferation and differentiation"

    Article Title: TIP39/parathyroid hormone type 2 receptor signaling is a potent inhibitor of chondrocyte proliferation and differentiation

    Journal: American Journal of Physiology - Endocrinology and Metabolism

    doi: 10.1152/ajpendo.00254.2009

    Altered expression of cartilaginous matrix proteins and metalloproteinases by TIP39/PTH2R signaling. A : relative abundance for Col2a1 and Col10a1 by semiquantitative RT-PCR. B : Col2a1 mRNA levels were assessed in TIP39-treated and untreated CFK2V and
    Figure Legend Snippet: Altered expression of cartilaginous matrix proteins and metalloproteinases by TIP39/PTH2R signaling. A : relative abundance for Col2a1 and Col10a1 by semiquantitative RT-PCR. B : Col2a1 mRNA levels were assessed in TIP39-treated and untreated CFK2V and

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    26) Product Images from "SLOW WALKER1, Essential for Gametogenesis in Arabidopsis, Encodes a WD40 Protein Involved in 18S Ribosomal RNA Biogenesis"

    Article Title: SLOW WALKER1, Essential for Gametogenesis in Arabidopsis, Encodes a WD40 Protein Involved in 18S Ribosomal RNA Biogenesis

    Journal: The Plant Cell

    doi: 10.1105/tpc.105.033563

    18S Pre-rRNA Processing in RNAi Transgenic Callus. (A) ). rRNA genes are arranged in tandem, separated by nontranscribed spacers (NTS). 18S, 5.8S, and 25/28S rRNAs are transcribed into pre-rRNA as a unit. (B) Arabidopsis pre-rRNA transcript contains the 18S, 5.8S, and 25S rRNAs as well as the 5′ and 3′ external transcript spacer (ETS) and two internal transcript spacers between the three rRNAs (ITS1 and ITS2). The positions of primers U1 and U2 used in RT-PCR detection of 18S pre-rRNA in RNAi callus are shown. Site P shows the primary pre-rRNA cleavage site in the 5′ ETS of Arabidopsis. Mature 18S, 5.8S, and 25S rRNAs are generated after additional processing steps that are not described here. (C) Detection of 18S pre-rRNA in RNAi callus. Top gel, RT-PCR result showing increased amounts of 18S pre-rRNA in RNAi1 and RNAi2 callus induced with β-estradiol compared with DMSO treatment. The data indicate that the knockout of SWA1 expression with RNAi technology leads to the accumulation of unprocessed 18S pre-rRNA. Bottom gel, RT-PCR product of the eIF4A gene, showing equal amounts of starting RNA template.
    Figure Legend Snippet: 18S Pre-rRNA Processing in RNAi Transgenic Callus. (A) ). rRNA genes are arranged in tandem, separated by nontranscribed spacers (NTS). 18S, 5.8S, and 25/28S rRNAs are transcribed into pre-rRNA as a unit. (B) Arabidopsis pre-rRNA transcript contains the 18S, 5.8S, and 25S rRNAs as well as the 5′ and 3′ external transcript spacer (ETS) and two internal transcript spacers between the three rRNAs (ITS1 and ITS2). The positions of primers U1 and U2 used in RT-PCR detection of 18S pre-rRNA in RNAi callus are shown. Site P shows the primary pre-rRNA cleavage site in the 5′ ETS of Arabidopsis. Mature 18S, 5.8S, and 25S rRNAs are generated after additional processing steps that are not described here. (C) Detection of 18S pre-rRNA in RNAi callus. Top gel, RT-PCR result showing increased amounts of 18S pre-rRNA in RNAi1 and RNAi2 callus induced with β-estradiol compared with DMSO treatment. The data indicate that the knockout of SWA1 expression with RNAi technology leads to the accumulation of unprocessed 18S pre-rRNA. Bottom gel, RT-PCR product of the eIF4A gene, showing equal amounts of starting RNA template.

    Techniques Used: Transgenic Assay, Reverse Transcription Polymerase Chain Reaction, Generated, Knock-Out, Expressing

    Expression Pattern of SWA1 Revealed by RT-PCR. mRNA isolated from different tissues as indicated was used as template and amplified with gene-specific primers by RT-PCR. The eIF4A gene was used as an internal control. Top gel, RT-PCR products showing the presence of SWA1 transcripts in root, stem, leaf, inflorescence, and silique of wild-type plants. Middle gel, RT-PCR products of the eIF4A gene, showing equal amounts of starting mRNAs. Bottom gel, PCR product with mRNA as template directly, showing no DNA contamination in the mRNA sample.
    Figure Legend Snippet: Expression Pattern of SWA1 Revealed by RT-PCR. mRNA isolated from different tissues as indicated was used as template and amplified with gene-specific primers by RT-PCR. The eIF4A gene was used as an internal control. Top gel, RT-PCR products showing the presence of SWA1 transcripts in root, stem, leaf, inflorescence, and silique of wild-type plants. Middle gel, RT-PCR products of the eIF4A gene, showing equal amounts of starting mRNAs. Bottom gel, PCR product with mRNA as template directly, showing no DNA contamination in the mRNA sample.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Polymerase Chain Reaction

    27) Product Images from "Tumor Necrosis Factor Alpha-Induced Hypoxia-Inducible Factor 1?-?-Catenin Axis Regulates Major Histocompatibility Complex Class I Gene Activation through Chromatin Remodeling"

    Article Title: Tumor Necrosis Factor Alpha-Induced Hypoxia-Inducible Factor 1?-?-Catenin Axis Regulates Major Histocompatibility Complex Class I Gene Activation through Chromatin Remodeling

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.01254-12

    Increased association of CREB with Brg1 but not hBrm. (A) TNF-α has no effect on the levels of hBrm and Brg1. Shown is a Western blot analysis indicating nuclear hBrm and Brg1 levels in TNF-α-treated cells. C-23 levels are shown as a loading control (lane C). (B) TNF-α induces acetylation of hBrm. Nuclear extracts from TNF-α-treated cells were immunoprecipitated with anti-hBrm antibody and analyzed for the levels of acetylated hBrm with a pan-acetylated-lysine antibody. IB, immunoblot. (C) TNF-α increases the association between CREB and Brg1 but not hBrm in a β-catenin-dependent manner. Nuclear extracts from cells transfected with β-catenin siRNA and treated with TNF-α were immunoprecipitated with CREB antibody, and an immunoblot analysis was done with Brg1 and hBrm antibodies. Band density was normalized against IgG levels under the same conditions. NS, nonspecific. (D, E) ChIP and ChIP-qPCR analyses indicating the relative changes in hBrm and Brg1 binding levels at the SXY module of the MHC-I promoter upon TNF-α treatment in a β-catenin-dependent manner. A representative gel image of the precleared fraction (Input) and the anti-Brg1- or anti-hBrm antibody-immunoprecipitated sample after PCR amplification is shown. DNA samples immunoprecipitated with the indicated antibodies were also subjected to qPCR along with the diluted input (1%), and the n -fold enrichment was calculated relative to control levels after correction for background signals. qPCR data bars indicate relative changes ( n -fold) in enrichment over the control levels ± the standard deviations from two independent sets. (F) Brg1 activity is crucial for MHC-I expression. RT-PCR for MHC-I expression in TNF-α-treated cells transfected with ATPase-deficient Brg1 with a mutation in the ATPase subunit (K-R). GAPDH levels were used as internal controls. All experiments were performed with glioma cell line T98G.
    Figure Legend Snippet: Increased association of CREB with Brg1 but not hBrm. (A) TNF-α has no effect on the levels of hBrm and Brg1. Shown is a Western blot analysis indicating nuclear hBrm and Brg1 levels in TNF-α-treated cells. C-23 levels are shown as a loading control (lane C). (B) TNF-α induces acetylation of hBrm. Nuclear extracts from TNF-α-treated cells were immunoprecipitated with anti-hBrm antibody and analyzed for the levels of acetylated hBrm with a pan-acetylated-lysine antibody. IB, immunoblot. (C) TNF-α increases the association between CREB and Brg1 but not hBrm in a β-catenin-dependent manner. Nuclear extracts from cells transfected with β-catenin siRNA and treated with TNF-α were immunoprecipitated with CREB antibody, and an immunoblot analysis was done with Brg1 and hBrm antibodies. Band density was normalized against IgG levels under the same conditions. NS, nonspecific. (D, E) ChIP and ChIP-qPCR analyses indicating the relative changes in hBrm and Brg1 binding levels at the SXY module of the MHC-I promoter upon TNF-α treatment in a β-catenin-dependent manner. A representative gel image of the precleared fraction (Input) and the anti-Brg1- or anti-hBrm antibody-immunoprecipitated sample after PCR amplification is shown. DNA samples immunoprecipitated with the indicated antibodies were also subjected to qPCR along with the diluted input (1%), and the n -fold enrichment was calculated relative to control levels after correction for background signals. qPCR data bars indicate relative changes ( n -fold) in enrichment over the control levels ± the standard deviations from two independent sets. (F) Brg1 activity is crucial for MHC-I expression. RT-PCR for MHC-I expression in TNF-α-treated cells transfected with ATPase-deficient Brg1 with a mutation in the ATPase subunit (K-R). GAPDH levels were used as internal controls. All experiments were performed with glioma cell line T98G.

    Techniques Used: Western Blot, Immunoprecipitation, Transfection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Polymerase Chain Reaction, Amplification, Activity Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Mutagenesis

    28) Product Images from "Proteolytic Cleavage of Human Acid-sensing Ion Channel 1 by the Serine Protease Matriptase *"

    Article Title: Proteolytic Cleavage of Human Acid-sensing Ion Channel 1 by the Serine Protease Matriptase *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.153213

    RT-PCR and Western blot detection of matriptase in glioma cell lines and fresh GBM tissues. A , agarose gels of RT-PCR products detect matriptase RNA in SKMG and U251MG cell lines, freshly resected GBM, and anaplastic astrocytoma ( AA ). A matriptase message
    Figure Legend Snippet: RT-PCR and Western blot detection of matriptase in glioma cell lines and fresh GBM tissues. A , agarose gels of RT-PCR products detect matriptase RNA in SKMG and U251MG cell lines, freshly resected GBM, and anaplastic astrocytoma ( AA ). A matriptase message

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Western Blot

    29) Product Images from "In Vivo Tropisms and Kinetics of Rat Theilovirus Infection in Immunocompetent and Immunodeficient Rats"

    Article Title: In Vivo Tropisms and Kinetics of Rat Theilovirus Infection in Immunocompetent and Immunodeficient Rats

    Journal: Virus research

    doi: 10.1016/j.virusres.2011.07.014

    Detection of RTV1 in the spleen and mesenteric lymph nodes by RT-PCR. Brown Norway (BN) n=11, Fischer 344 (F344) n=11, Hsd:RH-Fox1 rnu (Hsd: rnu ) n=10, and NTac:NIH- Whn (Tac: rnu ) n=10 rats were inoculated with 2.5 × 10 6 PFU RTV1 by oral gavage. Statistical analysis performed by Fischer’s Exact test with asterisk indicating statistical difference between immunocompromised and immunocompetent groups (P
    Figure Legend Snippet: Detection of RTV1 in the spleen and mesenteric lymph nodes by RT-PCR. Brown Norway (BN) n=11, Fischer 344 (F344) n=11, Hsd:RH-Fox1 rnu (Hsd: rnu ) n=10, and NTac:NIH- Whn (Tac: rnu ) n=10 rats were inoculated with 2.5 × 10 6 PFU RTV1 by oral gavage. Statistical analysis performed by Fischer’s Exact test with asterisk indicating statistical difference between immunocompromised and immunocompetent groups (P

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    30) Product Images from "Prostate-derived Ets transcription factor (PDEF) downregulates survivin expression and inhibits breast cancer cell growth in vitro and xenograft tumor formation in vivo"

    Article Title: Prostate-derived Ets transcription factor (PDEF) downregulates survivin expression and inhibits breast cancer cell growth in vitro and xenograft tumor formation in vivo

    Journal: Breast cancer research and treatment

    doi: 10.1007/s10549-006-9314-9

    Survivin expression is inversely associated with PDEF protein expression. ( A ) Upper panel: Western blots show PDEF polyclonal antibodies (see Method section) specifically recognized a PDEF protein band from MCF-7 cell lysates but not from the lysates of U937, HeLa and Skbr3 cells. Lanes 1–4: 50 μ g of cell lysates per lane, lane 5: 0.1 ng of purified PDEF protein (positive control). Lower panel: PDEF mRNA expression in the same cell lines determined by RT-PCR. GAPDH is an internal control, and template in the lane 5 is 10 ng pcDNA3.1-PDEF plasmid. ( B ) Inverse expression pattern of PDEF and survivin in breast cancer cell lines. The expression of PDEF, survivin and actin was determined by Western blot analysis. Only the major survivin isoform was detected as the other isoforms are expressed at significantly lower levels in these cells. ( C ) Immunocytochemistry confirms PDEF expression in MCF-7 cells (400× magnification). ( D ) Immunohistochemistry showed PDEF expression in ductal and lobular epithelial cells of normal breast tissues ( E ). Inverse expression pattern of PDEF and survivin in normal and cancerous breast tissues. Protein expression was determined as in ( B ). Note: Actin expression shown in ( A ), ( B ) and ( E ) was used as a total protein loading control
    Figure Legend Snippet: Survivin expression is inversely associated with PDEF protein expression. ( A ) Upper panel: Western blots show PDEF polyclonal antibodies (see Method section) specifically recognized a PDEF protein band from MCF-7 cell lysates but not from the lysates of U937, HeLa and Skbr3 cells. Lanes 1–4: 50 μ g of cell lysates per lane, lane 5: 0.1 ng of purified PDEF protein (positive control). Lower panel: PDEF mRNA expression in the same cell lines determined by RT-PCR. GAPDH is an internal control, and template in the lane 5 is 10 ng pcDNA3.1-PDEF plasmid. ( B ) Inverse expression pattern of PDEF and survivin in breast cancer cell lines. The expression of PDEF, survivin and actin was determined by Western blot analysis. Only the major survivin isoform was detected as the other isoforms are expressed at significantly lower levels in these cells. ( C ) Immunocytochemistry confirms PDEF expression in MCF-7 cells (400× magnification). ( D ) Immunohistochemistry showed PDEF expression in ductal and lobular epithelial cells of normal breast tissues ( E ). Inverse expression pattern of PDEF and survivin in normal and cancerous breast tissues. Protein expression was determined as in ( B ). Note: Actin expression shown in ( A ), ( B ) and ( E ) was used as a total protein loading control

    Techniques Used: Expressing, Western Blot, Purification, Positive Control, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Immunocytochemistry, Immunohistochemistry

    31) Product Images from "Spore Germination Mediated by Bacillus megaterium QM B1551 SleL and YpeB"

    Article Title: Spore Germination Mediated by Bacillus megaterium QM B1551 SleL and YpeB

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01298-13

    RT-PCR analysis of the expression of ypeB during sporulation of B. megaterium QM B1551 (A), B. megaterium sleB (GC103) (B), and B. megaterium sleB pHT- ypeB (GC123) (C) strains. RT-PCR was conducted using gene-specific primers designed to amplify an ∼500-bp fragment of ypeB from RNA isolated from sporulating cultures, as described in Materials and Methods. Numbers below the lanes refer to the times (h) after entry to sporulation. Molecular weight markers (lane M), and negative, i.e., no template RNA (-ve), control reactions are indicated. Isolated RNAs were verified as being free from genomic DNA by conducting PCRs with the same ypeB -specific primers (data not shown).
    Figure Legend Snippet: RT-PCR analysis of the expression of ypeB during sporulation of B. megaterium QM B1551 (A), B. megaterium sleB (GC103) (B), and B. megaterium sleB pHT- ypeB (GC123) (C) strains. RT-PCR was conducted using gene-specific primers designed to amplify an ∼500-bp fragment of ypeB from RNA isolated from sporulating cultures, as described in Materials and Methods. Numbers below the lanes refer to the times (h) after entry to sporulation. Molecular weight markers (lane M), and negative, i.e., no template RNA (-ve), control reactions are indicated. Isolated RNAs were verified as being free from genomic DNA by conducting PCRs with the same ypeB -specific primers (data not shown).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Molecular Weight

    32) Product Images from "Molecular Characterization of Feline Infectious Peritonitis Virus Strain DF-2 and Studies of the Role of ORF3abc in Viral Cell Tropism"

    Article Title: Molecular Characterization of Feline Infectious Peritonitis Virus Strain DF-2 and Studies of the Role of ORF3abc in Viral Cell Tropism

    Journal: Journal of Virology

    doi: 10.1128/JVI.00189-12

    RT-PCR detection of sg mRNA transcription of ORF3abc of PBFIPV-DF-2 and PBFIPV-DF-2-R3i 24 h after infection of CrFK cells (MOI of 0.1). The DF2F forward primer was designed to hybridize to the leader sequence of the FIPV DF-2 genome, while the ORF3CR
    Figure Legend Snippet: RT-PCR detection of sg mRNA transcription of ORF3abc of PBFIPV-DF-2 and PBFIPV-DF-2-R3i 24 h after infection of CrFK cells (MOI of 0.1). The DF2F forward primer was designed to hybridize to the leader sequence of the FIPV DF-2 genome, while the ORF3CR

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Infection, Sequencing

    33) Product Images from "Genetic Analysis of West Nile Virus Isolates from an Outbreak in Idaho, United States, 2006-2007"

    Article Title: Genetic Analysis of West Nile Virus Isolates from an Outbreak in Idaho, United States, 2006-2007

    Journal: International Journal of Environmental Research and Public Health

    doi: 10.3390/ijerph10094486

    ( A ) Scheme of multiplex RT-PCR assay; ( B ) 2% agarose gel stained by ethidium bromide. NC–negative control, no viral RNA added in PCR reaction. C1 and C2–positive controls for F10400-R10630 and F10100-R10630 primers pairs respectively. L–1 kb ladder (Invitrogen). N–no deletion. D–deletion.
    Figure Legend Snippet: ( A ) Scheme of multiplex RT-PCR assay; ( B ) 2% agarose gel stained by ethidium bromide. NC–negative control, no viral RNA added in PCR reaction. C1 and C2–positive controls for F10400-R10630 and F10100-R10630 primers pairs respectively. L–1 kb ladder (Invitrogen). N–no deletion. D–deletion.

    Techniques Used: Multiplex Assay, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Negative Control, Polymerase Chain Reaction

    34) Product Images from "Highly Specific Gene Silencing by Artificial miRNAs in Rice"

    Article Title: Highly Specific Gene Silencing by Artificial miRNAs in Rice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0001829

    Molecular characterization of transgenic plants. Cleavage site mapping was performed on mRNA from one transgenic plant for each transgene in both varieties (Nipponbare and IR64). Numbers above the arrows denote the number of clones ending at the particular position, with the total number of clones in parentheses. The binding energy (ΔG) of the RNA-RNA duplex between target (denoted by TIGR locus identifier) and amiRNA is given in kcal/mol and as a fraction of the calculated binding energy for a perfect match to the target site. Total RNA from two transgenic plants for each construct (leaf tissue for SPl11 and Pds , young panicles for Eui1 / CYP714D1 ) was used for RT-PCR for the target (histograms, top right), and small RNA blots (bottom right). Gel images are provided as loading control for small RNA blots. Comparison was to an empty vector control (IRS-154). Expression was normalized to the respective empty vector control. Error bars indicate the variation between technical replicates (range).
    Figure Legend Snippet: Molecular characterization of transgenic plants. Cleavage site mapping was performed on mRNA from one transgenic plant for each transgene in both varieties (Nipponbare and IR64). Numbers above the arrows denote the number of clones ending at the particular position, with the total number of clones in parentheses. The binding energy (ΔG) of the RNA-RNA duplex between target (denoted by TIGR locus identifier) and amiRNA is given in kcal/mol and as a fraction of the calculated binding energy for a perfect match to the target site. Total RNA from two transgenic plants for each construct (leaf tissue for SPl11 and Pds , young panicles for Eui1 / CYP714D1 ) was used for RT-PCR for the target (histograms, top right), and small RNA blots (bottom right). Gel images are provided as loading control for small RNA blots. Comparison was to an empty vector control (IRS-154). Expression was normalized to the respective empty vector control. Error bars indicate the variation between technical replicates (range).

    Techniques Used: Transgenic Assay, Clone Assay, Binding Assay, Construct, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Expressing

    35) Product Images from "Serotype Specific Primers and Gel-Based RT-PCR Assays for 'Typing' African Horse Sickness Virus: Identification of Strains from Africa"

    Article Title: Serotype Specific Primers and Gel-Based RT-PCR Assays for 'Typing' African Horse Sickness Virus: Identification of Strains from Africa

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0025686

    Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Senegal 2007 using ‘type-specific’ primer-pairs. Panel A and B: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from equine lung (SEN2007/01 – panel A) and spleen (SEN2007/02 – panel B) using primer-pairs ‘2A1’ (1098 bp, lane 5 in both panels) and ‘2A2’ (1339 bp, lane 6 in both panels) ( Table S1 ), demonstrating that the samples contain AHSV-2 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2). Panel C: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SEN2007/06 using primer-pairs ‘7A1’ (1426 bp - lane 7) ( Table S1 ), demonstrating that the samples contain AHSV-7 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using first set of primers for each serotypes. No amplification was detected in other serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV multivalent vaccine strain (SENvvv1/MV) with ‘3A1’ was used as positive control which generated a product of 751 bp (lane +C). Panel D: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SENvvvv/09 using primer-pairs ‘9A1’ (1483 bp - lane 18) and ‘9A2’ (1706 bp – lane 19) ( Table S1 ), demonstrating that this sample contains AHSV-9 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2).
    Figure Legend Snippet: Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Senegal 2007 using ‘type-specific’ primer-pairs. Panel A and B: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from equine lung (SEN2007/01 – panel A) and spleen (SEN2007/02 – panel B) using primer-pairs ‘2A1’ (1098 bp, lane 5 in both panels) and ‘2A2’ (1339 bp, lane 6 in both panels) ( Table S1 ), demonstrating that the samples contain AHSV-2 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2). Panel C: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SEN2007/06 using primer-pairs ‘7A1’ (1426 bp - lane 7) ( Table S1 ), demonstrating that the samples contain AHSV-7 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using first set of primers for each serotypes. No amplification was detected in other serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV multivalent vaccine strain (SENvvv1/MV) with ‘3A1’ was used as positive control which generated a product of 751 bp (lane +C). Panel D: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SENvvvv/09 using primer-pairs ‘9A1’ (1483 bp - lane 18) and ‘9A2’ (1706 bp – lane 19) ( Table S1 ), demonstrating that this sample contains AHSV-9 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2).

    Techniques Used: Polymerase Chain Reaction, Generated, Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Positive Control

    Electrophoretic analysis of cDNA products generated in AHSV group-specific RT-PCR assays using Seg-7 specific primers. PCR amplicons of 1179 bp were generated from AHSV Seg-7 specific RT-PCR of dsRNA extracted from equine lung and spleen extracts and vaccine strain from Senegal tested in duplicate (SEN2007/01 – lanes 1 and 2; SEN2007/02 – lanes 3 and 4 in panel A; SENvvvv/09 – lanes 1 and 2 in panel B respectively) [46] , demonstrating that the samples contain AHSV RNA. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane +C, panel B).
    Figure Legend Snippet: Electrophoretic analysis of cDNA products generated in AHSV group-specific RT-PCR assays using Seg-7 specific primers. PCR amplicons of 1179 bp were generated from AHSV Seg-7 specific RT-PCR of dsRNA extracted from equine lung and spleen extracts and vaccine strain from Senegal tested in duplicate (SEN2007/01 – lanes 1 and 2; SEN2007/02 – lanes 3 and 4 in panel A; SENvvvv/09 – lanes 1 and 2 in panel B respectively) [46] , demonstrating that the samples contain AHSV RNA. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane +C, panel B).

    Techniques Used: Generated, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Marker, Positive Control

    Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Kenya 2007 using ‘type-specific’ primer-pairs. PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from KEN2007/01 and KEN2007/02 using primer-pairs ‘4A1’ (1264 bp, lane 4 in panels A and C) and ‘4A2’ (1463 bp, lane 4 in panels B and D) ( Table S1 ), demonstrating that the samples contain AHSV-4 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using pair of primers for each serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV-2 from Senegal (SEN2007/02) with primer set ‘2A2’ (generating a product of 1339 bp) was used as a positive control.
    Figure Legend Snippet: Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Kenya 2007 using ‘type-specific’ primer-pairs. PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from KEN2007/01 and KEN2007/02 using primer-pairs ‘4A1’ (1264 bp, lane 4 in panels A and C) and ‘4A2’ (1463 bp, lane 4 in panels B and D) ( Table S1 ), demonstrating that the samples contain AHSV-4 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using pair of primers for each serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV-2 from Senegal (SEN2007/02) with primer set ‘2A2’ (generating a product of 1339 bp) was used as a positive control.

    Techniques Used: Polymerase Chain Reaction, Generated, Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Positive Control

    36) Product Images from "Surgery-induced monocytic myeloid-derived suppressor cells expand regulatory T cells in lung cancer"

    Article Title: Surgery-induced monocytic myeloid-derived suppressor cells expand regulatory T cells in lung cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.14991

    Surgery-induced M-MDSCs from lung cancer patients mediate expansion of Treg in vitro CD4 + cells isolated preoperatively from PBMCs of lung cancer patients (n=16) were cocultured with purified pre- or postoperative autologous M-MDSCs or G-MDSCs in the presence of mitomycin C-treated allogeneic PBMCs stimulator cells for 5 days. Treg were analyzed with FCM. A . Results are shown for combined results for four independent experiments showing absolute number of Treg. B . The expression of Foxp3 mRNA was analyzed by quantitative real-time PCR. C . The percentage of PD-1 + cells in Treg was analyzed by FCM. D . M-MDSCs were cocultured with CD4 + cells as described and transwell inserts were used as indicated. Shown are cumulative results from 3 independent experiments. * P
    Figure Legend Snippet: Surgery-induced M-MDSCs from lung cancer patients mediate expansion of Treg in vitro CD4 + cells isolated preoperatively from PBMCs of lung cancer patients (n=16) were cocultured with purified pre- or postoperative autologous M-MDSCs or G-MDSCs in the presence of mitomycin C-treated allogeneic PBMCs stimulator cells for 5 days. Treg were analyzed with FCM. A . Results are shown for combined results for four independent experiments showing absolute number of Treg. B . The expression of Foxp3 mRNA was analyzed by quantitative real-time PCR. C . The percentage of PD-1 + cells in Treg was analyzed by FCM. D . M-MDSCs were cocultured with CD4 + cells as described and transwell inserts were used as indicated. Shown are cumulative results from 3 independent experiments. * P

    Techniques Used: In Vitro, Isolation, Purification, Expressing, Real-time Polymerase Chain Reaction

    37) Product Images from "Modeling the neuropsychiatric manifestations of Lowe syndrome using induced pluripotent stem cells: defective F-actin polymerization and WAVE-1 expression in neuronal cells"

    Article Title: Modeling the neuropsychiatric manifestations of Lowe syndrome using induced pluripotent stem cells: defective F-actin polymerization and WAVE-1 expression in neuronal cells

    Journal: Molecular Autism

    doi: 10.1186/s13229-018-0227-3

    DNA and cDNA sequencing. a Genomic DNA sequences showing mutations in the CRISPR-engineered knockout line (690KO) and the LS samples (LS100, LS300, and LS500) along with controls. The arrows point to the mutations. b The LS100 splice acceptor mutation predicts the loss of the natural splice site at the intron 23/exon 24 border, as well as a cryptic splice site 16 bases into exon 24. c cDNA sequencing showing normal exon 22/23 and exon 23/24 combinations in controls, and aberrant splicing in LS300, which leads to the exclusion of exon 23, thereby connecting exon 22 to 24; and the cryptic splice in LS100, as predicted in panel b
    Figure Legend Snippet: DNA and cDNA sequencing. a Genomic DNA sequences showing mutations in the CRISPR-engineered knockout line (690KO) and the LS samples (LS100, LS300, and LS500) along with controls. The arrows point to the mutations. b The LS100 splice acceptor mutation predicts the loss of the natural splice site at the intron 23/exon 24 border, as well as a cryptic splice site 16 bases into exon 24. c cDNA sequencing showing normal exon 22/23 and exon 23/24 combinations in controls, and aberrant splicing in LS300, which leads to the exclusion of exon 23, thereby connecting exon 22 to 24; and the cryptic splice in LS100, as predicted in panel b

    Techniques Used: Sequencing, CRISPR, Knock-Out, Mutagenesis

    38) Product Images from "Huntingtin interacting protein 14 is an oncogenic human protein: palmitoyl acyltransferase"

    Article Title: Huntingtin interacting protein 14 is an oncogenic human protein: palmitoyl acyltransferase

    Journal: Oncogene

    doi: 10.1038/sj.onc.1208171

    HIP14 siRNA affects in vitro palmitoylation of the FarnCNRas(NBD) peptide and subcellular localization of H- RAS -GFP. In vitro palmitoylation assays performed on membrane fractions from the indicated cell lines. Each bar represents three independent experiments and the error bars are the standard deviation. RT–PCR was performed using 1 μ g of total RNA isolated from the indicated cell lines and primers that recognize both human and murine HIP3
    Figure Legend Snippet: HIP14 siRNA affects in vitro palmitoylation of the FarnCNRas(NBD) peptide and subcellular localization of H- RAS -GFP. In vitro palmitoylation assays performed on membrane fractions from the indicated cell lines. Each bar represents three independent experiments and the error bars are the standard deviation. RT–PCR was performed using 1 μ g of total RNA isolated from the indicated cell lines and primers that recognize both human and murine HIP3

    Techniques Used: In Vitro, Standard Deviation, Reverse Transcription Polymerase Chain Reaction, Isolation

    PAT activity and HIP14 mRNA levels. The in vitro palmitoylation assay performed using wild-type, three RAS -transformed NIH 3t3 cell lines, and three human tumor cell lines. In vitro palmitoylation assays consisted of 10 μ M MyrGCK(NBD) peptide with 2 μ M palmitoyl-CoA or 20 μ M FarnCNRas(NBD) peptide and 4 μ M palmitoyl-CoA, 50 μ g membrane protein, in 100 μ l acylation buffer. The assays were initiated by incubating the peptide substrate with membrane fractions from the indicated cell lines in acylation buffer for 8 min at 37°C with agitation. Palmitoyl-CoA is added to start the reaction and incubation was continued at 37°C for an additional 7.5 min. Palmitoylated peptides were resolved by HPLC using a reverse phase wide pore butyl column. RT–PCR analyses were preformed using 1 μ g of total RNA isolated from the indicated cell lines and primers that recognize both human and mouse HIP14
    Figure Legend Snippet: PAT activity and HIP14 mRNA levels. The in vitro palmitoylation assay performed using wild-type, three RAS -transformed NIH 3t3 cell lines, and three human tumor cell lines. In vitro palmitoylation assays consisted of 10 μ M MyrGCK(NBD) peptide with 2 μ M palmitoyl-CoA or 20 μ M FarnCNRas(NBD) peptide and 4 μ M palmitoyl-CoA, 50 μ g membrane protein, in 100 μ l acylation buffer. The assays were initiated by incubating the peptide substrate with membrane fractions from the indicated cell lines in acylation buffer for 8 min at 37°C with agitation. Palmitoyl-CoA is added to start the reaction and incubation was continued at 37°C for an additional 7.5 min. Palmitoylated peptides were resolved by HPLC using a reverse phase wide pore butyl column. RT–PCR analyses were preformed using 1 μ g of total RNA isolated from the indicated cell lines and primers that recognize both human and mouse HIP14

    Techniques Used: Activity Assay, In Vitro, Transformation Assay, Incubation, High Performance Liquid Chromatography, Reverse Transcription Polymerase Chain Reaction, Isolation

    39) Product Images from "Human and Simian Immunodeficiency Virus-Mediated Upregulation of the Apoptotic Factor TRAIL Occurs in Antigen-Presenting Cells from AIDS-Susceptible but Not from AIDS-Resistant Species ▿Human and Simian Immunodeficiency Virus-Mediated Upregulation of the Apoptotic Factor TRAIL Occurs in Antigen-Presenting Cells from AIDS-Susceptible but Not from AIDS-Resistant Species ▿ †"

    Article Title: Human and Simian Immunodeficiency Virus-Mediated Upregulation of the Apoptotic Factor TRAIL Occurs in Antigen-Presenting Cells from AIDS-Susceptible but Not from AIDS-Resistant Species ▿Human and Simian Immunodeficiency Virus-Mediated Upregulation of the Apoptotic Factor TRAIL Occurs in Antigen-Presenting Cells from AIDS-Susceptible but Not from AIDS-Resistant Species ▿ †

    Journal: Journal of Virology

    doi: 10.1128/JVI.02616-06

    TRAIL expression in macrophages from different primate species after Tat expression or viral infection (HIV Bal or SIV mac316 ). HIV and SIV infection in primate iDC and macrophages. (a) Virus production in infected macrophages measured by p24 (left panel) or p27 (middle panel) ELISA assay. Tat expression detected by real-time RT-PCR in the different cultures (right panel). (b) Changes in TRAIL RNA levels for each species (means ± standard errors [SE]). (c) Levels of sTRAIL measured by ELISA in the supernatant of macrophage cultures (means ± SE). Three independent experiments were carried out with human macrophages and two with macrophages from the other species.
    Figure Legend Snippet: TRAIL expression in macrophages from different primate species after Tat expression or viral infection (HIV Bal or SIV mac316 ). HIV and SIV infection in primate iDC and macrophages. (a) Virus production in infected macrophages measured by p24 (left panel) or p27 (middle panel) ELISA assay. Tat expression detected by real-time RT-PCR in the different cultures (right panel). (b) Changes in TRAIL RNA levels for each species (means ± standard errors [SE]). (c) Levels of sTRAIL measured by ELISA in the supernatant of macrophage cultures (means ± SE). Three independent experiments were carried out with human macrophages and two with macrophages from the other species.

    Techniques Used: Expressing, Infection, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    Expression analysis of selected IFN-inducible genes in different nonhuman primate iDC. (a) RT activity in macrophage supernatants. (b) Tat RNA levels measured by real time RT-PCR. (c) Induction of selected IFN-inducible genes based on RNA levels from human and nonhuman primate iDC after HIV Bal or SIV mac316 infection (day 14) and Tat expression (30 h). Results are reported as the average ( n -fold) induction relative to that of the time zero mock-infected sample. Two samples from two independent donors are reported. A positive control for the real-time RT-PCR in RNAs from each species was provided by an RNA sample from CD14 + cells treated with IFN-α. All detection values are normalized according to the GAPDH internal control. (d) Cytokine detection in primate iDC supernatants after HIV Bal or SIV mac316 infection (means ± standard errors of three independent samples).
    Figure Legend Snippet: Expression analysis of selected IFN-inducible genes in different nonhuman primate iDC. (a) RT activity in macrophage supernatants. (b) Tat RNA levels measured by real time RT-PCR. (c) Induction of selected IFN-inducible genes based on RNA levels from human and nonhuman primate iDC after HIV Bal or SIV mac316 infection (day 14) and Tat expression (30 h). Results are reported as the average ( n -fold) induction relative to that of the time zero mock-infected sample. Two samples from two independent donors are reported. A positive control for the real-time RT-PCR in RNAs from each species was provided by an RNA sample from CD14 + cells treated with IFN-α. All detection values are normalized according to the GAPDH internal control. (d) Cytokine detection in primate iDC supernatants after HIV Bal or SIV mac316 infection (means ± standard errors of three independent samples).

    Techniques Used: Expressing, Activity Assay, Quantitative RT-PCR, Infection, Positive Control

    40) Product Images from ""

    Article Title:

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E06-09-0876

    Expression and localization of calpain 1 and calpain 2 in primary neutrophils. RT-PCR (A) and immunoblotting (B) were used to determine the expression of calpain 1 and calpain 2 in primary neutrophils (PMNs) as described in Materials and Methods . (A) Control RNA from HEK 293 cells was compared with RNA from PMNs and undifferentiated and differentiated HL-60 cells (uHL and dHL) by using gene-specific primers against human calpain 1 (Capn 1) and calpain 2 (Capn 2). GAPDH loading controls indicate equal sample was loaded in each lane. (B) Cell lysates were collected from PMNs, HL-60 cells (uHL and dHL), and HEKs as described in Materials and Methods and probed using isoform-specific antibodies. For Western blot experiments, α-calpain 2 (Triple Point, Abcam) was used for neutrophils (box) and α-calpain 2 (Sigma-Aldrich) was used for HL-60 and HEK cells. Molecular weight markers (M) indicate proper predicted size. (C) Resting and fMLP-treated human neutrophils were plated on coverslips coated with 2.5 μg/ml fibrinogen for 10 min, fixed, stained for calpain 1 (left), costained with rhodamine-phalloidin for F-actin (middle), and overlaid (right). Magnified merged image shows no colocalization (yellow; note arrow) between F-actin (red) and calpain 1 (green). Bar, 10 μm. (D) Resting and fMLP-treated human neutrophils were treated as described in C and stained for calpain 2 (left), F-actin (middle), and overlaid (right). Magnified merged image shows strong colocalization (yellow; note arrow) between F-actin (red) and calpain 2 (green). Bar, 10 μm. (E) C5a-stimulated dHL-60 cells were plated on coverslips coated with 2.5 μg/ml fibrinogen for 10 min, fixed, and stained for endogenous calpain 1 (left) or calpain 2 (right). Arrows show localization of calpain 1 toward the cell rear and calpain 2 at the leading edge. Bar, 5 μm.
    Figure Legend Snippet: Expression and localization of calpain 1 and calpain 2 in primary neutrophils. RT-PCR (A) and immunoblotting (B) were used to determine the expression of calpain 1 and calpain 2 in primary neutrophils (PMNs) as described in Materials and Methods . (A) Control RNA from HEK 293 cells was compared with RNA from PMNs and undifferentiated and differentiated HL-60 cells (uHL and dHL) by using gene-specific primers against human calpain 1 (Capn 1) and calpain 2 (Capn 2). GAPDH loading controls indicate equal sample was loaded in each lane. (B) Cell lysates were collected from PMNs, HL-60 cells (uHL and dHL), and HEKs as described in Materials and Methods and probed using isoform-specific antibodies. For Western blot experiments, α-calpain 2 (Triple Point, Abcam) was used for neutrophils (box) and α-calpain 2 (Sigma-Aldrich) was used for HL-60 and HEK cells. Molecular weight markers (M) indicate proper predicted size. (C) Resting and fMLP-treated human neutrophils were plated on coverslips coated with 2.5 μg/ml fibrinogen for 10 min, fixed, stained for calpain 1 (left), costained with rhodamine-phalloidin for F-actin (middle), and overlaid (right). Magnified merged image shows no colocalization (yellow; note arrow) between F-actin (red) and calpain 1 (green). Bar, 10 μm. (D) Resting and fMLP-treated human neutrophils were treated as described in C and stained for calpain 2 (left), F-actin (middle), and overlaid (right). Magnified merged image shows strong colocalization (yellow; note arrow) between F-actin (red) and calpain 2 (green). Bar, 10 μm. (E) C5a-stimulated dHL-60 cells were plated on coverslips coated with 2.5 μg/ml fibrinogen for 10 min, fixed, and stained for endogenous calpain 1 (left) or calpain 2 (right). Arrows show localization of calpain 1 toward the cell rear and calpain 2 at the leading edge. Bar, 5 μm.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Molecular Weight, Staining

    41) Product Images from "A 205-Nucleotide Deletion in the 3? Untranslated Region of Avian Leukosis Virus Subgroup J, Currently Emergent in China, Contributes to Its Pathogenicity"

    Article Title: A 205-Nucleotide Deletion in the 3? Untranslated Region of Avian Leukosis Virus Subgroup J, Currently Emergent in China, Contributes to Its Pathogenicity

    Journal: Journal of Virology

    doi: 10.1128/JVI.01113-12

    Deletion of 205 nucleotides in the 3′UTR contributed to the unspliced RNA export in the vascular endothelial cells. (A) The subgenomic vector (sub-rHLJ09SH01) construct. ALV-J gag-pol genes were cloned into the vector pcDNA 3.1 containing a 3′UTR with the 205-nucleotide deletion. The spliced donors (SD) and splice acceptors (SA) are indicated. (B) The subgenomic vector (sub-rHLJ09SH01A205) construct was similar to sub-rHLJ09SH01, except for the 3′UTR (sub-rHLJ09SH01A205 contained the 205 nucleotides in this region). (C) The unspliced cytoplasmic RNA was quantified using quantitative RT-PCR with primers F and R and probe P. The level of β-actin RNA was used for normalization. (D) The 205-nucleotide deletion in sub-rHLJ09SH01 increased the expression of p27 protein. Lysates from vascular endothelial cells transfected with sub-rHLJ09SH01 (lane 1) or sub-rHLJ09SH01A205 (lane 2) were incubated with mouse anti-p27 antiserum, anti-β-actin antiserum.
    Figure Legend Snippet: Deletion of 205 nucleotides in the 3′UTR contributed to the unspliced RNA export in the vascular endothelial cells. (A) The subgenomic vector (sub-rHLJ09SH01) construct. ALV-J gag-pol genes were cloned into the vector pcDNA 3.1 containing a 3′UTR with the 205-nucleotide deletion. The spliced donors (SD) and splice acceptors (SA) are indicated. (B) The subgenomic vector (sub-rHLJ09SH01A205) construct was similar to sub-rHLJ09SH01, except for the 3′UTR (sub-rHLJ09SH01A205 contained the 205 nucleotides in this region). (C) The unspliced cytoplasmic RNA was quantified using quantitative RT-PCR with primers F and R and probe P. The level of β-actin RNA was used for normalization. (D) The 205-nucleotide deletion in sub-rHLJ09SH01 increased the expression of p27 protein. Lysates from vascular endothelial cells transfected with sub-rHLJ09SH01 (lane 1) or sub-rHLJ09SH01A205 (lane 2) were incubated with mouse anti-p27 antiserum, anti-β-actin antiserum.

    Techniques Used: Plasmid Preparation, Construct, Clone Assay, Quantitative RT-PCR, Expressing, Transfection, Incubation

    42) Product Images from "Identification of HDAC10, a novel class II human histone deacetylase containing a leucine-rich domain"

    Article Title: Identification of HDAC10, a novel class II human histone deacetylase containing a leucine-rich domain

    Journal: Nucleic Acids Research

    doi:

    Expression of HDAC10. ( A ) Expression of HDAC10 in adult human tissues. Poly(A) RNA blots (Clontech; 2 µg/lane) were probed with a HDAC10 cDNA fragment corresponding to its putative deacetylase domain (top). As a loading control, the same blots were re-probed with a β-actin cDNA probe (bottom). Note the presence of 3 and 3.5 kb transcripts in most tissues and of a 1.3 kb species in placenta (lane 3, top). Molecular size markers are shown at left. ( B ) Expression of HDAC10 in cultured mammalian cells. Total cell extracts (10 µg/lane) were separated on SDS–polyacrylamide gels, electro-transferred to nitrocellulose and probed with anti-HDAC10 antibody raised against the C-terminal domain (top). As a loading control, the same blots were analyzed with anti-α-actin antibody (Roche) (bottom). ( C ) RT–PCR analysis of total RNA from 293 and HeLa cells. Primers DAC70 and DAC84 amplify the coding sequences for the C-terminal regions of HDAC10 and the 658 residue isoform as 487 and 568 bp fragments, respectively. Lane 1, 100 bp ladder (Gibco BRL); lane 2, amplification reaction of total RNA from 293 cells with only one primer.
    Figure Legend Snippet: Expression of HDAC10. ( A ) Expression of HDAC10 in adult human tissues. Poly(A) RNA blots (Clontech; 2 µg/lane) were probed with a HDAC10 cDNA fragment corresponding to its putative deacetylase domain (top). As a loading control, the same blots were re-probed with a β-actin cDNA probe (bottom). Note the presence of 3 and 3.5 kb transcripts in most tissues and of a 1.3 kb species in placenta (lane 3, top). Molecular size markers are shown at left. ( B ) Expression of HDAC10 in cultured mammalian cells. Total cell extracts (10 µg/lane) were separated on SDS–polyacrylamide gels, electro-transferred to nitrocellulose and probed with anti-HDAC10 antibody raised against the C-terminal domain (top). As a loading control, the same blots were analyzed with anti-α-actin antibody (Roche) (bottom). ( C ) RT–PCR analysis of total RNA from 293 and HeLa cells. Primers DAC70 and DAC84 amplify the coding sequences for the C-terminal regions of HDAC10 and the 658 residue isoform as 487 and 568 bp fragments, respectively. Lane 1, 100 bp ladder (Gibco BRL); lane 2, amplification reaction of total RNA from 293 cells with only one primer.

    Techniques Used: Expressing, Histone Deacetylase Assay, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Amplification

    43) Product Images from "GRK2 is an endogenous protein inhibitor of the insulin signaling pathway for glucose transport stimulation"

    Article Title: GRK2 is an endogenous protein inhibitor of the insulin signaling pathway for glucose transport stimulation

    Journal: The EMBO Journal

    doi: 10.1038/sj.emboj.7600297

    Effects of GRK2 on insulin-stimulated GLUT4 translocation and 2-DOG uptake in 3T3-L1 adipocytes. ( A, D, E ) For microinjection assay, 3T3-L1 adipocytes on coverslips were serum starved for 4 h, and anti-GRK2 antibody, anti-GRK5 antibody, anti-GRK6 antibody, sheep IgG, GRK2 siRNA, or control siRNA was microinjected. For GRK2 overexpression assay, 3T3-L1 adipocytes on coverslips were infected with adenovirus expressing WT-GRK2, KD-GRK2, or control LacZ. At 48 h after infection, these cells were serum starved for 4 h. Cells were stimulated with 0.02, 0.2, or 1.7 nM insulin for 20 min. GLUT4 was stained as described in Materials and methods. The percentage of cells positive for GLUT4 translocation was calculated by counting at least 100 cells at each point. The data are the mean±s.e. from three independent experiments. ( B ) SiRNA of GRK2 (+) or control siRNA (−) was transfected in 3T3-L1 preadipocytes using Oligofectamine as described in Materials and methods. At the indicated days after transfection, total cell lysates were prepared and analyzed by Western blotting using anti-GRK2 antibody as described in Materials and methods. Representative blots are shown from two independent experiments. ( C ) The efficiency of siRNA under the microinjection into 3T3-L1 adipocytes was confirmed by the mRNA quantification as described in Materials and methods. All of 3T3-L1 adipocytes on coverslips (approximately 200 cells spotted on each coverslip) were microinjected with GRK2 or scrambled control (scramble) siRNA. At 48 h after microinjection, total RNA was purified and used for RT–PCR reaction with the GRK2 or PP2A (Cont.) primer set. A representative image from two independent experiments is shown. S: size marker. ( F ) 3T3-L1 adipocytes were infected with adenovirus expressing WT-GRK2, KD-GRK2, or control LacZ (Control). At 48 h after infection, these cells were serum starved for 3 h, stimulated with17 nM insulin for 30 min, and [ 3 H]2-DOG uptake was measured as described in Materials and methods. The data are the mean±s.e. from three independent experiments. Statistically significant differences versus control are indicated ( * P
    Figure Legend Snippet: Effects of GRK2 on insulin-stimulated GLUT4 translocation and 2-DOG uptake in 3T3-L1 adipocytes. ( A, D, E ) For microinjection assay, 3T3-L1 adipocytes on coverslips were serum starved for 4 h, and anti-GRK2 antibody, anti-GRK5 antibody, anti-GRK6 antibody, sheep IgG, GRK2 siRNA, or control siRNA was microinjected. For GRK2 overexpression assay, 3T3-L1 adipocytes on coverslips were infected with adenovirus expressing WT-GRK2, KD-GRK2, or control LacZ. At 48 h after infection, these cells were serum starved for 4 h. Cells were stimulated with 0.02, 0.2, or 1.7 nM insulin for 20 min. GLUT4 was stained as described in Materials and methods. The percentage of cells positive for GLUT4 translocation was calculated by counting at least 100 cells at each point. The data are the mean±s.e. from three independent experiments. ( B ) SiRNA of GRK2 (+) or control siRNA (−) was transfected in 3T3-L1 preadipocytes using Oligofectamine as described in Materials and methods. At the indicated days after transfection, total cell lysates were prepared and analyzed by Western blotting using anti-GRK2 antibody as described in Materials and methods. Representative blots are shown from two independent experiments. ( C ) The efficiency of siRNA under the microinjection into 3T3-L1 adipocytes was confirmed by the mRNA quantification as described in Materials and methods. All of 3T3-L1 adipocytes on coverslips (approximately 200 cells spotted on each coverslip) were microinjected with GRK2 or scrambled control (scramble) siRNA. At 48 h after microinjection, total RNA was purified and used for RT–PCR reaction with the GRK2 or PP2A (Cont.) primer set. A representative image from two independent experiments is shown. S: size marker. ( F ) 3T3-L1 adipocytes were infected with adenovirus expressing WT-GRK2, KD-GRK2, or control LacZ (Control). At 48 h after infection, these cells were serum starved for 3 h, stimulated with17 nM insulin for 30 min, and [ 3 H]2-DOG uptake was measured as described in Materials and methods. The data are the mean±s.e. from three independent experiments. Statistically significant differences versus control are indicated ( * P

    Techniques Used: Translocation Assay, Over Expression, Infection, Expressing, Staining, Transfection, Western Blot, Purification, Reverse Transcription Polymerase Chain Reaction, Marker

    44) Product Images from "The sld Genetic Defect"

    Article Title: The sld Genetic Defect

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.468645

    Comparisons of 3′-end processing of Muc19 transcripts between WT and sld mutant mice. A , polyadenylation site utilization between WT and sld mice at 3 days and 8 weeks of age by 3′-RLM RACE. PCR of ligated cDNA produced two products that differ by ∼100 bp, indicating that both polyadenylation sites are utilized by both strains of mice. The transcript levels in sld neonates are too low for detection. B , RACE-PAT to compare poly(A) tail length of Muc19 transcripts. Sublingual total RNA from four WT and three sld glands from mice at 8 weeks of age was reverse transcribed with a 44-bp primer/adapter containing 11 thymines at the 3′-end. Subsequent PCR of the cDNA incorporated a Muc19 -specific forward primer 103 bp 5′ to the first polyadenylation site and a reverse primer to the 5′-end of the primer/adapter. The prominent band at ∼300 bp suggests that the downstream polyadenylation site is utilized more extensively.
    Figure Legend Snippet: Comparisons of 3′-end processing of Muc19 transcripts between WT and sld mutant mice. A , polyadenylation site utilization between WT and sld mice at 3 days and 8 weeks of age by 3′-RLM RACE. PCR of ligated cDNA produced two products that differ by ∼100 bp, indicating that both polyadenylation sites are utilized by both strains of mice. The transcript levels in sld neonates are too low for detection. B , RACE-PAT to compare poly(A) tail length of Muc19 transcripts. Sublingual total RNA from four WT and three sld glands from mice at 8 weeks of age was reverse transcribed with a 44-bp primer/adapter containing 11 thymines at the 3′-end. Subsequent PCR of the cDNA incorporated a Muc19 -specific forward primer 103 bp 5′ to the first polyadenylation site and a reverse primer to the 5′-end of the primer/adapter. The prominent band at ∼300 bp suggests that the downstream polyadenylation site is utilized more extensively.

    Techniques Used: Mutagenesis, Mouse Assay, Polymerase Chain Reaction, Produced

    Interrogation of aberrant splicing of sublingual gland Muc19 mRNA caused by intron 18 or intron 53 mutations. A , shown is the sequence variation in intron 18 between WT and sld mutant mice. Underneath is a map of the genomic sequence with positions of the sequence variation ( X ) of forward ( F ) and reverse ( R ) primers and the length of intervening introns. PCR of two separate preparations of cDNA from each mouse strain detected only correctly spliced products. β-Actin loading controls shown below. The maps are not drawn to scale. B , primer-specific detection of correctly and aberrantly spliced transcripts in WT and sld cDNAs from 3-day-old and 8-week-old mice. Shown are the positions of transcript-specific forward ( F ) and reverse ( R ) primers. Below are PCR results using glandular cDNA from each strain of mice, as well as RNA negative controls and β-actin loading controls. The maps are not drawn to scale. C , annotated sequence of the 3′-end of mutant Muc19 mRNA starting from exon 53. Exons are labeled and demarcated by lines with arrows . Intron 54 is in italics , and the splice sites and branch site sequence are labeled. *, putative branch point. The predicted translation sequence is given below the message sequence, with stars indicating stop codons.
    Figure Legend Snippet: Interrogation of aberrant splicing of sublingual gland Muc19 mRNA caused by intron 18 or intron 53 mutations. A , shown is the sequence variation in intron 18 between WT and sld mutant mice. Underneath is a map of the genomic sequence with positions of the sequence variation ( X ) of forward ( F ) and reverse ( R ) primers and the length of intervening introns. PCR of two separate preparations of cDNA from each mouse strain detected only correctly spliced products. β-Actin loading controls shown below. The maps are not drawn to scale. B , primer-specific detection of correctly and aberrantly spliced transcripts in WT and sld cDNAs from 3-day-old and 8-week-old mice. Shown are the positions of transcript-specific forward ( F ) and reverse ( R ) primers. Below are PCR results using glandular cDNA from each strain of mice, as well as RNA negative controls and β-actin loading controls. The maps are not drawn to scale. C , annotated sequence of the 3′-end of mutant Muc19 mRNA starting from exon 53. Exons are labeled and demarcated by lines with arrows . Intron 54 is in italics , and the splice sites and branch site sequence are labeled. *, putative branch point. The predicted translation sequence is given below the message sequence, with stars indicating stop codons.

    Techniques Used: Sequencing, Mutagenesis, Mouse Assay, Polymerase Chain Reaction, Labeling

    Map of genomic sequencing strategy, resultant sequence variations and minigene splicing assays of the 3′-end mutations. A , genomic sequencing of Muc19/Smgc incorporated either cloned PCR products ( black numbered boxes ) or PCR products ( gray numbered boxes ). See “Experimental Procedures” for details. Three insertion mutations in introns 18, 53, and 57 are indicated by gray arrows . Because we were unable to sequence through TA repeats within intron 52, we label this region as a potential mutation site with unknown TA repeats. The central region of exon 50 is intractable to both cloning and sequencing because its central region contains ∼36 tandem repeats of 489 bp that encode Ser/Thr-rich sequences. B–D , minigene splicing assays of the 3′-end mutations. In each panel is shown the sequence variation between WT and sld mutant mice. Underneath is a map of the genomic sequence inserted into each minigene, along with positions of each sequence variation ( X ) and of forward ( F ) and reverse ( R ) primers used in subsequent PCRs of cDNA isolated from transfected Hepa 1–6 cells. Below each genomic map are analogous maps of correctly spliced products and of potential aberrantly spliced products. At the bottom of each panel are assay results, representative of at least two separate experiments with neo loading controls, an empty vector control ( E ) and a positive control ( P ) using DNA from the appropriate minigene. B and C , cells transfected with minigene DNA containing either intron 52 or 57 from each mouse genotype produced only a single PCR product representing the correctly spliced RNA. D , three preparations of cells transfected with 2 μg of minigene DNA from each genotype containing intron 53 displayed two products: the 112-bp correctly spliced product and a 198-bp aberrant product containing intron 54. The unmarked lanes show molecular size markers. The maps are not drawn to scale.
    Figure Legend Snippet: Map of genomic sequencing strategy, resultant sequence variations and minigene splicing assays of the 3′-end mutations. A , genomic sequencing of Muc19/Smgc incorporated either cloned PCR products ( black numbered boxes ) or PCR products ( gray numbered boxes ). See “Experimental Procedures” for details. Three insertion mutations in introns 18, 53, and 57 are indicated by gray arrows . Because we were unable to sequence through TA repeats within intron 52, we label this region as a potential mutation site with unknown TA repeats. The central region of exon 50 is intractable to both cloning and sequencing because its central region contains ∼36 tandem repeats of 489 bp that encode Ser/Thr-rich sequences. B–D , minigene splicing assays of the 3′-end mutations. In each panel is shown the sequence variation between WT and sld mutant mice. Underneath is a map of the genomic sequence inserted into each minigene, along with positions of each sequence variation ( X ) and of forward ( F ) and reverse ( R ) primers used in subsequent PCRs of cDNA isolated from transfected Hepa 1–6 cells. Below each genomic map are analogous maps of correctly spliced products and of potential aberrantly spliced products. At the bottom of each panel are assay results, representative of at least two separate experiments with neo loading controls, an empty vector control ( E ) and a positive control ( P ) using DNA from the appropriate minigene. B and C , cells transfected with minigene DNA containing either intron 52 or 57 from each mouse genotype produced only a single PCR product representing the correctly spliced RNA. D , three preparations of cells transfected with 2 μg of minigene DNA from each genotype containing intron 53 displayed two products: the 112-bp correctly spliced product and a 198-bp aberrant product containing intron 54. The unmarked lanes show molecular size markers. The maps are not drawn to scale.

    Techniques Used: Genomic Sequencing, Sequencing, Clone Assay, Polymerase Chain Reaction, Mutagenesis, Mouse Assay, Isolation, Transfection, Plasmid Preparation, Positive Control, Produced

    45) Product Images from "DNA Microarray for Detection of Gastrointestinal Viruses"

    Article Title: DNA Microarray for Detection of Gastrointestinal Viruses

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.01317-14

    Identification of rotavirus group A. A group of 76 gastroenteritis samples was analyzed by three methods for the presence of rotavirus. These were visualization of rotavirus dsRNA by SDS-PAGE, RT-PCR, and the microarray designed in this work. The circles
    Figure Legend Snippet: Identification of rotavirus group A. A group of 76 gastroenteritis samples was analyzed by three methods for the presence of rotavirus. These were visualization of rotavirus dsRNA by SDS-PAGE, RT-PCR, and the microarray designed in this work. The circles

    Techniques Used: SDS Page, Reverse Transcription Polymerase Chain Reaction, Microarray

    46) Product Images from "Gene Expression Profiles are Altered in Human Papillomavirus-16 E6 D25E-Expressing Cell Lines"

    Article Title: Gene Expression Profiles are Altered in Human Papillomavirus-16 E6 D25E-Expressing Cell Lines

    Journal: Virology Journal

    doi: 10.1186/1743-422X-8-453

    Confirmation of HPV-16 E6 oncogenes expression and effects on the transcription of endogenous survivin gene in C33A cell lines with e6 oncogenes . A . Quantification of mRNA of wild-type E6 and E6 D25E in C33A cells by RT-PCR performed using OneStep RT-PCR kits. GAPDH mRNA was measured as a loading control. B . Protein expression analysis of wild-type E6 or E6 D25E using confocal microscopy. Caski cells were used as a positive control. C . Quantative real-time PCR specific for survivin gene.
    Figure Legend Snippet: Confirmation of HPV-16 E6 oncogenes expression and effects on the transcription of endogenous survivin gene in C33A cell lines with e6 oncogenes . A . Quantification of mRNA of wild-type E6 and E6 D25E in C33A cells by RT-PCR performed using OneStep RT-PCR kits. GAPDH mRNA was measured as a loading control. B . Protein expression analysis of wild-type E6 or E6 D25E using confocal microscopy. Caski cells were used as a positive control. C . Quantative real-time PCR specific for survivin gene.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Confocal Microscopy, Positive Control, Real-time Polymerase Chain Reaction

    47) Product Images from "Analysis of Xyloglucan Fucosylation in Arabidopsis 1"

    Article Title: Analysis of Xyloglucan Fucosylation in Arabidopsis 1

    Journal: Plant Physiology

    doi: 10.1104/pp.102.016642

    Expression of AtFUT1 analyzed by RT-PCR. RNA isolated from Arabidopsis tissues and used for RT reactions primed with oligo(dT). An equal volume of the RT reactions was used for PCR with primers specific for either AtFUT1 (top) or cytochrome c as a standard gene control (bottom). PCR was performed for 24 (AtFUT1) or 28 (cytochrome c ) cycles. A representative gel is shown from two technical replicates each of two independent biological replicates.
    Figure Legend Snippet: Expression of AtFUT1 analyzed by RT-PCR. RNA isolated from Arabidopsis tissues and used for RT reactions primed with oligo(dT). An equal volume of the RT reactions was used for PCR with primers specific for either AtFUT1 (top) or cytochrome c as a standard gene control (bottom). PCR was performed for 24 (AtFUT1) or 28 (cytochrome c ) cycles. A representative gel is shown from two technical replicates each of two independent biological replicates.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction

    48) Product Images from "Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1"

    Article Title: Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1

    Journal: Archaea

    doi:

    Transcriptional analysis of the M. mazei nif gene cluster. (A) Northern blot analysis of total RNA isolated from M. mazei cells grown under conditions of nitrogen limitation (N 2 ) and nitrogen sufficiency ( NH 4 + ) using probes for nifH , nifK and nifN . Each lane was loaded with 0.25 µg total RNA from cells grown under nitrogen limitation (-) or nitrogen sufficiency (+); numbers on the left are molecular sizes in kilobases. (B) RT-PCR analysis. Reverse transcription was carried out on 0.1 µg RNA isolated from cells grown under conditions of nitrogen limitation (-) or nitrogen sufficiency (+) using the OneStep RT-PCR Kit from Qiagen and primers as described in Materials and methods. Control PCR reactions with RNA in the absence of reverse transcriptase showed that the isolated RNA preparations were free of genomic DNA. As a control, a 16S rDNA-specific RT-PCR was carried out on 10 ng of RNA from cells from each growth condition. Products of the expected size (450 bp ( nifH ), 417 bp ( nifK ), 438 bp ( nifN ), 415 bp ( glnK 1 ) and 420 bp (16S rDNA)) were separated in 1.5% agarose gels and visualized by ethidium bromide staining.
    Figure Legend Snippet: Transcriptional analysis of the M. mazei nif gene cluster. (A) Northern blot analysis of total RNA isolated from M. mazei cells grown under conditions of nitrogen limitation (N 2 ) and nitrogen sufficiency ( NH 4 + ) using probes for nifH , nifK and nifN . Each lane was loaded with 0.25 µg total RNA from cells grown under nitrogen limitation (-) or nitrogen sufficiency (+); numbers on the left are molecular sizes in kilobases. (B) RT-PCR analysis. Reverse transcription was carried out on 0.1 µg RNA isolated from cells grown under conditions of nitrogen limitation (-) or nitrogen sufficiency (+) using the OneStep RT-PCR Kit from Qiagen and primers as described in Materials and methods. Control PCR reactions with RNA in the absence of reverse transcriptase showed that the isolated RNA preparations were free of genomic DNA. As a control, a 16S rDNA-specific RT-PCR was carried out on 10 ng of RNA from cells from each growth condition. Products of the expected size (450 bp ( nifH ), 417 bp ( nifK ), 438 bp ( nifN ), 415 bp ( glnK 1 ) and 420 bp (16S rDNA)) were separated in 1.5% agarose gels and visualized by ethidium bromide staining.

    Techniques Used: Northern Blot, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Staining

    49) Product Images from "Expression of an Innate Immune Element (Mouse Hepcidin-1) in Baculovirus Expression System and the Comparison of Its Function with Synthetic Human Hepcidin-25"

    Article Title: Expression of an Innate Immune Element (Mouse Hepcidin-1) in Baculovirus Expression System and the Comparison of Its Function with Synthetic Human Hepcidin-25

    Journal: Iranian Journal of Pharmaceutical Research : IJPR

    doi:

    PCR product of hepcidin cDNA in 1% agarose gel electrophoresis. Lane M is the molecular marker (GeneRuler™ 50 bp DNA Ladder). Lane 1 is the effect of ALU-1 restriction enzyme on PCR product confirming it as a hepcidin cDNA. Lane 2 is PCR product with 260 bp weight expected for hepcidin cDNA
    Figure Legend Snippet: PCR product of hepcidin cDNA in 1% agarose gel electrophoresis. Lane M is the molecular marker (GeneRuler™ 50 bp DNA Ladder). Lane 1 is the effect of ALU-1 restriction enzyme on PCR product confirming it as a hepcidin cDNA. Lane 2 is PCR product with 260 bp weight expected for hepcidin cDNA

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

    50) Product Images from "LoxP-FRT Trap (LOFT): a simple and flexible system for conventional and reversible gene targeting"

    Article Title: LoxP-FRT Trap (LOFT): a simple and flexible system for conventional and reversible gene targeting

    Journal: BMC Biology

    doi: 10.1186/1741-7007-10-96

    Behaviors of Baf57 Int and Baf57 ΔR . ( A ) Western blot examining Brg/Brahma-associated factor (BAF)57 expression in total thymocytes (lanes 1 to 5, and lane 10) and purified CD4 cells (lanes 6 to 9). Samples in lanes 8 to 10 were from mice exposed to TAM. The genotype of the mice are indicated, where F, ΔR and Flp denote Baf57 F , Baf57 ΔR and R26 FlpoER1 , respectively. The bracket at the left indicates the three BAF57 mutant proteins expressed from Baf57 F after deletion of floxed sequence. At least three mice of each genotype were analyzed. Shown is a representative experiment. ( B ) Reverse transcriptase (RT)-PCR examining BAF57 transcripts in CD4 cells expressed by the wild-type (WT) allele (lanes 1 and 3) or the mutant allele lacking exons 2 and 3 (lanes 2 and 4); the cells were isolated from Baf57 +/ΔR ; CD4-Cre; R26 FlpoER1 and Baf57 F/ΔR ; CD4-Cre; R26 FlpoER1 mice, respectively. RT-PCR primers targeted exons 1 and 7 (lanes 1 and 2) or 1 and 5 (lanes 3 and 4). The latter primer set yielded amplicons A to C (lanes 3 and 4, diagrammed at the bottom), which were re- amplified with a nested primer set, gel-purified, and digested with Eco N1 to verify their identities (lanes 5 to 10). There was also a nonspecific amplicon (about 310 bp, lane 3) which was not re-amplifiable (not shown). Two mice of each genotype were analyzed. Shown is a representative experiment. ( C ). Flow cytometric assays monitoring green fluorescent protein (GFP) expression in peripheral blood CD4, CD8 and B cells at various times after tamoxifen (TAM) injection. Three mice of each genotype were analyzed. ( D ) Summary of the reversion efficiencies at day 10 in CD4, CD8, and B cells, as measured by the fraction of cells that had lost GFP. Each symbol represents an individual mouse.
    Figure Legend Snippet: Behaviors of Baf57 Int and Baf57 ΔR . ( A ) Western blot examining Brg/Brahma-associated factor (BAF)57 expression in total thymocytes (lanes 1 to 5, and lane 10) and purified CD4 cells (lanes 6 to 9). Samples in lanes 8 to 10 were from mice exposed to TAM. The genotype of the mice are indicated, where F, ΔR and Flp denote Baf57 F , Baf57 ΔR and R26 FlpoER1 , respectively. The bracket at the left indicates the three BAF57 mutant proteins expressed from Baf57 F after deletion of floxed sequence. At least three mice of each genotype were analyzed. Shown is a representative experiment. ( B ) Reverse transcriptase (RT)-PCR examining BAF57 transcripts in CD4 cells expressed by the wild-type (WT) allele (lanes 1 and 3) or the mutant allele lacking exons 2 and 3 (lanes 2 and 4); the cells were isolated from Baf57 +/ΔR ; CD4-Cre; R26 FlpoER1 and Baf57 F/ΔR ; CD4-Cre; R26 FlpoER1 mice, respectively. RT-PCR primers targeted exons 1 and 7 (lanes 1 and 2) or 1 and 5 (lanes 3 and 4). The latter primer set yielded amplicons A to C (lanes 3 and 4, diagrammed at the bottom), which were re- amplified with a nested primer set, gel-purified, and digested with Eco N1 to verify their identities (lanes 5 to 10). There was also a nonspecific amplicon (about 310 bp, lane 3) which was not re-amplifiable (not shown). Two mice of each genotype were analyzed. Shown is a representative experiment. ( C ). Flow cytometric assays monitoring green fluorescent protein (GFP) expression in peripheral blood CD4, CD8 and B cells at various times after tamoxifen (TAM) injection. Three mice of each genotype were analyzed. ( D ) Summary of the reversion efficiencies at day 10 in CD4, CD8, and B cells, as measured by the fraction of cells that had lost GFP. Each symbol represents an individual mouse.

    Techniques Used: Western Blot, Expressing, Purification, Mouse Assay, Mutagenesis, Sequencing, Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Flow Cytometry, Injection

    51) Product Images from "Activation of Akt is increased in the dysplasia-carcinoma sequence in Barrett's oesophagus and contributes to increased proliferation and inhibition of apoptosis: a histopathological and functional study"

    Article Title: Activation of Akt is increased in the dysplasia-carcinoma sequence in Barrett's oesophagus and contributes to increased proliferation and inhibition of apoptosis: a histopathological and functional study

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-7-97

    Functional leptin receptor expression by OE33 cells . Expression of the long (Ob-Rb), short (Ob-Ra) and common sequence leptin receptors was detected by RT-PCR using specific primers ( 3a ). Surface expression of Ob-R was detected using immunocytochemistry with an anti-Ob-R antibody, primary antibody binding was recognised using a donkey-FITC conjugated ant-rabbit antibody and fluorescence microscopy ( 3b top panel ). No staining was detected in the absence of anti-Ob-R antibody ( 3b bottom panel ) (× 63 magnification). Leptin increased cell numbers in OE33 cells ( 3c): serum-starved OE33 cells were treated with increasing concentrations of leptin and relative cell numbers assessed after 24 hours using the MTT colourmetric assay, results expressed as mean ± SEM, N = 3, * P
    Figure Legend Snippet: Functional leptin receptor expression by OE33 cells . Expression of the long (Ob-Rb), short (Ob-Ra) and common sequence leptin receptors was detected by RT-PCR using specific primers ( 3a ). Surface expression of Ob-R was detected using immunocytochemistry with an anti-Ob-R antibody, primary antibody binding was recognised using a donkey-FITC conjugated ant-rabbit antibody and fluorescence microscopy ( 3b top panel ). No staining was detected in the absence of anti-Ob-R antibody ( 3b bottom panel ) (× 63 magnification). Leptin increased cell numbers in OE33 cells ( 3c): serum-starved OE33 cells were treated with increasing concentrations of leptin and relative cell numbers assessed after 24 hours using the MTT colourmetric assay, results expressed as mean ± SEM, N = 3, * P

    Techniques Used: Functional Assay, Expressing, Sequencing, Reverse Transcription Polymerase Chain Reaction, Immunocytochemistry, Binding Assay, Fluorescence, Microscopy, Staining, MTT Assay

    52) Product Images from "Inactive X chromosome-specific histone H3 modifications and CpG hypomethylation flank a chromatin boundary between an X-inactivated and an escape gene"

    Article Title: Inactive X chromosome-specific histone H3 modifications and CpG hypomethylation flank a chromatin boundary between an X-inactivated and an escape gene

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp860

    Histone modification profiles in the ∼12 kb region encompassing RBM10 exon 20 to UBA1 exon 2. ChIP was performed using antibodies against different modifications on histone H3K4, H3K9, H3K27 and H4K20. The enrichment of each region in immunoprecipitates was evaluated using real-time PCR and expressed as the percentage to the input (%IP). The mean values of three independent ChIP experiments are plotted with the standard deviations. ( A ) Schematic representation of the locus in HX (harboring Xa) and CF (harboring Xi). ( B ) ChIP with histone H3K4me1, me2, me2+3 and H3K9ac. ( C ) ChIP with histone H3K9me1, me2 and me3. ( D ) ChIP with histone H3K27me3 and H4K20me3.
    Figure Legend Snippet: Histone modification profiles in the ∼12 kb region encompassing RBM10 exon 20 to UBA1 exon 2. ChIP was performed using antibodies against different modifications on histone H3K4, H3K9, H3K27 and H4K20. The enrichment of each region in immunoprecipitates was evaluated using real-time PCR and expressed as the percentage to the input (%IP). The mean values of three independent ChIP experiments are plotted with the standard deviations. ( A ) Schematic representation of the locus in HX (harboring Xa) and CF (harboring Xi). ( B ) ChIP with histone H3K4me1, me2, me2+3 and H3K9ac. ( C ) ChIP with histone H3K9me1, me2 and me3. ( D ) ChIP with histone H3K27me3 and H4K20me3.

    Techniques Used: Modification, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    The status of human X chromosomes in the human–mouse hybrid cell lines. ( A ) Schematic human X-chromosome map with the inactivated and escape genes examined in this study. ( B ) Quantitative RT–PCR analysis of human X-linked genes in different cell lines. Total RNA was prepared from A9 (parental mouse cell line for HX and CF: without human X), HX (mouse line harboring active human X), CF (mouse line harboring inactive human X), MRC5 (46, XY; male diploid human cells harboring active X) and WI38 (46, XX; female diploid human cells harboring active and inactive Xs). The levels of transcripts were analyzed using real-time PCR, and expressed as relative amounts to human TBP (for MRC5 and WI38) or mouse Tbp (for A9, HX and CF). ( C ) Representative X chromosome banding patterns. After the incubation with BrdU for 6 h to label late replicating DNA, cells were treated with colcemid for chromosome spreading and R-banding. A typical human active X chromosome is observed in HX cell spread (left panel; arrowhead). In CF cell spread, human inactive X chromosome shows homogenous dimmer staining (right panel; arrow).
    Figure Legend Snippet: The status of human X chromosomes in the human–mouse hybrid cell lines. ( A ) Schematic human X-chromosome map with the inactivated and escape genes examined in this study. ( B ) Quantitative RT–PCR analysis of human X-linked genes in different cell lines. Total RNA was prepared from A9 (parental mouse cell line for HX and CF: without human X), HX (mouse line harboring active human X), CF (mouse line harboring inactive human X), MRC5 (46, XY; male diploid human cells harboring active X) and WI38 (46, XX; female diploid human cells harboring active and inactive Xs). The levels of transcripts were analyzed using real-time PCR, and expressed as relative amounts to human TBP (for MRC5 and WI38) or mouse Tbp (for A9, HX and CF). ( C ) Representative X chromosome banding patterns. After the incubation with BrdU for 6 h to label late replicating DNA, cells were treated with colcemid for chromosome spreading and R-banding. A typical human active X chromosome is observed in HX cell spread (left panel; arrowhead). In CF cell spread, human inactive X chromosome shows homogenous dimmer staining (right panel; arrow).

    Techniques Used: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Incubation, Staining

    The presence of transcripts and RNA polymerase II on RBM10 - UBA1 region. ( A ) Schematic representation of the locus in HX (harboring Xa) and CF (harboring Xi). ( B ) Relative amounts of sense and antisense transcripts measured by quantitative RT-PCR. ( C ) RNA polymerase II association. ChIP was performed using antibodies directed against Rpb8 (a shared subunit of RNA polymerase I, II and III; B8), unphosphorylated form of Pol II (8WG), and Ser5-phosphorylated form of Pol II (H14). The enrichment is expressed as the percentage to the input (%IP); the mean values from three independent experiments are plotted with the standard deviations.
    Figure Legend Snippet: The presence of transcripts and RNA polymerase II on RBM10 - UBA1 region. ( A ) Schematic representation of the locus in HX (harboring Xa) and CF (harboring Xi). ( B ) Relative amounts of sense and antisense transcripts measured by quantitative RT-PCR. ( C ) RNA polymerase II association. ChIP was performed using antibodies directed against Rpb8 (a shared subunit of RNA polymerase I, II and III; B8), unphosphorylated form of Pol II (8WG), and Ser5-phosphorylated form of Pol II (H14). The enrichment is expressed as the percentage to the input (%IP); the mean values from three independent experiments are plotted with the standard deviations.

    Techniques Used: Quantitative RT-PCR, Chromatin Immunoprecipitation

    53) Product Images from "Duplication and Evolution of devA-Like Genes in Streptomyces Has Resulted in Distinct Developmental Roles"

    Article Title: Duplication and Evolution of devA-Like Genes in Streptomyces Has Resulted in Distinct Developmental Roles

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0025049

    Transcriptional analysis of devA devE . RT-PCR of devA and devE during development of S. coelicolor M600 on MS medium. The time points at which mycelium were harvested for RNA and the developmental stage of the culture, as judged by microscopic examination, are shown above.
    Figure Legend Snippet: Transcriptional analysis of devA devE . RT-PCR of devA and devE during development of S. coelicolor M600 on MS medium. The time points at which mycelium were harvested for RNA and the developmental stage of the culture, as judged by microscopic examination, are shown above.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mass Spectrometry

    54) Product Images from "Six newly sequenced chloroplast genomes from prasinophyte green algae provide insights into the relationships among prasinophyte lineages and the diversity of streamlined genome architecture in picoplanktonic species"

    Article Title: Six newly sequenced chloroplast genomes from prasinophyte green algae provide insights into the relationships among prasinophyte lineages and the diversity of streamlined genome architecture in picoplanktonic species

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-857

    Analysis of the trans -spliced group II intron in Picocystis ycf3 . (A) Potential intron secondary structure modeled according to Michel et al. (1989) [ 66 ]. Exon sequences are shown in lowercase letters. Roman numbers specify the six major structural domains. Tertiary interactions are denoted by dashed lines, arrows, or Greek letterings. EBS and IBS are exon-binding and intron-binding sites, respectively. The asterisk indicates the site of lariat formation. Note that the precise position of the breakpoint within domain IV is unknown. (B) Confirmation of intron trans -splicing by RT-PCR analysis. The diagrams on the left display the genomic configuration of the Picocystis ycf3 exons (solid color), with the trans -spliced intron sequences shown as color gradients. Primer locations are indicated by numbered arrows (see Methods for primer sequences); the numbers in parentheses denote the nucleotide positions corresponding to the 5′ ends of the primers on the ycf3 coding sequence after intron removal. Coding regions shown above or below the horizontal line are transcribed to the right or to the left, respectively. PCR assays were carried out on cDNA or genomic DNA (gDNA), with the numbers above the gel lanes indicating the combinations of primers used. The amplicon derived from the PCR assay on cDNA is of the size expected if intron trans -splicing occurs to produce the ycf3 RNA. The identity of this amplicon as well as the insertion position of the intron in the ycf3 gene were confirmed by DNA sequencing. The amplicons derived from the PCR assays on gDNA have the sizes predicted by the genome map.
    Figure Legend Snippet: Analysis of the trans -spliced group II intron in Picocystis ycf3 . (A) Potential intron secondary structure modeled according to Michel et al. (1989) [ 66 ]. Exon sequences are shown in lowercase letters. Roman numbers specify the six major structural domains. Tertiary interactions are denoted by dashed lines, arrows, or Greek letterings. EBS and IBS are exon-binding and intron-binding sites, respectively. The asterisk indicates the site of lariat formation. Note that the precise position of the breakpoint within domain IV is unknown. (B) Confirmation of intron trans -splicing by RT-PCR analysis. The diagrams on the left display the genomic configuration of the Picocystis ycf3 exons (solid color), with the trans -spliced intron sequences shown as color gradients. Primer locations are indicated by numbered arrows (see Methods for primer sequences); the numbers in parentheses denote the nucleotide positions corresponding to the 5′ ends of the primers on the ycf3 coding sequence after intron removal. Coding regions shown above or below the horizontal line are transcribed to the right or to the left, respectively. PCR assays were carried out on cDNA or genomic DNA (gDNA), with the numbers above the gel lanes indicating the combinations of primers used. The amplicon derived from the PCR assay on cDNA is of the size expected if intron trans -splicing occurs to produce the ycf3 RNA. The identity of this amplicon as well as the insertion position of the intron in the ycf3 gene were confirmed by DNA sequencing. The amplicons derived from the PCR assays on gDNA have the sizes predicted by the genome map.

    Techniques Used: Binding Assay, Reverse Transcription Polymerase Chain Reaction, Sequencing, Polymerase Chain Reaction, Amplification, Derivative Assay, DNA Sequencing

    55) Product Images from "Molecular Diagnostics for Lassa Fever at Irrua Specialist Teaching Hospital, Nigeria: Lessons Learnt from Two Years of Laboratory Operation"

    Article Title: Molecular Diagnostics for Lassa Fever at Irrua Specialist Teaching Hospital, Nigeria: Lessons Learnt from Two Years of Laboratory Operation

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0001839

    Molecular testing for Lassa virus at ISTH. (A) Outline of the diagnostic laboratory with pre- and post-PCR areas (“Clean” and “Dirty”, respectively). (B) Inactivation of plasma samples in a chaotropic buffer in a plexiglas box in the inactivation room. All sample manipulations were done behind a plexiglas shield. The box features a UV light source on top for decontamination. (C) Example of an RT-PCR result. From each patient sample, 140 µl and 14 µl were processed (lanes UD [undiluted] and 1∶10, respectively).
    Figure Legend Snippet: Molecular testing for Lassa virus at ISTH. (A) Outline of the diagnostic laboratory with pre- and post-PCR areas (“Clean” and “Dirty”, respectively). (B) Inactivation of plasma samples in a chaotropic buffer in a plexiglas box in the inactivation room. All sample manipulations were done behind a plexiglas shield. The box features a UV light source on top for decontamination. (C) Example of an RT-PCR result. From each patient sample, 140 µl and 14 µl were processed (lanes UD [undiluted] and 1∶10, respectively).

    Techniques Used: Diagnostic Assay, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

    Phylogenetic analysis of Lassa virus sequences. The sequences of the PCR fragments obtained from positive cases were aligned with published sequences. The latter are identified by GenBank accession numbers. For clarity of presentation, only Nigerian strains are shown. The clusters A, B, and C comprising strains from Edo State and Ondo State were collapsed; these strains are shown separately in Figure 6 . Posterior probability values are indicated on the branches. The country of origin of Lassa virus strains is indicated by a prefix: IC, Ivory Coast; NIG, Nigeria. If known, State and city is also shown with the strains (FCT, Federal Capital Territory). Sequences highlighted in boldface have been submitted to GenBank (accession nos. JN651366-JN651400). Lassa virus lineages are indicated left. The novel putative lineage/sub-lineage represented by strain Nig05-A08 [49] is indicated with a question mark.
    Figure Legend Snippet: Phylogenetic analysis of Lassa virus sequences. The sequences of the PCR fragments obtained from positive cases were aligned with published sequences. The latter are identified by GenBank accession numbers. For clarity of presentation, only Nigerian strains are shown. The clusters A, B, and C comprising strains from Edo State and Ondo State were collapsed; these strains are shown separately in Figure 6 . Posterior probability values are indicated on the branches. The country of origin of Lassa virus strains is indicated by a prefix: IC, Ivory Coast; NIG, Nigeria. If known, State and city is also shown with the strains (FCT, Federal Capital Territory). Sequences highlighted in boldface have been submitted to GenBank (accession nos. JN651366-JN651400). Lassa virus lineages are indicated left. The novel putative lineage/sub-lineage represented by strain Nig05-A08 [49] is indicated with a question mark.

    Techniques Used: Polymerase Chain Reaction

    56) Product Images from "CAF01 Potentiates Immune Responses and Efficacy of an Inactivated Influenza Vaccine in Ferrets"

    Article Title: CAF01 Potentiates Immune Responses and Efficacy of an Inactivated Influenza Vaccine in Ferrets

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0022891

    Challenge with A/Brisbane/59/2007 (H1N1) after immunizations with different doses. 6 to 10 months-old ferrets were immunized twice at two week-intervals with CAF01 adjuvanted and non-adjuvanted influenza vaccine at different dose levels. A third group was left un-vaccinated. All ferrets were challenged with 10 7 TCID 50 of A/Brisbane/59/2007 (H1N1) four weeks after the second immunization (n = 4). A , B and C show the relative amounts of viral RNA found in nasal washes of individual infected animals at peak replication day (day 4), measured by quantitative RT-PCR. D , E and F show hemagglutination inhibition assay serum titers at day 11 using influenza A/Brisbane/59/2007. Values marked with an asterisk are significantly different (*, p
    Figure Legend Snippet: Challenge with A/Brisbane/59/2007 (H1N1) after immunizations with different doses. 6 to 10 months-old ferrets were immunized twice at two week-intervals with CAF01 adjuvanted and non-adjuvanted influenza vaccine at different dose levels. A third group was left un-vaccinated. All ferrets were challenged with 10 7 TCID 50 of A/Brisbane/59/2007 (H1N1) four weeks after the second immunization (n = 4). A , B and C show the relative amounts of viral RNA found in nasal washes of individual infected animals at peak replication day (day 4), measured by quantitative RT-PCR. D , E and F show hemagglutination inhibition assay serum titers at day 11 using influenza A/Brisbane/59/2007. Values marked with an asterisk are significantly different (*, p

    Techniques Used: Infection, Quantitative RT-PCR, HI Assay

    Challenge with A/New Caledonia/20/99 (H1N1). 6 to 10 months-old ferrets were immunized twice at two week- intervals with CAF01 adjuvanted (▴) and non-adjuvanted (▪) influenza vaccine Sanofi-Pasteur's Vaxigrip season 2005/2006 (n = 8 per group). A third group was mock-vaccinated (•). All ferrets were challenged with 10 7 TCID 50 of A/New Caledonia/20/99 (H1N1) four weeks after the second immunization (n = 8 per group). A. Relative amounts of viral RNA found in nasal washes of infected animals during the first six days of challenge, measured by quantitative RT-PCR. B. Vaccine-specific IgG titers measured in serum by ELISA C. Vaccine-specific IgA titers measured in nasal washes by ELISA. D. Hemagglutination inhibition assay titers using influenza A New Caledonia 1999 (H1N1). All ELISA values are expressed as geometric mean titers (GMT). E. Percentage of IFN-γ-positive lymphocytes after 4 hours stimulation with PMA and ionomycin. Values marked with an asterisk are significantly different (*, p
    Figure Legend Snippet: Challenge with A/New Caledonia/20/99 (H1N1). 6 to 10 months-old ferrets were immunized twice at two week- intervals with CAF01 adjuvanted (▴) and non-adjuvanted (▪) influenza vaccine Sanofi-Pasteur's Vaxigrip season 2005/2006 (n = 8 per group). A third group was mock-vaccinated (•). All ferrets were challenged with 10 7 TCID 50 of A/New Caledonia/20/99 (H1N1) four weeks after the second immunization (n = 8 per group). A. Relative amounts of viral RNA found in nasal washes of infected animals during the first six days of challenge, measured by quantitative RT-PCR. B. Vaccine-specific IgG titers measured in serum by ELISA C. Vaccine-specific IgA titers measured in nasal washes by ELISA. D. Hemagglutination inhibition assay titers using influenza A New Caledonia 1999 (H1N1). All ELISA values are expressed as geometric mean titers (GMT). E. Percentage of IFN-γ-positive lymphocytes after 4 hours stimulation with PMA and ionomycin. Values marked with an asterisk are significantly different (*, p

    Techniques Used: Infection, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, HI Assay

    57) Product Images from "Sacbrood Virus of the Honeybee (Apis mellifera): Rapid Identification and Phylogenetic Analysis Using Reverse Transcription-PCR"

    Article Title: Sacbrood Virus of the Honeybee (Apis mellifera): Rapid Identification and Phylogenetic Analysis Using Reverse Transcription-PCR

    Journal: Clinical and Diagnostic Laboratory Immunology

    doi: 10.1128/CDLI.8.1.93-104.2001

    Detection of SBV in honeybees and brood by RT-PCR assays amplifying five different regions (lanes 1, 2, 3, 4, and 5) of the SBV genome. The amplification products were electrophoresed on a 1.2% agarose gel, stained with ethidium bromide, and visualized under UV light. Lanes M, DNA size markers (100-bp ladder); lane N, negative control.
    Figure Legend Snippet: Detection of SBV in honeybees and brood by RT-PCR assays amplifying five different regions (lanes 1, 2, 3, 4, and 5) of the SBV genome. The amplification products were electrophoresed on a 1.2% agarose gel, stained with ethidium bromide, and visualized under UV light. Lanes M, DNA size markers (100-bp ladder); lane N, negative control.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining, Negative Control

    58) Product Images from "Nodal induces apoptosis through activation of the ALK7 signaling pathway in pancreatic INS-1 ?-cells"

    Article Title: Nodal induces apoptosis through activation of the ALK7 signaling pathway in pancreatic INS-1 ?-cells

    Journal: American Journal of Physiology - Endocrinology and Metabolism

    doi: 10.1152/ajpendo.00074.2012

    Expression of Nodal mRNA and protein in pancreatic β-cells. A : 100 ng of total RNA from various tissues or cells as indicated was used for RT-PCR. PCR products were separated on a 1% agarose gel. Control was performed by omitting the RNA. B : microscopic
    Figure Legend Snippet: Expression of Nodal mRNA and protein in pancreatic β-cells. A : 100 ng of total RNA from various tissues or cells as indicated was used for RT-PCR. PCR products were separated on a 1% agarose gel. Control was performed by omitting the RNA. B : microscopic

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    59) Product Images from "Competitive Fitness During Feast and Famine: How SOS DNA Polymerases Influence Physiology and Evolution in Escherichia coli"

    Article Title: Competitive Fitness During Feast and Famine: How SOS DNA Polymerases Influence Physiology and Evolution in Escherichia coli

    Journal: Genetics

    doi: 10.1534/genetics.113.151837

    Alternative polymerase transcript abundance changes over the cell cycle. Messenger RNA transcript abundance, in the absence of exogenous SOS inducers, was determined by qRT-PCR. (A) Transcript abundance for each gene relative to its concentration at 2
    Figure Legend Snippet: Alternative polymerase transcript abundance changes over the cell cycle. Messenger RNA transcript abundance, in the absence of exogenous SOS inducers, was determined by qRT-PCR. (A) Transcript abundance for each gene relative to its concentration at 2

    Techniques Used: Quantitative RT-PCR, Concentration Assay

    60) Product Images from "Isomer-specific regulation of metabolism and PPAR? signaling by CLA in human preadipocytes"

    Article Title: Isomer-specific regulation of metabolism and PPAR? signaling by CLA in human preadipocytes

    Journal: Journal of lipid research

    doi: 10.1194/jlr.M300001-JLR200

    Time course and CLA-induced alterations of human adipocyte gene expression. A: For the time course data, confluent cultures of human preadipocytes were induced to differentiate under standard adipogenic conditions, and total RNA was harvested throughout adipose conversion (Day 0, 8 h, 24 h, 72 h, and 216 h postinduction). Total RNA was used for first-strand cDNA synthesis, and real-time quantitative RT-PCR analyses were performed to analyze the expression of acyl-CoA binding protein (ACBP), adipocyte fatty acid binding protein (aP2), CAAT/enhancer binding protein α (C/EBPα), glycerol dehydrogenase (GPDH), hormone-sensitive lipase (HSL), perilipin, peroxisome proliferator-activated receptors γ1 and γ2 (PPARγ1 and PPARγ2), leptin, and acetyl-CoA carboxylase (ACC). The relative expression level of a given gene was calculated after normalization to TATA-binding protein expression, and was expressed relative to Day 0 (confluent, noninduced) controls. B: To examine the effects of fatty acid treatment on gene expression, cultures were continuously treated with either a BSA vehicle control, 30 μM cis -9, trans ), or 30 μM trans -10, cis ) for either 0 h, 8 h, 24 h, 72 h, or 216 h during differentiation. Real-time quantitative RT-PCR analyses were performed as stated above to analyze gene expression. Results shown are only for the 216 h treatments and are representative of three separate experiments from independent human subjects.
    Figure Legend Snippet: Time course and CLA-induced alterations of human adipocyte gene expression. A: For the time course data, confluent cultures of human preadipocytes were induced to differentiate under standard adipogenic conditions, and total RNA was harvested throughout adipose conversion (Day 0, 8 h, 24 h, 72 h, and 216 h postinduction). Total RNA was used for first-strand cDNA synthesis, and real-time quantitative RT-PCR analyses were performed to analyze the expression of acyl-CoA binding protein (ACBP), adipocyte fatty acid binding protein (aP2), CAAT/enhancer binding protein α (C/EBPα), glycerol dehydrogenase (GPDH), hormone-sensitive lipase (HSL), perilipin, peroxisome proliferator-activated receptors γ1 and γ2 (PPARγ1 and PPARγ2), leptin, and acetyl-CoA carboxylase (ACC). The relative expression level of a given gene was calculated after normalization to TATA-binding protein expression, and was expressed relative to Day 0 (confluent, noninduced) controls. B: To examine the effects of fatty acid treatment on gene expression, cultures were continuously treated with either a BSA vehicle control, 30 μM cis -9, trans ), or 30 μM trans -10, cis ) for either 0 h, 8 h, 24 h, 72 h, or 216 h during differentiation. Real-time quantitative RT-PCR analyses were performed as stated above to analyze gene expression. Results shown are only for the 216 h treatments and are representative of three separate experiments from independent human subjects.

    Techniques Used: Expressing, Quantitative RT-PCR, Binding Assay

    61) Product Images from "Sox15 Is Required for Skeletal Muscle Regeneration"

    Article Title: Sox15 Is Required for Skeletal Muscle Regeneration

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.24.19.8428-8436.2004

    Targeted disruption of the Sox15 gene. (A) The structures of the wild type, the targeted vector, and the recombinant allele are shown together with the relevant restriction sites. A 2.5-kb HindIII/KpnI fragment containing 5′flanking region and a sequence encoding the HMG domain was replaced by a pgk-neo selection cassette (NEO). The 3′external probe used and the predicted length of NheI restriction fragments in Southern blot analysis are shown. The primers SF, SR, and Pgk used to amplify the wild-type and mutant allele by PCR are indicated. Abbreviations: TK, thymidine kinase cassette; B, BamHI; H, HindIII; K, KpnI; N, NheI; S, SalI; X, XhoI. (B) Southern blot analysis of the recombinant ES cell clones. Genomic DNA extracted from ES cell clones was digested with NheI and probed with the 3′ probe shown in panel A. The wild-type Sox15 allele generated a 12-kb NheI fragment, whereas the targeted allele yielded a 10.8-kb NheI fragment, as indicated in panel A. (C) Northern blot analysis with total RNA isolated from Sox15 +/+ and Sox15 −/− myogenic cultures was hybridized with the Sox15 cDNA. The cross hybridization with 18S RNA revealed the integrity of RNA loading. (D) Western blot with proteins extracted from primary Sox15 +/+ and Sox15 −/− myoblasts was probed with purified anti-Sox15 antibodies. The immunoreactive 25-kDa Sox15 was detectable in wild-type but not in Sox15 −/− myoblasts. (E) RT-PCR analysis revealed the presence of the Fxr2h gene in the brains of Sox15 −/− mice.
    Figure Legend Snippet: Targeted disruption of the Sox15 gene. (A) The structures of the wild type, the targeted vector, and the recombinant allele are shown together with the relevant restriction sites. A 2.5-kb HindIII/KpnI fragment containing 5′flanking region and a sequence encoding the HMG domain was replaced by a pgk-neo selection cassette (NEO). The 3′external probe used and the predicted length of NheI restriction fragments in Southern blot analysis are shown. The primers SF, SR, and Pgk used to amplify the wild-type and mutant allele by PCR are indicated. Abbreviations: TK, thymidine kinase cassette; B, BamHI; H, HindIII; K, KpnI; N, NheI; S, SalI; X, XhoI. (B) Southern blot analysis of the recombinant ES cell clones. Genomic DNA extracted from ES cell clones was digested with NheI and probed with the 3′ probe shown in panel A. The wild-type Sox15 allele generated a 12-kb NheI fragment, whereas the targeted allele yielded a 10.8-kb NheI fragment, as indicated in panel A. (C) Northern blot analysis with total RNA isolated from Sox15 +/+ and Sox15 −/− myogenic cultures was hybridized with the Sox15 cDNA. The cross hybridization with 18S RNA revealed the integrity of RNA loading. (D) Western blot with proteins extracted from primary Sox15 +/+ and Sox15 −/− myoblasts was probed with purified anti-Sox15 antibodies. The immunoreactive 25-kDa Sox15 was detectable in wild-type but not in Sox15 −/− myoblasts. (E) RT-PCR analysis revealed the presence of the Fxr2h gene in the brains of Sox15 −/− mice.

    Techniques Used: Plasmid Preparation, Recombinant, Sequencing, Selection, Southern Blot, Mutagenesis, Polymerase Chain Reaction, Clone Assay, Generated, Northern Blot, Isolation, Hybridization, Western Blot, Purification, Reverse Transcription Polymerase Chain Reaction, Mouse Assay

    Expression analyses of the Sox15 gene. (A) Northern blot with total RNA from ES cells and different tissues hybridized with the Sox15 cDNA revealed the 1.4-kb Sox15 transcripts only in ES cells. The cross hybridization with 18S RNA revealed the integrity of RNA loading. (B) RT-PCR analysis with total RNA and Sox15 specific primers showed the presence of a 678-bp amplified product in all examined tissues. (C) Immunostaining with anti-Sox15 antibodies (Sox15) revealed that expression of Sox15 is restricted to the nuclei of ES cells and to some nuclei of primary myogenic cells cultured in growth medium (GM). No Sox15 positive cells were detectable in cultures of Swiss 3T3 fibroblasts (3T3) or myogenic cells growing in differentiation medium (DM). In sections of skeletal muscle, the Sox15 expression was associated with one nucleus (white arrowheads), which may be a satellite cell. Cells stained with Sox15 antibodies (right micrographs) were counterstained with DAPI (left micrographs) to show all nuclei. Scale bar, 100 μm.
    Figure Legend Snippet: Expression analyses of the Sox15 gene. (A) Northern blot with total RNA from ES cells and different tissues hybridized with the Sox15 cDNA revealed the 1.4-kb Sox15 transcripts only in ES cells. The cross hybridization with 18S RNA revealed the integrity of RNA loading. (B) RT-PCR analysis with total RNA and Sox15 specific primers showed the presence of a 678-bp amplified product in all examined tissues. (C) Immunostaining with anti-Sox15 antibodies (Sox15) revealed that expression of Sox15 is restricted to the nuclei of ES cells and to some nuclei of primary myogenic cells cultured in growth medium (GM). No Sox15 positive cells were detectable in cultures of Swiss 3T3 fibroblasts (3T3) or myogenic cells growing in differentiation medium (DM). In sections of skeletal muscle, the Sox15 expression was associated with one nucleus (white arrowheads), which may be a satellite cell. Cells stained with Sox15 antibodies (right micrographs) were counterstained with DAPI (left micrographs) to show all nuclei. Scale bar, 100 μm.

    Techniques Used: Expressing, Northern Blot, Hybridization, Reverse Transcription Polymerase Chain Reaction, Amplification, Immunostaining, Cell Culture, Staining

    62) Product Images from "Activation of Influenza A Viruses by Host Proteases from Swine Airway Epithelium"

    Article Title: Activation of Influenza A Viruses by Host Proteases from Swine Airway Epithelium

    Journal: Journal of Virology

    doi: 10.1128/JVI.01635-13

    Distribution of swTMPRSS2- and swAT-specific mRNA in respiratory tissues and expression of recombinant swine and human proteases. (A) Total RNA was isolated from PEECs, PTECs, and PBECs as well as porcine lung tissue and used as a target for RT-PCR analysis
    Figure Legend Snippet: Distribution of swTMPRSS2- and swAT-specific mRNA in respiratory tissues and expression of recombinant swine and human proteases. (A) Total RNA was isolated from PEECs, PTECs, and PBECs as well as porcine lung tissue and used as a target for RT-PCR analysis

    Techniques Used: Expressing, Recombinant, Isolation, Reverse Transcription Polymerase Chain Reaction

    63) Product Images from "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV"

    Article Title: An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV

    Journal: Retrovirology

    doi: 10.1186/1742-4690-7-110

    One-step RT-PCR for identification of contaminants in Kit I and Platinum Taq . (A-C) One-step RT-PCR for identification of a contaminated component in Kit I. The experiments were conducted in two independent laboratories, IVR and JRC. In IVR, nucleic acids were extracted from 50 μl of the enzyme mix of the RT-PCR Kit I using an RNA purification column (QIAamp viral RNA mini kit [Cat. no. 52904] [QIAGEN]) and the presence of polytropic endogenous MLV was examined by using the RT-PCR Kit T (A) and Kit P (B). In JRC, nucleic acids were extracted from 75 μl of the enzyme mix of RT-PCR Kit I using an RNA/DNA purification column (PureLink™ Viral RNA/DNA Kit [Cat. no. 12280-050] [Invitrogen]), and the presence of polytropic endogenous MLV was examined using Kit Q (C). Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR conditions for Kit T and Kit P were the same as in Figure 1B. The RT-PCR conditions for Kit Q were as follows: reverse transcription at 50°C for 30 minutes; activation at 95°C for 15 minutes; 45 cycles of the following steps: 94°C for 30 s, 57°C for 30 s, and 72°C for 1 minute; and a final extension at 72°C for 10 minutes. Lanes 1 and 5, DW; lanes 2 and 6, column-purified carrier RNA (carrier); lanes 3 and 7, column-purified nucleic acids from enzyme mix (enzyme) of the Kit I; lanes 4 and 8, 1 μl buffer of the Kit I plus 4 μl DW (buffer). (D) One-step RT-PCR for the detection of MLV RNA in Platinum Taq. Nucleic acids were extracted from 50 μl of the Platinum Taq using an RNA purification column (QIAamp viral RNA mini kit [QIAGEN]) and the presence of MLV RNA was examined by using the RT-PCR Kit P. Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR condition was the same as in Figure 1B with the exception of the PCR cycles (60 cycles instead of 45 cycles). Abbreviation; DW: distilled water. M: DNA size marker.
    Figure Legend Snippet: One-step RT-PCR for identification of contaminants in Kit I and Platinum Taq . (A-C) One-step RT-PCR for identification of a contaminated component in Kit I. The experiments were conducted in two independent laboratories, IVR and JRC. In IVR, nucleic acids were extracted from 50 μl of the enzyme mix of the RT-PCR Kit I using an RNA purification column (QIAamp viral RNA mini kit [Cat. no. 52904] [QIAGEN]) and the presence of polytropic endogenous MLV was examined by using the RT-PCR Kit T (A) and Kit P (B). In JRC, nucleic acids were extracted from 75 μl of the enzyme mix of RT-PCR Kit I using an RNA/DNA purification column (PureLink™ Viral RNA/DNA Kit [Cat. no. 12280-050] [Invitrogen]), and the presence of polytropic endogenous MLV was examined using Kit Q (C). Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR conditions for Kit T and Kit P were the same as in Figure 1B. The RT-PCR conditions for Kit Q were as follows: reverse transcription at 50°C for 30 minutes; activation at 95°C for 15 minutes; 45 cycles of the following steps: 94°C for 30 s, 57°C for 30 s, and 72°C for 1 minute; and a final extension at 72°C for 10 minutes. Lanes 1 and 5, DW; lanes 2 and 6, column-purified carrier RNA (carrier); lanes 3 and 7, column-purified nucleic acids from enzyme mix (enzyme) of the Kit I; lanes 4 and 8, 1 μl buffer of the Kit I plus 4 μl DW (buffer). (D) One-step RT-PCR for the detection of MLV RNA in Platinum Taq. Nucleic acids were extracted from 50 μl of the Platinum Taq using an RNA purification column (QIAamp viral RNA mini kit [QIAGEN]) and the presence of MLV RNA was examined by using the RT-PCR Kit P. Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR condition was the same as in Figure 1B with the exception of the PCR cycles (60 cycles instead of 45 cycles). Abbreviation; DW: distilled water. M: DNA size marker.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Purification, DNA Purification, Activation Assay, Polymerase Chain Reaction, Marker

    64) Product Images from "Role of endonucleases XPF and XPG in nucleotide excision repair of platinated DNA and cisplatin/oxaliplatin cytotoxicity"

    Article Title: Role of endonucleases XPF and XPG in nucleotide excision repair of platinated DNA and cisplatin/oxaliplatin cytotoxicity

    Journal: Chembiochem : a European journal of chemical biology

    doi: 10.1002/cbic.201000724

    A 2% agarose gel (0.5 μg/mL EtBr) of amplified DNA from RT-PCR of RNA isolated from cells after XPF (left) and XPG (right) knockdown. 1×TBE was used for the gel and running buffer. The gel was run at 100 V for 120 min.
    Figure Legend Snippet: A 2% agarose gel (0.5 μg/mL EtBr) of amplified DNA from RT-PCR of RNA isolated from cells after XPF (left) and XPG (right) knockdown. 1×TBE was used for the gel and running buffer. The gel was run at 100 V for 120 min.

    Techniques Used: Agarose Gel Electrophoresis, Amplification, Reverse Transcription Polymerase Chain Reaction, Isolation

    65) Product Images from "Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors"

    Article Title: Susceptibility of Human Endogenous Retrovirus Type K to Reverse Transcriptase Inhibitors

    Journal: Journal of Virology

    doi: 10.1128/JVI.01309-17

    Functional capacity and fidelity of K103 RT. Capacity of K103 RT to efficiently reverse transcribe HK2 K108 env transcripts produced in vitro in RT-PCRs. Serial dilutions of HK2 DNA-free RNA transcripts ranging from a concentration of 10 9 to 10 6 copies per microliter were subjected to RT-PCR using the MLV RT or the K103 RT using the master mix buffer provided by the Qiagen OneStep qRT-PCR kit. (A) An electrophoresis gel showing the amplification products generated by qRT-PCRs using serial dilutions of HK2 transcripts and the negative-control fetal bovine serum (FBS). The upper band represents HK2 amplicon, whereas the lower band represents primer dimer. Efficient amplification was observed when using a lower concentration of K103 RT. Amplification efficiency (B) and melting curve analysis (C) of reverse-transcribed RNAs generated by the MLV RT (left) and the K103 RT. The calibration curves display the squared correlation coefficient ( R 2 ). The melting curve analysis shows the melting temperature peaks of the PCR amplicons and the primer dimers in each RT reaction using different enzymes. (D and E) Sequence of HK2 env type 2 (D) or gag (E) PCR amplicons produced by RT-PCRs using K103 RT on HK2 transcripts produced in vitro . Arrows indicate misincorporation of nucleotides, likely generated by the K103 RT. (F and G) Sequence chromatograms of env type 2 (F) and gag (G) on amplicons produced by RT-PCRs using MLV RT on HK2 transcripts. We did not find misincorporation of bases using the MLV RT.
    Figure Legend Snippet: Functional capacity and fidelity of K103 RT. Capacity of K103 RT to efficiently reverse transcribe HK2 K108 env transcripts produced in vitro in RT-PCRs. Serial dilutions of HK2 DNA-free RNA transcripts ranging from a concentration of 10 9 to 10 6 copies per microliter were subjected to RT-PCR using the MLV RT or the K103 RT using the master mix buffer provided by the Qiagen OneStep qRT-PCR kit. (A) An electrophoresis gel showing the amplification products generated by qRT-PCRs using serial dilutions of HK2 transcripts and the negative-control fetal bovine serum (FBS). The upper band represents HK2 amplicon, whereas the lower band represents primer dimer. Efficient amplification was observed when using a lower concentration of K103 RT. Amplification efficiency (B) and melting curve analysis (C) of reverse-transcribed RNAs generated by the MLV RT (left) and the K103 RT. The calibration curves display the squared correlation coefficient ( R 2 ). The melting curve analysis shows the melting temperature peaks of the PCR amplicons and the primer dimers in each RT reaction using different enzymes. (D and E) Sequence of HK2 env type 2 (D) or gag (E) PCR amplicons produced by RT-PCRs using K103 RT on HK2 transcripts produced in vitro . Arrows indicate misincorporation of nucleotides, likely generated by the K103 RT. (F and G) Sequence chromatograms of env type 2 (F) and gag (G) on amplicons produced by RT-PCRs using MLV RT on HK2 transcripts. We did not find misincorporation of bases using the MLV RT.

    Techniques Used: Functional Assay, Produced, In Vitro, Concentration Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Electrophoresis, Amplification, Generated, Negative Control, Polymerase Chain Reaction, Sequencing

    66) Product Images from "Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis"

    Article Title: Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

    Journal: Journal of Virology

    doi: 10.1128/JVI.78.22.12576-12590.2004

    Amplification of 20 novel genes of SGIV via RT-PCR. Total RNA (harvested after 48 h of infection) was isolated by using the RNeasy Mini kit and amplified by using the OneStep RT-PCR kit. Full lengths of 14 genes were amplified (A and B). Partial sequences
    Figure Legend Snippet: Amplification of 20 novel genes of SGIV via RT-PCR. Total RNA (harvested after 48 h of infection) was isolated by using the RNeasy Mini kit and amplified by using the OneStep RT-PCR kit. Full lengths of 14 genes were amplified (A and B). Partial sequences

    Techniques Used: Amplification, Reverse Transcription Polymerase Chain Reaction, Infection, Isolation

    67) Product Images from "Functionally Cloned pdrM from Streptococcus pneumoniae Encodes a Na+ Coupled Multidrug Efflux Pump"

    Article Title: Functionally Cloned pdrM from Streptococcus pneumoniae Encodes a Na+ Coupled Multidrug Efflux Pump

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0059525

    RT-PCR analysis in S. pneumoniae R6. One ng total RNA was used for the template for one reaction of RT-PCR, and the reaction was repeated for 24 cycles. pUC19 digested with Msp I was used as a size marker (lane M). pdrM (lane a, e), spr1756 (lane b, f), spr1877 (lane c, g). The expression of the atpB was used as an internal control (lane d, h). Reverse transcriptional reactions were submitted on samples in lane a, b, c, and d, and were not on samples in lane e, f, g, and h.
    Figure Legend Snippet: RT-PCR analysis in S. pneumoniae R6. One ng total RNA was used for the template for one reaction of RT-PCR, and the reaction was repeated for 24 cycles. pUC19 digested with Msp I was used as a size marker (lane M). pdrM (lane a, e), spr1756 (lane b, f), spr1877 (lane c, g). The expression of the atpB was used as an internal control (lane d, h). Reverse transcriptional reactions were submitted on samples in lane a, b, c, and d, and were not on samples in lane e, f, g, and h.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Marker, Expressing

    68) Product Images from "RNAi triggered by specialized machinery silences developmental genes and retrotransposons"

    Article Title: RNAi triggered by specialized machinery silences developmental genes and retrotransposons

    Journal: Nature

    doi: 10.1038/nature11716

    siRNA clusters and RNAi-dependent assembly of heterochromatin at gene-containing regions a , The normalized number of small RNA reads are plotted. The signals above and below the line represent small RNAs that map to the top and bottom DNA strands, respectively. siRNA mapping to myp2 and SPCC1442.04c and their length profiles are shown. b , Chromatin immunoprecipitation (ChIP) showing Chp1 enrichment at the indicated loci. The intensities of bands representing each locus and the leu1 control in ChIP and whole cell crude extract (WCE) lanes were used to calculate the relative fold enrichments shown. c , Northern with probes specific for myp2 or SPCC1442.04c was used to detect siRNAs. tRNA serves as a loading control. d , The H3K9me2 was mapped by ChIP-chip. siRNA clusters and H3K9me map to the open reading frames of multiple genes, but their distribution decreases sharply, in some cases coinciding with TFIIIC binding sites, such as tRNAs , that are known to serve as heterochromatin boundaries. e , Detection of antisense transcripts generated from myp2 or SPCC1442.04c loci was performed using RT-PCR. The act1 transcript level was used as a control.
    Figure Legend Snippet: siRNA clusters and RNAi-dependent assembly of heterochromatin at gene-containing regions a , The normalized number of small RNA reads are plotted. The signals above and below the line represent small RNAs that map to the top and bottom DNA strands, respectively. siRNA mapping to myp2 and SPCC1442.04c and their length profiles are shown. b , Chromatin immunoprecipitation (ChIP) showing Chp1 enrichment at the indicated loci. The intensities of bands representing each locus and the leu1 control in ChIP and whole cell crude extract (WCE) lanes were used to calculate the relative fold enrichments shown. c , Northern with probes specific for myp2 or SPCC1442.04c was used to detect siRNAs. tRNA serves as a loading control. d , The H3K9me2 was mapped by ChIP-chip. siRNA clusters and H3K9me map to the open reading frames of multiple genes, but their distribution decreases sharply, in some cases coinciding with TFIIIC binding sites, such as tRNAs , that are known to serve as heterochromatin boundaries. e , Detection of antisense transcripts generated from myp2 or SPCC1442.04c loci was performed using RT-PCR. The act1 transcript level was used as a control.

    Techniques Used: Chromatin Immunoprecipitation, Northern Blot, Binding Assay, Generated, Reverse Transcription Polymerase Chain Reaction

    69) Product Images from "NKX2-5 Regulates the Expression of ?-Catenin and GATA4 in Ventricular Myocytes"

    Article Title: NKX2-5 Regulates the Expression of ?-Catenin and GATA4 in Ventricular Myocytes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0005698

    The level of Gata4 and β-catenin RNA in Nkx2-5 +/- heterozygous and wild type hearts. Quantitative RT-PCR analysis of Nkx2-5, Gata4, and β-catenin in the hearts of 11.5 dpc wild type (WT) and Nkx2-5 +/- (HET) embryos revealed augmentation of both Gata4 and β-catenin and reduction in Nkx2-5 RNA levels. The values (mean±SEM) for each gene were normalized against GAPDH. N = 9 for WT and N = 11 for HET hearts.
    Figure Legend Snippet: The level of Gata4 and β-catenin RNA in Nkx2-5 +/- heterozygous and wild type hearts. Quantitative RT-PCR analysis of Nkx2-5, Gata4, and β-catenin in the hearts of 11.5 dpc wild type (WT) and Nkx2-5 +/- (HET) embryos revealed augmentation of both Gata4 and β-catenin and reduction in Nkx2-5 RNA levels. The values (mean±SEM) for each gene were normalized against GAPDH. N = 9 for WT and N = 11 for HET hearts.

    Techniques Used: Quantitative RT-PCR

    70) Product Images from "Apoptosis and Pathogenesis of Avian Influenza A (H5N1) Virus in Humans"

    Article Title: Apoptosis and Pathogenesis of Avian Influenza A (H5N1) Virus in Humans

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid1305.060572

    A) Detection of viral RNA in lung, trachea, and liver by reverse transcription–PCR (RT-PCR) (upper panel) and detection of positive- and negative-stranded viral RNA in trachea and liver by strand-specific RT-PCR (lower panel). Lane 1, 100-bp ladder; Neg, negative. B) RT-PCR showing overexpression of tumor necrosis factor-α in lung and liver tissues of patient in A compared with normal tissues.
    Figure Legend Snippet: A) Detection of viral RNA in lung, trachea, and liver by reverse transcription–PCR (RT-PCR) (upper panel) and detection of positive- and negative-stranded viral RNA in trachea and liver by strand-specific RT-PCR (lower panel). Lane 1, 100-bp ladder; Neg, negative. B) RT-PCR showing overexpression of tumor necrosis factor-α in lung and liver tissues of patient in A compared with normal tissues.

    Techniques Used: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Over Expression

    71) Product Images from "Berberine Chloride Mediates Its Anti-Leishmanial Activity via Differential Regulation of the Mitogen Activated Protein Kinase Pathway in Macrophages"

    Article Title: Berberine Chloride Mediates Its Anti-Leishmanial Activity via Differential Regulation of the Mitogen Activated Protein Kinase Pathway in Macrophages

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0018467

    Effect of Berberine chloride on IL-12p40 in macrophages. A: Uninfected (a) and L. donovani infected (d) macrophages were treated for 18 h with Berberine chloride 2.5 µM (b, e) or 10 µM (c, f). RNA was isolated, subjected to RT-PCR and the products of β-actin and IL-12 p40 mRNA were resolved on an agarose gel (1.5%) and quantified densitometrically using Total lab software as described in Methods . B: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated with Berberine chloride 2.5 µM (b) and 10 µM (c) for 24 h and assayed for levels of IL-12p40 in culture supernatants by ELISA as described in Methods . Each point represents the mean ± SEM of IL-12p40 (pg/ml) of at least 3 experiments in duplicate.
    Figure Legend Snippet: Effect of Berberine chloride on IL-12p40 in macrophages. A: Uninfected (a) and L. donovani infected (d) macrophages were treated for 18 h with Berberine chloride 2.5 µM (b, e) or 10 µM (c, f). RNA was isolated, subjected to RT-PCR and the products of β-actin and IL-12 p40 mRNA were resolved on an agarose gel (1.5%) and quantified densitometrically using Total lab software as described in Methods . B: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated with Berberine chloride 2.5 µM (b) and 10 µM (c) for 24 h and assayed for levels of IL-12p40 in culture supernatants by ELISA as described in Methods . Each point represents the mean ± SEM of IL-12p40 (pg/ml) of at least 3 experiments in duplicate.

    Techniques Used: Infection, Isolation, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Software, Enzyme-linked Immunosorbent Assay

    Effect of Berberine chloride on IL-10 in macrophages. A: Uninfected (a) and L. donovani infected (d) macrophages were treated for 18 h with Berberine chloride 2.5 µM (b, e) or 10 µM (c, f). RNA was isolated, subjected to RT-PCR and the products of β-actin and IL-10 mRNA were resolved on an agarose gel (1.5%) and quantified densitometrically using Total lab software as described in Methods . B: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated with Berberine chloride 2.5 µM (b) and 10 µM (c) for 24 h and assayed for levels of IL-10 in culture supernatants by ELISA as described in Methods . Each point represents the mean ± SEM of IL-10 (pg/ml) of at least 3 experiments in duplicate.
    Figure Legend Snippet: Effect of Berberine chloride on IL-10 in macrophages. A: Uninfected (a) and L. donovani infected (d) macrophages were treated for 18 h with Berberine chloride 2.5 µM (b, e) or 10 µM (c, f). RNA was isolated, subjected to RT-PCR and the products of β-actin and IL-10 mRNA were resolved on an agarose gel (1.5%) and quantified densitometrically using Total lab software as described in Methods . B: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated with Berberine chloride 2.5 µM (b) and 10 µM (c) for 24 h and assayed for levels of IL-10 in culture supernatants by ELISA as described in Methods . Each point represents the mean ± SEM of IL-10 (pg/ml) of at least 3 experiments in duplicate.

    Techniques Used: Infection, Isolation, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Software, Enzyme-linked Immunosorbent Assay

    Effect of Berberine chloride on generation of NO and expression of iNOS. A: A representative dot plot of uninfected (a) and Leishmania infected (d) murine peritoneal macrophages, that were treated with Berberine chloride (10 µM, 48 h, b, e). Cells were gated on the basis of characteristic linear forward and side scatter features of macrophages and subsequently DAF-2T fluorescence was measured on a logarithmic scale in the FL1 channel. A representative histogram of uninfected macrophages (c, ) and L. donovani infected macrophages (f, ) for DAF-2T that were treated with Berberine chloride (…) macrophages as described in Methods . B: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 24 h with Berberine chloride 2.5 µM (b) and 10 µM (c), and processed for measurement of DAF-2T fluorescence as described in Methods . Data are expressed as the mean GMFC ± SEM of at least 3 experiments in duplicate. C: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 48 h with Berberine chloride 2.5 µM (b) and 10 µM (c) and processed for measurement of DAF-2T fluorescence as described in Methods . Data are expressed as the mean GMFC ± SEM of at least 3 experiments in duplicate. D: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 24 h with Berberine chloride 2.5 µM (b) and 10 µM (c) and assayed for levels of extracellular NO as described in Methods . Each point represents the mean ± SEM of NO 2 − (µM) of at least 3 experiments in duplicate. E: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 48 h with Berberine chloride 2.5 µM (b) and 10 µM (c) and assayed for levels of extracellular NO as described in Methods . Each point represents the mean ± SEM of NO 2 − (µM) of at least 3 experiments in duplicate. F: Uninfected macrophages (a) and L. donovani infected macrophages (d) were treated for 18 h with Berberine chloride 2.5 µM (b, e) or 10 µM (c, f). RNA was isolated and subjected to RT-PCR and the products of β-actin and iNOS mRNA were resolved on an agarose gel (1.5%) and quantified densitometrically using Total lab software as described in Methods .
    Figure Legend Snippet: Effect of Berberine chloride on generation of NO and expression of iNOS. A: A representative dot plot of uninfected (a) and Leishmania infected (d) murine peritoneal macrophages, that were treated with Berberine chloride (10 µM, 48 h, b, e). Cells were gated on the basis of characteristic linear forward and side scatter features of macrophages and subsequently DAF-2T fluorescence was measured on a logarithmic scale in the FL1 channel. A representative histogram of uninfected macrophages (c, ) and L. donovani infected macrophages (f, ) for DAF-2T that were treated with Berberine chloride (…) macrophages as described in Methods . B: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 24 h with Berberine chloride 2.5 µM (b) and 10 µM (c), and processed for measurement of DAF-2T fluorescence as described in Methods . Data are expressed as the mean GMFC ± SEM of at least 3 experiments in duplicate. C: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 48 h with Berberine chloride 2.5 µM (b) and 10 µM (c) and processed for measurement of DAF-2T fluorescence as described in Methods . Data are expressed as the mean GMFC ± SEM of at least 3 experiments in duplicate. D: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 24 h with Berberine chloride 2.5 µM (b) and 10 µM (c) and assayed for levels of extracellular NO as described in Methods . Each point represents the mean ± SEM of NO 2 − (µM) of at least 3 experiments in duplicate. E: Uninfected macrophages (1×10 6 /ml, □, a) or L. donovani infected macrophages (▪, a) were treated for 48 h with Berberine chloride 2.5 µM (b) and 10 µM (c) and assayed for levels of extracellular NO as described in Methods . Each point represents the mean ± SEM of NO 2 − (µM) of at least 3 experiments in duplicate. F: Uninfected macrophages (a) and L. donovani infected macrophages (d) were treated for 18 h with Berberine chloride 2.5 µM (b, e) or 10 µM (c, f). RNA was isolated and subjected to RT-PCR and the products of β-actin and iNOS mRNA were resolved on an agarose gel (1.5%) and quantified densitometrically using Total lab software as described in Methods .

    Techniques Used: Expressing, Infection, Fluorescence, Isolation, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Software

    72) Product Images from "Altered Gene Expression and Intracellular Changes of the Viable But Nonculturable State in Ralstonia solanacearum by Copper Treatment"

    Article Title: Altered Gene Expression and Intracellular Changes of the Viable But Nonculturable State in Ralstonia solanacearum by Copper Treatment

    Journal: The Plant Pathology Journal

    doi: 10.5423/PPJ.OA.07.2013.0067

    RT-PCR analysis of genes encoding induced proteins in VBNC R. solanacearum . (A) Total RNAs were extracted from bacterial cells maintained for 3 days in liquid microcosm containing various amount of copper sulfate. The numbers on the left represent the corresponding protein spot number from the 2-DE gel. (B) Detection of dps transcript over time in culturable (Cu−) and VBNC (Cu+) R. solanacearum . (C) Relative expression level of dps over time in VBNC cells (black) and culturable cells (white) of R. solanacearum . Y-axis represents the relative amount of dps transcript over omp transcript. The vertical bar represents the standard deviation of 3 replicates. Asterisk represents significant difference between VBNC cells and culturable cells, P
    Figure Legend Snippet: RT-PCR analysis of genes encoding induced proteins in VBNC R. solanacearum . (A) Total RNAs were extracted from bacterial cells maintained for 3 days in liquid microcosm containing various amount of copper sulfate. The numbers on the left represent the corresponding protein spot number from the 2-DE gel. (B) Detection of dps transcript over time in culturable (Cu−) and VBNC (Cu+) R. solanacearum . (C) Relative expression level of dps over time in VBNC cells (black) and culturable cells (white) of R. solanacearum . Y-axis represents the relative amount of dps transcript over omp transcript. The vertical bar represents the standard deviation of 3 replicates. Asterisk represents significant difference between VBNC cells and culturable cells, P

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Standard Deviation

    73) Product Images from "Identification of Small Molecule Inhibitors of Pre-mRNA Splicing *"

    Article Title: Identification of Small Molecule Inhibitors of Pre-mRNA Splicing *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.590976

    Secondary screen. A, schematic representation of the RT-PCR in vitro splicing assay. 20-μl splicing reaction was incubated in the presence of 500 μ m compound at 30 °C for 90 min before the splicing reaction was stop by heat inactivation. After proteinase K digestion, the spliced and unspliced RNA is amplified by RT-PCR. B shows examples of compounds that either inhibit pre-mRNA splicing or do not interfere with the splicing reaction. The star indicates splicing reactions that were inhibited. Lane M , marker (hyperladder, 1 kb).
    Figure Legend Snippet: Secondary screen. A, schematic representation of the RT-PCR in vitro splicing assay. 20-μl splicing reaction was incubated in the presence of 500 μ m compound at 30 °C for 90 min before the splicing reaction was stop by heat inactivation. After proteinase K digestion, the spliced and unspliced RNA is amplified by RT-PCR. B shows examples of compounds that either inhibit pre-mRNA splicing or do not interfere with the splicing reaction. The star indicates splicing reactions that were inhibited. Lane M , marker (hyperladder, 1 kb).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, In Vitro, Splicing Assay, Incubation, Amplification, Marker

    74) Product Images from "Regulation of 4E-BP1 activity in the mammalian oocyte"

    Article Title: Regulation of 4E-BP1 activity in the mammalian oocyte

    Journal: Cell Cycle

    doi: 10.1080/15384101.2017.1295178

    Expression of 4E-BP forms in mouse oocytes. (A) Quantitative RT-PCR analysis shows all 3 forms of 4e-bp mRNA, which are stable during oocyte maturation (NS = non-significant, n ≥ 3). Results were normalized to the relative internal standard Gapdh mRNA in GV. (B) Immunoblotting shows presence of only 4E-BP1 form on the protein level. Both 4E-BP2 and 4E-BP3 are absent in the oocytes, although they are present in the brain. Expression of the 4E-BP1 in the brain sample is significantly lower in comparison with oocytes (See Fig. S1A). 4E-BP1 displays visible phosphorylation shift (arrowhead) post NEBD (a typical experiment from at least 3 replicates is shown). (C) Quantification of protein expression of the 4E-BP1–3 in the oocytes during maturation and brain samples. Data are presented as mean ± SD, Student's t-test. (D) Treatment of the lysate from MII oocytes with Lambda Protein Phosphatase (LPP+) suppressed mobility shift of the 4E-BP1 on the WB. Arrowhead points to phospho 4E-BP1 form. See Figure S1A and B.
    Figure Legend Snippet: Expression of 4E-BP forms in mouse oocytes. (A) Quantitative RT-PCR analysis shows all 3 forms of 4e-bp mRNA, which are stable during oocyte maturation (NS = non-significant, n ≥ 3). Results were normalized to the relative internal standard Gapdh mRNA in GV. (B) Immunoblotting shows presence of only 4E-BP1 form on the protein level. Both 4E-BP2 and 4E-BP3 are absent in the oocytes, although they are present in the brain. Expression of the 4E-BP1 in the brain sample is significantly lower in comparison with oocytes (See Fig. S1A). 4E-BP1 displays visible phosphorylation shift (arrowhead) post NEBD (a typical experiment from at least 3 replicates is shown). (C) Quantification of protein expression of the 4E-BP1–3 in the oocytes during maturation and brain samples. Data are presented as mean ± SD, Student's t-test. (D) Treatment of the lysate from MII oocytes with Lambda Protein Phosphatase (LPP+) suppressed mobility shift of the 4E-BP1 on the WB. Arrowhead points to phospho 4E-BP1 form. See Figure S1A and B.

    Techniques Used: Expressing, Quantitative RT-PCR, Mobility Shift, Western Blot

    75) Product Images from "Role of the Irr Protein in the Regulation of Iron Metabolism in Rhodobacter sphaeroides"

    Article Title: Role of the Irr Protein in the Regulation of Iron Metabolism in Rhodobacter sphaeroides

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0042231

    Determination of 5′ ends of mbfA (RSP_0850) (A) and ccpA (RSP_2395) (B) mRNA by 5′ rapid amplification of cDNA ends (RACE). Separation of 5′-RACE products mbfA and ccpA obtained from RNA extracts of the wild type strain under normal iron conditions. PCR products obtained after second PCR (nested) were separated on a 10% polyacrylamid gel and stained with ethidium bromide. Determined 5′ ends are indicated by an arrow. The putative translational start is indicated by an asterisk. The Irr-box (ICE, iron control element) is marked by a frame.
    Figure Legend Snippet: Determination of 5′ ends of mbfA (RSP_0850) (A) and ccpA (RSP_2395) (B) mRNA by 5′ rapid amplification of cDNA ends (RACE). Separation of 5′-RACE products mbfA and ccpA obtained from RNA extracts of the wild type strain under normal iron conditions. PCR products obtained after second PCR (nested) were separated on a 10% polyacrylamid gel and stained with ethidium bromide. Determined 5′ ends are indicated by an arrow. The putative translational start is indicated by an asterisk. The Irr-box (ICE, iron control element) is marked by a frame.

    Techniques Used: Rapid Amplification of cDNA Ends, Polymerase Chain Reaction, Staining

    Related Articles

    Clone Assay:

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen). .. The identity of this transcription template was confirmed by cloning into standard pCRII (Invitrogen) and sequencing.

    Amplification:

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: .. We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen). ..

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. To visualize RNA-loading concentrations, samples were amplified with Ph 18S primers (forward primer 5′-TTAGCAGGCTGAGGTCTCGT-3′; reverse primer 5′-AGCGGATGTTGCTTTTAGGA-3′) and analyzed on an agarose gel.

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !
    Article Snippet: .. PIPKIγ90 transcript was amplified using Qiagen’s one-step RT-PCR kit with the following primers: Forward 5′ GTGCACAACATCGATCAGCAGGA 3′ Reverse 5′ CTATAGTGAAGCGGGGAGTACAC 3′. ..

    Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis
    Article Snippet: To characterize the ctpE operon, approximately 400- to 600-bp junction regions between two genes were amplified with the help of junction primers listed in . .. Reverse transcription PCR was carried out using 1.0 μg total RNA by One-Step RT-PCR (reverse transcriptase PCR) kit (Qiagen).

    Positive Control:

    Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis
    Article Snippet: Reverse transcription PCR was carried out using 1.0 μg total RNA by One-Step RT-PCR (reverse transcriptase PCR) kit (Qiagen). .. For each sample, a reverse transcriptase-negative reaction was also performed to rule out DNA contamination. sigA was amplified as a positive control of RT-PCR using SIGAF and SIGAR primers.

    Quantitative RT-PCR:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. The following primers were designed and utilized for the visualization of the mRNA levels corresponding to PhEOBII (forward primer 5′-TCCCCCATATATGTGAGTTAAGTG-3′; reverse primer 5′-CCATAGGCACCTCCATGCAT-3′) ΔΔCt. qRT-PCR was performed and analyzed using a StepOnePlus real-time PCR system (Applied Biosystems).

    SYBR Green Assay:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. Power SYBR green RNA-to-Ct 1 and 2-step kits (Applied Biosystems) were used to amplify and detect the products according to the manufacturer’s protocol.

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types
    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen). .. Reaction products were electrophoresed in 2% agarose gels and stained with SYBR Green.

    Expressing:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: Primers employed for analyzing the relative expression of target genes, using real-time RT-PCR, are listed in Table S1 in the supplemental material. .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA.

    Modification:

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation
    Article Snippet: .. After treatment with DNase I (Promega), ~50 ng of RNA were analyzed using a One-Step RT-PCR kit (Qiagen) with primers specific for GFP. act1 + was used as an internal control. .. Supporting information (Related to ) ChIP qPCR showing relative enrichment of overexpressed Cnp1-GFP in heterochromatin.

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: .. We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen). ..

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: .. All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. To visualize RNA-loading concentrations, samples were amplified with Ph 18S primers (forward primer 5′-TTAGCAGGCTGAGGTCTCGT-3′; reverse primer 5′-AGCGGATGTTGCTTTTAGGA-3′) and analyzed on an agarose gel.

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1
    Article Snippet: .. Afterwards, 1 µl was used as template for the One-Step RT PCR kit (Qiagen) using either KIN5 primers (tkin5.40s CCAGCAGCATAAGCTATGG ; tkin5.40a ATGAAGACTGTTGCCGCCACC ) or PGM1 primers (PGM3s AAAAGGTTAGTGGTTGTTAAGG ; PGM3a CTTGTGTAAATCATACTTTATTT ) in a total reaction volume of 25 µl. .. The reaction conditions were performed on the Geneamp PCR System 2400 (Perkin Elmer) as follows: 50°C – 30 min, 95°C – 15 min; 95°C – 45 sec, 57°C – 1 min, 72°C – 1 min for 35 cycles; 72°C – 10 min; 4°C hold.

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types
    Article Snippet: .. For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen). .. Reverse transcription was done at 52°C for 45 minutes, 60°C for 1 minute, and 52°C for 30 minutes, followed by enzyme inactivation and hot-start PCR at 95°C for 15 minutes.

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !
    Article Snippet: .. PIPKIγ90 transcript was amplified using Qiagen’s one-step RT-PCR kit with the following primers: Forward 5′ GTGCACAACATCGATCAGCAGGA 3′ Reverse 5′ CTATAGTGAAGCGGGGAGTACAC 3′. ..

    Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia
    Article Snippet: .. The RNA samples were tested for presence of flaviviruses by RT-PCR using a One-Step RT-PCR Kit (Qiagen, Inc.), universal flavivirus FU2/cFD3, and UniF/UniR primers as described elsewhere. .. The PCR products were visualized by agarose (1%) gel electrophoresis.

    Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis
    Article Snippet: .. Reverse transcription PCR was carried out using 1.0 μg total RNA by One-Step RT-PCR (reverse transcriptase PCR) kit (Qiagen). ..

    Article Title: Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1
    Article Snippet: .. The RT-PCR reactions were carried out using the OneStep RT-PCR Kit (Qiagen) as recommended by the supplier, using 0.1 µg RNA and 0.6 µM sense primer and antiprimer for nifH , nifK , nifN , glnK1 and 16S rDNA (see above). .. The control RT-PCR of 16S rDNA was carried out with 10 ng RNA and the respective primers.

    Polymerase Chain Reaction:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. PCR efficiencies were 2.02 for rpoZ , 1.98 for ggt , 2.31 for gloB , and 2.02 for gpx ( , ).

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen). .. Phylogenetic analysis of the protein encoded by this PCR product demonstrates that this gene represents the zebrafish homolog of cytosolic pck1 .

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: Targeted single-cell RT–PCR To analyse editing of specific sites in single cells, single wild-type macrophages were sorted into 96-well PCR plates with 5-μl of lysis buffer, containing 0.45% NP-40, 0.36 U μl−1 RNAse Inhibitor and 0.18 U μl−1 Superase-In (Ambion). .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol.

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1
    Article Snippet: Afterwards, 1 µl was used as template for the One-Step RT PCR kit (Qiagen) using either KIN5 primers (tkin5.40s CCAGCAGCATAAGCTATGG ; tkin5.40a ATGAAGACTGTTGCCGCCACC ) or PGM1 primers (PGM3s AAAAGGTTAGTGGTTGTTAAGG ; PGM3a CTTGTGTAAATCATACTTTATTT ) in a total reaction volume of 25 µl. .. The reaction conditions were performed on the Geneamp PCR System 2400 (Perkin Elmer) as follows: 50°C – 30 min, 95°C – 15 min; 95°C – 45 sec, 57°C – 1 min, 72°C – 1 min for 35 cycles; 72°C – 10 min; 4°C hold.

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types
    Article Snippet: PCR reactions were resolved on 1% agarose TAE gels, and bands were purified and Sanger-sequenced to verify predicted fusion junctions. .. For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia
    Article Snippet: The RNA samples were tested for presence of flaviviruses by RT-PCR using a One-Step RT-PCR Kit (Qiagen, Inc.), universal flavivirus FU2/cFD3, and UniF/UniR primers as described elsewhere. .. The PCR products were visualized by agarose (1%) gel electrophoresis.

    Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis
    Article Snippet: .. Reverse transcription PCR was carried out using 1.0 μg total RNA by One-Step RT-PCR (reverse transcriptase PCR) kit (Qiagen). ..

    Article Title: Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1
    Article Snippet: Paragraph title: Reverse transcription PCR ... The RT-PCR reactions were carried out using the OneStep RT-PCR Kit (Qiagen) as recommended by the supplier, using 0.1 µg RNA and 0.6 µM sense primer and antiprimer for nifH , nifK , nifN , glnK1 and 16S rDNA (see above).

    Nucleic Acid Electrophoresis:

    Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia
    Article Snippet: The RNA samples were tested for presence of flaviviruses by RT-PCR using a One-Step RT-PCR Kit (Qiagen, Inc.), universal flavivirus FU2/cFD3, and UniF/UniR primers as described elsewhere. .. The PCR products were visualized by agarose (1%) gel electrophoresis.

    Isolation:

    Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1
    Article Snippet: Paragraph title: RNA Isolation & RT PCR ... Afterwards, 1 µl was used as template for the One-Step RT PCR kit (Qiagen) using either KIN5 primers (tkin5.40s CCAGCAGCATAAGCTATGG ; tkin5.40a ATGAAGACTGTTGCCGCCACC ) or PGM1 primers (PGM3s AAAAGGTTAGTGGTTGTTAAGG ; PGM3a CTTGTGTAAATCATACTTTATTT ) in a total reaction volume of 25 µl.

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !
    Article Snippet: RNA was isolated from anti-CD3/CD28 bead activated CD4+ T cells using Qiagen’s RNA-easy protect kit. .. PIPKIγ90 transcript was amplified using Qiagen’s one-step RT-PCR kit with the following primers: Forward 5′ GTGCACAACATCGATCAGCAGGA 3′ Reverse 5′ CTATAGTGAAGCGGGGAGTACAC 3′.

    Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis
    Article Snippet: Paragraph title: RNA isolation and reverse transcriptase PCR. ... Reverse transcription PCR was carried out using 1.0 μg total RNA by One-Step RT-PCR (reverse transcriptase PCR) kit (Qiagen).

    Article Title: Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1
    Article Snippet: Control PCR reactions using RNA in the absence of reverse transcriptase showed that the isolated RNA preparations were free of genomic DNA. .. The RT-PCR reactions were carried out using the OneStep RT-PCR Kit (Qiagen) as recommended by the supplier, using 0.1 µg RNA and 0.6 µM sense primer and antiprimer for nifH , nifK , nifN , glnK1 and 16S rDNA (see above).

    Size-exclusion Chromatography:

    Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1
    Article Snippet: Afterwards, 1 µl was used as template for the One-Step RT PCR kit (Qiagen) using either KIN5 primers (tkin5.40s CCAGCAGCATAAGCTATGG ; tkin5.40a ATGAAGACTGTTGCCGCCACC ) or PGM1 primers (PGM3s AAAAGGTTAGTGGTTGTTAAGG ; PGM3a CTTGTGTAAATCATACTTTATTT ) in a total reaction volume of 25 µl. .. The reaction conditions were performed on the Geneamp PCR System 2400 (Perkin Elmer) as follows: 50°C – 30 min, 95°C – 15 min; 95°C – 45 sec, 57°C – 1 min, 72°C – 1 min for 35 cycles; 72°C – 10 min; 4°C hold.

    Purification:

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types
    Article Snippet: PCR reactions were resolved on 1% agarose TAE gels, and bands were purified and Sanger-sequenced to verify predicted fusion junctions. .. For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis
    Article Snippet: The RNA was treated with DNase I and purified using an RNeasy kit (Qiagen). .. Reverse transcription PCR was carried out using 1.0 μg total RNA by One-Step RT-PCR (reverse transcriptase PCR) kit (Qiagen).

    Sequencing:

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen). .. The identity of this transcription template was confirmed by cloning into standard pCRII (Invitrogen) and sequencing.

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

    Staining:

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types
    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen). .. Reaction products were electrophoresed in 2% agarose gels and stained with SYBR Green.

    Nested PCR:

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Hot Start PCR:

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types
    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen). .. Reverse transcription was done at 52°C for 45 minutes, 60°C for 1 minute, and 52°C for 30 minutes, followed by enzyme inactivation and hot-start PCR at 95°C for 15 minutes.

    In Situ Hybridization:

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: Paragraph title: 2.8. In Situ Hybridization ... We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen).

    Software:

    Article Title: Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1
    Article Snippet: The RT-PCR reactions were carried out using the OneStep RT-PCR Kit (Qiagen) as recommended by the supplier, using 0.1 µg RNA and 0.6 µM sense primer and antiprimer for nifH , nifK , nifN , glnK1 and 16S rDNA (see above). .. Products for each primer pair and growth condition were separated on 1.5% agarose gels and quantified using the GelDoc2000 Quantity One software (Bio-Rad Laboratories, Hercules, CA).

    Real-time Polymerase Chain Reaction:

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. The following primers were designed and utilized for the visualization of the mRNA levels corresponding to PhEOBII (forward primer 5′-TCCCCCATATATGTGAGTTAAGTG-3′; reverse primer 5′-CCATAGGCACCTCCATGCAT-3′) ΔΔCt. qRT-PCR was performed and analyzed using a StepOnePlus real-time PCR system (Applied Biosystems).

    Agarose Gel Electrophoresis:

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. To visualize RNA-loading concentrations, samples were amplified with Ph 18S primers (forward primer 5′-TTAGCAGGCTGAGGTCTCGT-3′; reverse primer 5′-AGCGGATGTTGCTTTTAGGA-3′) and analyzed on an agarose gel.

    Concentration Assay:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Lysis:

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: Targeted single-cell RT–PCR To analyse editing of specific sites in single cells, single wild-type macrophages were sorted into 96-well PCR plates with 5-μl of lysis buffer, containing 0.45% NP-40, 0.36 U μl−1 RNAse Inhibitor and 0.18 U μl−1 Superase-In (Ambion). .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen one step rt pcr kit
    Separation of 5′ RACE products obtained from <t>RNA</t> extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. <t>PCR</t> products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).
    One Step Rt Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1624 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rt pcr kit/product/Qiagen
    Average 99 stars, based on 1624 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).

    Journal: Journal of Bacteriology

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †

    doi: 10.1128/JB.00925-08

    Figure Lengend Snippet: Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).

    Article Snippet: For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA.

    Techniques: Mutagenesis, Polymerase Chain Reaction, Staining, Marker, Sequencing

    qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental

    Journal: Plant Physiology

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]

    doi: 10.1104/pp.111.176248

    Figure Lengend Snippet: qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental

    Article Snippet: All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA.

    Techniques: Quantitative RT-PCR

    T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !

    doi: 10.4049/jimmunol.1001445

    Figure Lengend Snippet: T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.

    Article Snippet: PIPKIγ90 transcript was amplified using Qiagen’s one-step RT-PCR kit with the following primers: Forward 5′ GTGCACAACATCGATCAGCAGGA 3′ Reverse 5′ CTATAGTGAAGCGGGGAGTACAC 3′.

    Techniques: Mouse Assay, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Knock-Out, Expressing

    Flavivirus detection by reverse transcription-polymerase chain reaction (RT-PCR).

    Journal: The American Journal of Tropical Medicine and Hygiene

    Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia

    doi: 10.4269/ajtmh.2012.11-0655

    Figure Lengend Snippet: Flavivirus detection by reverse transcription-polymerase chain reaction (RT-PCR).

    Article Snippet: The RNA samples were tested for presence of flaviviruses by RT-PCR using a One-Step RT-PCR Kit (Qiagen, Inc.), universal flavivirus FU2/cFD3, and UniF/UniR primers as described elsewhere.

    Techniques: Reverse Transcription Polymerase Chain Reaction