rt pcr amplifications (Qiagen)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Name:

QIAGEN OneStep RT PCR Kit

Description:

For highly sensitive and specific one step RT PCR Kit contents Qiagen OneStep RT PCR Kit 25 x 50L rxns RNA Template Sample Reverse Transcription Enzyme Activity One step RT PCR Reaction With Hotstart Ideal for Gene expression Analysis Virus Detection For Highly Sensitive and Specific One step RT PCR Includes Qiagen OneStep RT PCR Enzyme Mix 1 x 50L 5x Qiagen OneStep RT PCR Buffer 1 x 250L dNTP Mix 1 x 50L 10mM Each 5x Q Solution 1 x 400L RNase free Water 1 x 1 9mL Benefits Fast and easy one tube setup Efficient one step RT PCR of any RNA template without optimization Unique enzyme mix for high specificity and sensitivity Balanced mixture of enzymes with optimized reverse transcription buffer

Catalog Number:

210210

Price:

161

Category:

QIAGEN OneStep RT PCR Kit

Buy from Supplier

Structured Review

Qiagen rt pcr amplifications

rt pcr amplifications - by Bioz Stars, 2021-02

90/100 stars

Related Products / Commonly Used Together

rna
rt-pcr
total rna
cdna
pcr
rna template
rneasy mini kit
trizol reagent
rt-pcr reactions
trizol
rt-pcrs
rnas
sybr green
rnase inhibitor
rt

Images

1) Product Images from "Simultaneous Extraction from Bacterioplankton of Total RNA and DNA Suitable for Quantitative Structure and Function Analyses"

Article Title: Simultaneous Extraction from Bacterioplankton of Total RNA and DNA Suitable for Quantitative Structure and Function Analyses

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.68.3.1082-1087.2002

SSCP patterns obtained with single-stranded PCR products of 16S rRNA genes (lanes 2 to 9) and single-stranded RT-PCR products (lanes 11 to 17) amplified from pond bacterioplankton extracted by the SLS-phenol and DivoLab-phenol methods [(a) and (b) in the lane descriptions refer to duplicate extracted filters]. Lanes 1, 10, and 18, DNA ladders; lane 2, SLS-phenol undiluted (a); lane 3, SLS-phenol diluted 1:10 (a); lane 4, SLS-phenol undiluted (b); lane 5, SLS-phenol diluted 1:10 (b); lane 6, DivoLab-phenol undiluted (a); lane 7, DivoLab-phenol diluted 1:10 (a); lane 8, DivoLab-phenol undiluted (b); lane 9, DivoLab-phenol diluted 1:10 (b); lane 11, SLS-phenol undiluted (a); lane 12, SLS-phenol diluted 1:10 (a); lane 13, SLS-phenol undiluted (b); lane 14, SLS-phenol diluted 1:10 (b); lane 15, DivoLab-phenol undiluted (a); lane 16, DivoLab-phenol diluted 1:10 (a); lane 17, DivoLab-phenol undiluted (b). Between lanes 17 and 18, a lane with a different marker was excised by using Adobe Photoshop.

Figure Legend Snippet: SSCP patterns obtained with single-stranded PCR products of 16S rRNA genes (lanes 2 to 9) and single-stranded RT-PCR products (lanes 11 to 17) amplified from pond bacterioplankton extracted by the SLS-phenol and DivoLab-phenol methods [(a) and (b) in the lane descriptions refer to duplicate extracted filters]. Lanes 1, 10, and 18, DNA ladders; lane 2, SLS-phenol undiluted (a); lane 3, SLS-phenol diluted 1:10 (a); lane 4, SLS-phenol undiluted (b); lane 5, SLS-phenol diluted 1:10 (b); lane 6, DivoLab-phenol undiluted (a); lane 7, DivoLab-phenol diluted 1:10 (a); lane 8, DivoLab-phenol undiluted (b); lane 9, DivoLab-phenol diluted 1:10 (b); lane 11, SLS-phenol undiluted (a); lane 12, SLS-phenol diluted 1:10 (a); lane 13, SLS-phenol undiluted (b); lane 14, SLS-phenol diluted 1:10 (b); lane 15, DivoLab-phenol undiluted (a); lane 16, DivoLab-phenol diluted 1:10 (a); lane 17, DivoLab-phenol undiluted (b). Between lanes 17 and 18, a lane with a different marker was excised by using Adobe Photoshop.

Techniques Used: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Amplification, Marker

2) Product Images from "Hmx3a Has Essential Functions in Zebrafish Spinal Cord, Ear and Lateral Line Development"

Article Title: Hmx3a Has Essential Functions in Zebrafish Spinal Cord, Ear and Lateral Line Development

Journal: Genetics

doi: 10.1534/genetics.120.303748

Expression of hmx genes in mutant zebrafish embryos and before the midblastula transition. (A–E, G–R) Lateral views of expression in whole embryos at 1.5 hpf (16 cells, A–E) or the spinal cord (G–R) at 27 hpf. (A–E) Animal pole, up. (G–R) Rostral, left; Dorsal, up. (L and M, O and P) White asterisk indicates expression in the lateral line primordium. None of the hmx genes are maternally expressed at 1.5 hpf, as assessed by in situ hybridization (A–E), and, in the case of hmx2 and hmx3a , quantitative RT-PCR on whole embryos (F). No maternal expression of hmx2 and hmx3a was detected and zygotic expression was not observed via quantitative RT-PCR until 14 hpf (F). hmx1 (G), hmx3b (J), and hmx4 (K) are not expressed in the spinal cord of hmx2;hmx3a SU44 deletion mutants. However, hmx1 and hmx4 were still expressed in the head, as shown in Figure 1 (data not shown), confirming that the in situ hybridization experiment had worked. We never detect expression of hmx3b in WT embryos at 27 hpf (see Figure 1 ). (H and I) As expected, given the deletion of the entire hmx3a coding sequence and all but the last 66 bp of hmx2 coding sequence in hmx2;hmx3a SU44 mutants ( Figure 4 ), we did not detect any hmx2 (H) or hmx3a (I) transcripts in these mutants. (L and M) hmx2 mRNA does not exhibit nonsense-mediated decay (NMD) in hmx2 SU37 or hmx2 SU38 mutants. (N) In hmx2 SU39 mutants, deletion of all but the first 84 and the last 60 bases of hmx2 coding sequence ( Figure 4 ) generates a severely truncated hmx2 transcript that cannot be detected by our hmx2 ISH probe. Generation of a short ISH probe targeted to the predicted truncated transcript product of hmx2 SU39 mutants also failed to detect hmx2 expression in these mutants (data not shown). (O–R) hmx3a mRNA does not exhibit NMD in hmx3a SU42 (O), hmx3a sa23054 (P), hmx3a SU3 (Q), or hmx3a SU43 (R) mutant embryos. Bar, 280 µm (A–E), 50 µm (G–R).

Figure Legend Snippet: Expression of hmx genes in mutant zebrafish embryos and before the midblastula transition. (A–E, G–R) Lateral views of expression in whole embryos at 1.5 hpf (16 cells, A–E) or the spinal cord (G–R) at 27 hpf. (A–E) Animal pole, up. (G–R) Rostral, left; Dorsal, up. (L and M, O and P) White asterisk indicates expression in the lateral line primordium. None of the hmx genes are maternally expressed at 1.5 hpf, as assessed by in situ hybridization (A–E), and, in the case of hmx2 and hmx3a , quantitative RT-PCR on whole embryos (F). No maternal expression of hmx2 and hmx3a was detected and zygotic expression was not observed via quantitative RT-PCR until 14 hpf (F). hmx1 (G), hmx3b (J), and hmx4 (K) are not expressed in the spinal cord of hmx2;hmx3a SU44 deletion mutants. However, hmx1 and hmx4 were still expressed in the head, as shown in Figure 1 (data not shown), confirming that the in situ hybridization experiment had worked. We never detect expression of hmx3b in WT embryos at 27 hpf (see Figure 1 ). (H and I) As expected, given the deletion of the entire hmx3a coding sequence and all but the last 66 bp of hmx2 coding sequence in hmx2;hmx3a SU44 mutants ( Figure 4 ), we did not detect any hmx2 (H) or hmx3a (I) transcripts in these mutants. (L and M) hmx2 mRNA does not exhibit nonsense-mediated decay (NMD) in hmx2 SU37 or hmx2 SU38 mutants. (N) In hmx2 SU39 mutants, deletion of all but the first 84 and the last 60 bases of hmx2 coding sequence ( Figure 4 ) generates a severely truncated hmx2 transcript that cannot be detected by our hmx2 ISH probe. Generation of a short ISH probe targeted to the predicted truncated transcript product of hmx2 SU39 mutants also failed to detect hmx2 expression in these mutants (data not shown). (O–R) hmx3a mRNA does not exhibit NMD in hmx3a SU42 (O), hmx3a sa23054 (P), hmx3a SU3 (Q), or hmx3a SU43 (R) mutant embryos. Bar, 280 µm (A–E), 50 µm (G–R).

Techniques Used: Expressing, Mutagenesis, In Situ Hybridization, Quantitative RT-PCR, Sequencing

3) Product Images from "Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore"

Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore

Journal: Biomarker Insights

doi:

Figure Legend Snippet: Nested PCR for WT1 expression.

Techniques Used: Nested PCR, Expressing

4) Product Images from "RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †"

Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †

Journal: Journal of Bacteriology

doi: 10.1128/JB.00925-08

Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).

Figure Legend Snippet: Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).

Techniques Used: Mutagenesis, Polymerase Chain Reaction, Staining, Marker, Sequencing

5) Product Images from "RNA editing generates cellular subsets with diverse sequence within populations"

Article Title: RNA editing generates cellular subsets with diverse sequence within populations

Journal: Nature Communications

doi: 10.1038/ncomms12145

Validation of model predictions using targeted amplification of editable sites from single cells. ( a ) Wiggle plots showing coverage in 3′-untranslated regions for B2m, Anxa5 and Cybb in the 24 bone marrow-derived macrophages profiled. ( b – d ) Sequence alignments from targeted RT–PCR amplification and Sanger sequencing of bacterial colonies for ( b ) B2m, ( c ) Anxa5 and ( d ) Cybb transcripts from gDNA and cDNA from a bulk sample (amplified using standard PCR), and cDNA of single cells (amplified using a modified OneStep RT–PCR protocol, per Supplementary Fig. 4 ). Alignments, showing the sequence space surrounding a particular editable site, are clustered by sample. Alignments are colour-coded to indicate whether the sequence aligned contained (red) or lacked (grey) editing in the length of the amplicon. Though a C-to-U change may not be shown in the narrow window illustrated, a red sequence would indicate that the amplicon sequence contained at least one C-to-U edit elsewhere (red). Lack of editing in the gDNA indicates that the C-to-U transitions observed are bona fide APOBEC1-mediated RNA editing events.

Figure Legend Snippet: Validation of model predictions using targeted amplification of editable sites from single cells. ( a ) Wiggle plots showing coverage in 3′-untranslated regions for B2m, Anxa5 and Cybb in the 24 bone marrow-derived macrophages profiled. ( b – d ) Sequence alignments from targeted RT–PCR amplification and Sanger sequencing of bacterial colonies for ( b ) B2m, ( c ) Anxa5 and ( d ) Cybb transcripts from gDNA and cDNA from a bulk sample (amplified using standard PCR), and cDNA of single cells (amplified using a modified OneStep RT–PCR protocol, per Supplementary Fig. 4 ). Alignments, showing the sequence space surrounding a particular editable site, are clustered by sample. Alignments are colour-coded to indicate whether the sequence aligned contained (red) or lacked (grey) editing in the length of the amplicon. Though a C-to-U change may not be shown in the narrow window illustrated, a red sequence would indicate that the amplicon sequence contained at least one C-to-U edit elsewhere (red). Lack of editing in the gDNA indicates that the C-to-U transitions observed are bona fide APOBEC1-mediated RNA editing events.

Techniques Used: Amplification, Derivative Assay, Sequencing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Modification

6) Product Images from "The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun"

Journal: Cellular Signalling

doi: 10.1016/j.cellsig.2012.04.016

Protein kinase C inhibitors block human SOCS-3 gene induction in HUVECs. A). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either a combination of 10 μM forskolin plus 10 μM rolipram (F/R; upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the protein kinase C (PKC) inhibitors Ro-31-7549 or GF-109203X. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. B). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the PKC inhibitors Ro-31-7549 or Gö-6983. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. C). HUVECs were stimulated for 5 h in the presence or absence of F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus Ro-31-7549 (5 μM), Gö-6983 (25 μM) or GF-109203X (25 μM). Total RNA was then extracted from cells and subjected to one-step RT-PCR, with specific primers towards SOCS-3 or actin, as described in Materials and methods . Amplified DNA fragments were visualised by agarose gel electrophoresis.

Figure Legend Snippet: Protein kinase C inhibitors block human SOCS-3 gene induction in HUVECs. A). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either a combination of 10 μM forskolin plus 10 μM rolipram (F/R; upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the protein kinase C (PKC) inhibitors Ro-31-7549 or GF-109203X. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. B). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the PKC inhibitors Ro-31-7549 or Gö-6983. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. C). HUVECs were stimulated for 5 h in the presence or absence of F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus Ro-31-7549 (5 μM), Gö-6983 (25 μM) or GF-109203X (25 μM). Total RNA was then extracted from cells and subjected to one-step RT-PCR, with specific primers towards SOCS-3 or actin, as described in Materials and methods . Amplified DNA fragments were visualised by agarose gel electrophoresis.

Techniques Used: Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

7) Product Images from "A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower"

Article Title: A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower

Journal: Journal of Experimental Botany

doi: 10.1093/jxb/ers153

PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcript analyzed is PhAAE (mean±SE; n =3).

Figure Legend Snippet: PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcript analyzed is PhAAE (mean±SE; n =3).

Techniques Used: Quantitative RT-PCR, Isolation

PhAAE transcript accumulation analysis (one-step qRT-PCR). Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16.00h (A). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00h (B). Ethylene treatment (2 µl l –1 analysis used excised MD and 44 568 whole flowers treated for 0, 1, 2, 4, and 8h (C, D). 50ng total RNA was used per reaction in all cases. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references (mean±SE; n =3).

Figure Legend Snippet: PhAAE transcript accumulation analysis (one-step qRT-PCR). Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16.00h (A). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00h (B). Ethylene treatment (2 µl l –1 analysis used excised MD and 44 568 whole flowers treated for 0, 1, 2, 4, and 8h (C, D). 50ng total RNA was used per reaction in all cases. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references (mean±SE; n =3).

Techniques Used: Quantitative RT-PCR

Techniques Used: Quantitative RT-PCR, Isolation

8) Product Images from "EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]"

Journal: Plant Physiology

doi: 10.1104/pp.111.176248

qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental

Figure Legend Snippet: qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental

Techniques Used: Quantitative RT-PCR

9) Product Images from "Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1"

Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1

Journal: PLoS ONE

doi: 10.1371/journal.pone.0004873

Optimization of KIN5 sh RNA. A. Degradation of KIN5 message after sh RNA induction in KO cells using 0–0.5 µg/ml Cd 2+ . Above: RT-PCR products resolved on a 1% agarose gel. At Cd 2+ concentrations lower than 0.5 µg/ml, KIN5 mRNA is stable for 24 h. After 24 h in 0.5 µg/ml Cd 2+ , KIN5 mRNA is dramatically decreased, while PGM1 is unaffected. B. Effect of 0.5 µg/ml Cd 2+ on KIN5 and PGM1 messages in Inv2 cells. KIN5 and PGM1 mRNA levels remain unaffected after 24 h. DNA markers shown: lines indicate 600 and 300 bp. C. Effect of 0.5 µg/ml Cd 2+ on Kin5 protein levels in KO and Inv2 cells. Corresponding KO (left) and Inv2 (right) cell homogenates 12 h post-induction at either 0 or 0.5 µg/ml Cd 2+ and blotted with K5T1 Ab to Kin5. While the Kin5 protein is severely knocked down in the KO cells upon sh RNA induction, Kin5 levels remain unaffected in Inv2 cells under similar conditions.

Figure Legend Snippet: Optimization of KIN5 sh RNA. A. Degradation of KIN5 message after sh RNA induction in KO cells using 0–0.5 µg/ml Cd 2+ . Above: RT-PCR products resolved on a 1% agarose gel. At Cd 2+ concentrations lower than 0.5 µg/ml, KIN5 mRNA is stable for 24 h. After 24 h in 0.5 µg/ml Cd 2+ , KIN5 mRNA is dramatically decreased, while PGM1 is unaffected. B. Effect of 0.5 µg/ml Cd 2+ on KIN5 and PGM1 messages in Inv2 cells. KIN5 and PGM1 mRNA levels remain unaffected after 24 h. DNA markers shown: lines indicate 600 and 300 bp. C. Effect of 0.5 µg/ml Cd 2+ on Kin5 protein levels in KO and Inv2 cells. Corresponding KO (left) and Inv2 (right) cell homogenates 12 h post-induction at either 0 or 0.5 µg/ml Cd 2+ and blotted with K5T1 Ab to Kin5. While the Kin5 protein is severely knocked down in the KO cells upon sh RNA induction, Kin5 levels remain unaffected in Inv2 cells under similar conditions.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

Stability of KIN5 and PGM1 messages. A. CU522 cells grown in starvation conditions+5.0 µg/ml Cd 2+ prior to transformation showing comparable relative stabilities of the KIN5 and PGM1 mRNA. B. Time course of degradation of KIN5 message after sh RNA induction in K5KOAs.40 cells using 5.0 µg/ml Cd 2+ . RT-PCR products resolved on a 1% agarose gel. Left lane: DNA markers. The KIN5 message decreases at 45 min post-induction and is eliminated at 60 min. The PGM1 message remains constant.

Figure Legend Snippet: Stability of KIN5 and PGM1 messages. A. CU522 cells grown in starvation conditions+5.0 µg/ml Cd 2+ prior to transformation showing comparable relative stabilities of the KIN5 and PGM1 mRNA. B. Time course of degradation of KIN5 message after sh RNA induction in K5KOAs.40 cells using 5.0 µg/ml Cd 2+ . RT-PCR products resolved on a 1% agarose gel. Left lane: DNA markers. The KIN5 message decreases at 45 min post-induction and is eliminated at 60 min. The PGM1 message remains constant.

Techniques Used: Transformation Assay, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

10) Product Images from "The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes"

Article Title: The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkv152

$Characterization of dsRBP gene structure, expression and localization. ( A ) Structures of loqs-ra, loqs-rb , and l oqs-rc splice variants and r2d2 mRNA. Solid boxes represent ORFs, unfilled boxes represent UTRs, and gray bars represent predicted DRMs. Primer locations used for RT-PCR and cDNA sequencing are marked by block arrows; 3′ RACE primers indicated by open arrows. ( B ) One-step RT-PCR using head (H), thorax (T), midgut (M), sugar-fed ovaries (SFO), blood-fed ovaries (BFO), male pupae (MP), female pupae (FP) and L4 larvae (L4) total RNA as templates to detect dsRBP transcripts. ( C ) Localization of overexpressed HA or FLAG-tagged dsRBPs in Aag2 cells. HA-EGFP and HA-R2D2 were expressed via dsSINV; HA-Loqs-PA and HA-Loqs-PB were expressed via plasmid transfection. ( D ) Localization of mosquito Dcr and Ago proteins in uninfected and infected Aag2 cell fractions: cytoplasm (CP), membrane (M), nucleus (N), and cytoskeleton (CS). Antibodies recognizing β-actin (cytoplasmic) and heterochromatin protein 1 (HP1, nuclear) were used to verify the success of each fractionation experiment.$
Figure Legend Snippet: Characterization of dsRBP gene structure, expression and localization. ( A ) Structures of loqs-ra, loqs-rb , and l oqs-rc splice variants and r2d2 mRNA. Solid boxes represent ORFs, unfilled boxes represent UTRs, and gray bars represent predicted DRMs. Primer locations used for RT-PCR and cDNA sequencing are marked by block arrows; 3′ RACE primers indicated by open arrows. ( B ) One-step RT-PCR using head (H), thorax (T), midgut (M), sugar-fed ovaries (SFO), blood-fed ovaries (BFO), male pupae (MP), female pupae (FP) and L4 larvae (L4) total RNA as templates to detect dsRBP transcripts. ( C ) Localization of overexpressed HA or FLAG-tagged dsRBPs in Aag2 cells. HA-EGFP and HA-R2D2 were expressed via dsSINV; HA-Loqs-PA and HA-Loqs-PB were expressed via plasmid transfection. ( D ) Localization of mosquito Dcr and Ago proteins in uninfected and infected Aag2 cell fractions: cytoplasm (CP), membrane (M), nucleus (N), and cytoskeleton (CS). Antibodies recognizing β-actin (cytoplasmic) and heterochromatin protein 1 (HP1, nuclear) were used to verify the success of each fractionation experiment.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Sequencing, Blocking Assay, Plasmid Preparation, Transfection, Infection, Fractionation

11) Product Images from "The arginine methyltransferase NDUFAF7 is essential for complex I assembly and early vertebrate embryogenesis"

Article Title: The arginine methyltransferase NDUFAF7 is essential for complex I assembly and early vertebrate embryogenesis

Journal: Human Molecular Genetics

doi: 10.1093/hmg/ddu239

$NDUFAF7 is a soluble mitochondrial protein. ( A ) Analysis of NDUFAF7 RT-PCR products showing two transcript variants in human fibroblasts. ( B ) Immunocytochemistry of control cells expressing NDUFAF7-HA. Antibodies to hemagglutinin (HA) and cytochrome c were used as indicated ( C ) SDS–PAGE immunoblot analysis of native NDUFAF7, porin and Cu/Zn SOD in whole-cell extracts (Wh), mitochondria (Mi) and cytosolic supernatants (cSN) ( D ) SDS–PAGE immunoblot analysis of alkaline carbonate extracted mitochondrial fractions: Input (IN), supernatant (SN) and pellet (PE). This analysis was performed in cells expressing an untagged version of the long isoform of NDUFAF7.$
Figure Legend Snippet: NDUFAF7 is a soluble mitochondrial protein. ( A ) Analysis of NDUFAF7 RT-PCR products showing two transcript variants in human fibroblasts. ( B ) Immunocytochemistry of control cells expressing NDUFAF7-HA. Antibodies to hemagglutinin (HA) and cytochrome c were used as indicated ( C ) SDS–PAGE immunoblot analysis of native NDUFAF7, porin and Cu/Zn SOD in whole-cell extracts (Wh), mitochondria (Mi) and cytosolic supernatants (cSN) ( D ) SDS–PAGE immunoblot analysis of alkaline carbonate extracted mitochondrial fractions: Input (IN), supernatant (SN) and pellet (PE). This analysis was performed in cells expressing an untagged version of the long isoform of NDUFAF7.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Immunocytochemistry, Expressing, SDS Page

Embryonic lethality in mice with a germline disruption of NDUFAF7. Multiplex PCR products show NFUFAF7 wild-type (815 bp) and mutant (438 bp) bands. ( A ) One-month-old animals ( n = 27) were genotyped using three different controls: heterozygous DNA (+/−), homozygous DNA (+/+) and negative control (no DNA). ( B ) Thirteen animals genotyped at embryonic Day 10.5, controls are the same as in (A). ( C ) Twelve animals genotyped at embryonic Day 3.5 using five different controls: M2 buffer in which embryos were collected and washed (wash), proteinase-K lysis buffer + heterozygote DNA (lysis buffer +/−), heterozygous DNA (+/−), homozygous DNA (+/+) and negative control (no DNA, PCR mix).

Figure Legend Snippet: Embryonic lethality in mice with a germline disruption of NDUFAF7. Multiplex PCR products show NFUFAF7 wild-type (815 bp) and mutant (438 bp) bands. ( A ) One-month-old animals ( n = 27) were genotyped using three different controls: heterozygous DNA (+/−), homozygous DNA (+/+) and negative control (no DNA). ( B ) Thirteen animals genotyped at embryonic Day 10.5, controls are the same as in (A). ( C ) Twelve animals genotyped at embryonic Day 3.5 using five different controls: M2 buffer in which embryos were collected and washed (wash), proteinase-K lysis buffer + heterozygote DNA (lysis buffer +/−), heterozygous DNA (+/−), homozygous DNA (+/+) and negative control (no DNA, PCR mix).

Techniques Used: Mouse Assay, Multiplex Assay, Polymerase Chain Reaction, Mutagenesis, Negative Control, Lysis

NDUFAF7 knockdown in zebrafish. ( A ) RT-PCR analysis of controls (C 1–4 ) and MO knockdown fish (M 1–9 ) at 3 and 6 days old using specific primers for amplification of NDUFAF7 and the complex I subunit, NDUFA9. ( B ) Controls (C 5–8 ) and MO knockdown fish (M 10–17 ) were analyzed at 3 and 6 days old by BN–PAGE to detect complex I (Co I) and V (Co V) using subunit-specific antibodies, NDUFAF9 and ATPα, respectively. ( C ) Control ( 1 ) and MO knockdown ( 2–3 ) fish phenotype at 4 days old.

Figure Legend Snippet: NDUFAF7 knockdown in zebrafish. ( A ) RT-PCR analysis of controls (C 1–4 ) and MO knockdown fish (M 1–9 ) at 3 and 6 days old using specific primers for amplification of NDUFAF7 and the complex I subunit, NDUFA9. ( B ) Controls (C 5–8 ) and MO knockdown fish (M 10–17 ) were analyzed at 3 and 6 days old by BN–PAGE to detect complex I (Co I) and V (Co V) using subunit-specific antibodies, NDUFAF9 and ATPα, respectively. ( C ) Control ( 1 ) and MO knockdown ( 2–3 ) fish phenotype at 4 days old.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Fluorescence In Situ Hybridization, Amplification, Polyacrylamide Gel Electrophoresis

12) Product Images from "Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia"

Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia

Journal: The American Journal of Tropical Medicine and Hygiene

doi: 10.4269/ajtmh.2012.11-0655

Figure Legend Snippet: Flavivirus detection by reverse transcription-polymerase chain reaction (RT-PCR).

Techniques Used: Reverse Transcription Polymerase Chain Reaction

13) Product Images from "Loss of lysine-specific demethylase 1 nonautonomously causes stem cell tumors in the Drosophila ovary"

Article Title: Loss of lysine-specific demethylase 1 nonautonomously causes stem cell tumors in the Drosophila ovary

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1015874108

Lsd1 mutant germaria display elevated levels of dpp mRNA. Ethidium bromide-stained gel shows the products of a RT-PCR on RNA isolated from bam Δ86 and Lsd1 ΔN bam Δ86 ovaries using dally - ( A ) or dpp - ( B ) specific primers. No difference

Figure Legend Snippet: Lsd1 mutant germaria display elevated levels of dpp mRNA. Ethidium bromide-stained gel shows the products of a RT-PCR on RNA isolated from bam Δ86 and Lsd1 ΔN bam Δ86 ovaries using dally - ( A ) or dpp - ( B ) specific primers. No difference

Techniques Used: Mutagenesis, Staining, Reverse Transcription Polymerase Chain Reaction, Isolation

14) Product Images from "Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1"

Article Title: Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1

Journal: Archaea

doi:

Transcriptional analysis of the M. mazei nif gene cluster. (A) Northern blot analysis of total RNA isolated from M. mazei cells grown under conditions of nitrogen limitation (N 2 ) and nitrogen sufficiency ( NH 4 + ) using probes for nifH , nifK and nifN . Each lane was loaded with 0.25 µg total RNA from cells grown under nitrogen limitation (-) or nitrogen sufficiency (+); numbers on the left are molecular sizes in kilobases. (B) RT-PCR analysis. Reverse transcription was carried out on 0.1 µg RNA isolated from cells grown under conditions of nitrogen limitation (-) or nitrogen sufficiency (+) using the OneStep RT-PCR Kit from Qiagen and primers as described in Materials and methods. Control PCR reactions with RNA in the absence of reverse transcriptase showed that the isolated RNA preparations were free of genomic DNA. As a control, a 16S rDNA-specific RT-PCR was carried out on 10 ng of RNA from cells from each growth condition. Products of the expected size (450 bp ( nifH ), 417 bp ( nifK ), 438 bp ( nifN ), 415 bp ( glnK 1 ) and 420 bp (16S rDNA)) were separated in 1.5% agarose gels and visualized by ethidium bromide staining.

Figure Legend Snippet: Transcriptional analysis of the M. mazei nif gene cluster. (A) Northern blot analysis of total RNA isolated from M. mazei cells grown under conditions of nitrogen limitation (N 2 ) and nitrogen sufficiency ( NH 4 + ) using probes for nifH , nifK and nifN . Each lane was loaded with 0.25 µg total RNA from cells grown under nitrogen limitation (-) or nitrogen sufficiency (+); numbers on the left are molecular sizes in kilobases. (B) RT-PCR analysis. Reverse transcription was carried out on 0.1 µg RNA isolated from cells grown under conditions of nitrogen limitation (-) or nitrogen sufficiency (+) using the OneStep RT-PCR Kit from Qiagen and primers as described in Materials and methods. Control PCR reactions with RNA in the absence of reverse transcriptase showed that the isolated RNA preparations were free of genomic DNA. As a control, a 16S rDNA-specific RT-PCR was carried out on 10 ng of RNA from cells from each growth condition. Products of the expected size (450 bp ( nifH ), 417 bp ( nifK ), 438 bp ( nifN ), 415 bp ( glnK 1 ) and 420 bp (16S rDNA)) were separated in 1.5% agarose gels and visualized by ethidium bromide staining.

Techniques Used: Northern Blot, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Staining

15) Product Images from "Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation"

Article Title: Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1007572

Cse4 is subject to efficient ubiquitin-dependent degradation in the fission yeast. A, RT-PCR analysis of cells expressing Cnp1-GFP or Cse4-GFP. Total RNA extracted from cells overexpressing Cnp1-GFP or Cse4-GFP was used. Cnp1-GFP or Cse4-GFP transcripts were analyzed with primers specific for GFP. Actin was used as an internal control. B, Lysates from cells collected at indicated time points (hrs) following cycloheximide treatment were analyzed by western blotting with an anti-GFP antibody. C, Cse4 level is enhanced after proteasome inactivation in fission yeast. Cells overexpressing Cse4-GFP in wild type or mts2-1 background were incubated at 37°C for 4 hours, and were subject to western blot analysis using an anti-GFP antibody. Tubulin was used as a loading control. D, Extracts from cells expressing indicated proteins were split, and subject to TUBE pull-down and reverse pull-down assays, respectively. For TUBE pull-down assays, extracts were immunoprecipitated with tandem ubiquitin-binding entities (+TUBE), or control Argarose beads (-TUBE), followed by western blot analysis using an anti-GFP antibody. For reverse pull-down assays (right panel), extracts were immunoprecipitated with an anti-GFP antibody, then analyzed by western blotting using a pan ubiquitin antibody. Induction time: 20 hours for Cnp1-GFP; 24 hours for Cse4-GFP.

Figure Legend Snippet: Cse4 is subject to efficient ubiquitin-dependent degradation in the fission yeast. A, RT-PCR analysis of cells expressing Cnp1-GFP or Cse4-GFP. Total RNA extracted from cells overexpressing Cnp1-GFP or Cse4-GFP was used. Cnp1-GFP or Cse4-GFP transcripts were analyzed with primers specific for GFP. Actin was used as an internal control. B, Lysates from cells collected at indicated time points (hrs) following cycloheximide treatment were analyzed by western blotting with an anti-GFP antibody. C, Cse4 level is enhanced after proteasome inactivation in fission yeast. Cells overexpressing Cse4-GFP in wild type or mts2-1 background were incubated at 37°C for 4 hours, and were subject to western blot analysis using an anti-GFP antibody. Tubulin was used as a loading control. D, Extracts from cells expressing indicated proteins were split, and subject to TUBE pull-down and reverse pull-down assays, respectively. For TUBE pull-down assays, extracts were immunoprecipitated with tandem ubiquitin-binding entities (+TUBE), or control Argarose beads (-TUBE), followed by western blot analysis using an anti-GFP antibody. For reverse pull-down assays (right panel), extracts were immunoprecipitated with an anti-GFP antibody, then analyzed by western blotting using a pan ubiquitin antibody. Induction time: 20 hours for Cnp1-GFP; 24 hours for Cse4-GFP.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Western Blot, Incubation, Immunoprecipitation, Binding Assay

16) Product Images from "Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)"

Article Title: Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)

Journal: Emerging Microbes & Infections

doi: 10.1038/emi.2016.56

Assessing the role of the mSCARB2 protein in CDV:BS M-P1 and CDV:BS-VP1 K98E,E145A,L169F infection of murine cells. ( A – D ) Pre-incubation of 10 6 CCID 50 CDVs with the mSCARB2 protein for in vitro uncoating ( A, B ) or for cellular infection studies of NIH/3T3 cells ( C , D ). The viral RNA in the samples was extracted and quantified by RT–PCR (qRT–PCR). ( E–H ) Blocking viral entry by incubating NIH/3T3 cells with anti-mSCARB2 sera prior to inoculation with virus at an MOI of 10. Infection was assessed by determining viral titers in culture supernatant with dilutions of 10 -1 to 10 −10 in Vero cells at three days p.i. following chloroform viral disaggregation ( E , F ), and relative quantitation of EV71 RNA in extracted total cellular RNA by the ΔΔC T method using β-actin as an internal control ( G , H ). Tests were separately performed for CDV:BS M-P1 ( A , C , E , H ) and CDV:BS-VP1 K98E,E145A,L169F ( B , D , F , G ). For A – H , a t -test with Welch's correction for unequal variance was used to compare mean values ( n =4). Error bars represent the s.d.; * P

Figure Legend Snippet: Assessing the role of the mSCARB2 protein in CDV:BS M-P1 and CDV:BS-VP1 K98E,E145A,L169F infection of murine cells. ( A – D ) Pre-incubation of 10 6 CCID 50 CDVs with the mSCARB2 protein for in vitro uncoating ( A, B ) or for cellular infection studies of NIH/3T3 cells ( C , D ). The viral RNA in the samples was extracted and quantified by RT–PCR (qRT–PCR). ( E–H ) Blocking viral entry by incubating NIH/3T3 cells with anti-mSCARB2 sera prior to inoculation with virus at an MOI of 10. Infection was assessed by determining viral titers in culture supernatant with dilutions of 10 -1 to 10 −10 in Vero cells at three days p.i. following chloroform viral disaggregation ( E , F ), and relative quantitation of EV71 RNA in extracted total cellular RNA by the ΔΔC T method using β-actin as an internal control ( G , H ). Tests were separately performed for CDV:BS M-P1 ( A , C , E , H ) and CDV:BS-VP1 K98E,E145A,L169F ( B , D , F , G ). For A – H , a t -test with Welch's correction for unequal variance was used to compare mean values ( n =4). Error bars represent the s.d.; * P

Techniques Used: Infection, Incubation, In Vitro, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Blocking Assay, Quantitation Assay

17) Product Images from "The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development"

Article Title: The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development

Journal: Journal of Experimental Botany

doi: 10.1093/jxb/erw158

Domain structure and cellular localization of the Arabidopsis homolog of human U11-48K protein and generation of artificial miRNA-mediated knockdown plants. (A) Schematic representation of the domain structure of the Arabidopsis homolog of human U11-48K. The conserved CHHC-type zinc finger (ZF) motif and arginine (Arg)-rich region are shown. (B) GFP signals from the 48K–GFP-expressing tobacco plant were observed using a confocal microscope. DAPI was used to stain the nucleus. Scale bar=10 μm. (C) Position of the artificial miRNA1 (amiR1) target site and the sequences of amiR1, along with its target, U11-48K (48K). Exons and introns are represented as gray boxes and thick lines, respectively, and the untranslated regions are represented as white boxes. (D) Confirmation of mature amiR1 generation. Total RNA extracted from each transgenic line (amiR1-1, amiR1-2, and amiR1-3) was separated via denaturing 12% PAGE, and the expression of 21 nucleotide long mature amiR1 in each line was confirmed by northern blotting. (E, F) Down-regulation of U11-48K in the transgenic plants. The levels of U11-48K in each transgenic plant were confirmed by (E) RT–PCR and (F) real-time RT–PCR analysis. The numbers 1, 2, and 3 in (F) indicate amiR1-1, amiR1-2, and amiR1-3, respectively. Values are means ±SE obtained from three independent biological replicates. (This figure is available in colour at JXB online.)

Figure Legend Snippet: Domain structure and cellular localization of the Arabidopsis homolog of human U11-48K protein and generation of artificial miRNA-mediated knockdown plants. (A) Schematic representation of the domain structure of the Arabidopsis homolog of human U11-48K. The conserved CHHC-type zinc finger (ZF) motif and arginine (Arg)-rich region are shown. (B) GFP signals from the 48K–GFP-expressing tobacco plant were observed using a confocal microscope. DAPI was used to stain the nucleus. Scale bar=10 μm. (C) Position of the artificial miRNA1 (amiR1) target site and the sequences of amiR1, along with its target, U11-48K (48K). Exons and introns are represented as gray boxes and thick lines, respectively, and the untranslated regions are represented as white boxes. (D) Confirmation of mature amiR1 generation. Total RNA extracted from each transgenic line (amiR1-1, amiR1-2, and amiR1-3) was separated via denaturing 12% PAGE, and the expression of 21 nucleotide long mature amiR1 in each line was confirmed by northern blotting. (E, F) Down-regulation of U11-48K in the transgenic plants. The levels of U11-48K in each transgenic plant were confirmed by (E) RT–PCR and (F) real-time RT–PCR analysis. The numbers 1, 2, and 3 in (F) indicate amiR1-1, amiR1-2, and amiR1-3, respectively. Values are means ±SE obtained from three independent biological replicates. (This figure is available in colour at JXB online.)

Techniques Used: Expressing, Microscopy, Staining, Transgenic Assay, Polyacrylamide Gel Electrophoresis, Northern Blot, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

18) Product Images from "Single injection recombinant vesicular stomatitis virus vaccines protect ferrets against lethal Nipah virus disease"

Article Title: Single injection recombinant vesicular stomatitis virus vaccines protect ferrets against lethal Nipah virus disease

Journal: Virology Journal

doi: 10.1186/1743-422X-10-353

Viral load in NiV M challenged ferrets. Viral load in ferrets as detected by genome equivalents (GEq) by qRT-PCR from (A) blood as GEq/ml and (B) from tissues a GEq/g (Animal 4-1 was negative for NiV M antigen in spleen). Right upper (R.U.), right middle (R.M.), right lower (R.L.), left upper (L.U.), left middle (L.M.), left lower (L.L.), lymph node (LN). (C) PFU/g of NiV M isolated from tissues of ferrets in Group 1. Liver (L), spleen (S), kidney (K), adrenal gland (A). Error bars represent the s.d.

Figure Legend Snippet: Viral load in NiV M challenged ferrets. Viral load in ferrets as detected by genome equivalents (GEq) by qRT-PCR from (A) blood as GEq/ml and (B) from tissues a GEq/g (Animal 4-1 was negative for NiV M antigen in spleen). Right upper (R.U.), right middle (R.M.), right lower (R.L.), left upper (L.U.), left middle (L.M.), left lower (L.L.), lymph node (LN). (C) PFU/g of NiV M isolated from tissues of ferrets in Group 1. Liver (L), spleen (S), kidney (K), adrenal gland (A). Error bars represent the s.d.

Techniques Used: Quantitative RT-PCR, Isolation

19) Product Images from "Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types"

Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1003464

Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).

Figure Legend Snippet: Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).

Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Sequencing, Expressing, Negative Control

DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P

Figure Legend Snippet: DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P

Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Microarray, Expressing

Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P

Figure Legend Snippet: Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P

Techniques Used: RNA Sequencing Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Amplification

Figure Legend Snippet: Discovery of APIP/SLC1A2 in colon cancer. ( A ) Array CGH heatmap displaying genomic breakpoints disrupting SLC1A2 in the SNU-C1 colon cancer cell line and the SNU-16 gastric cancer cell line. SNU-16 is known to harbor CD44/SLC1A2 and its array CGH profile is depicted for comparison. Unsmoothed log 2 ratios are displayed. ( B ) Paired-end RNA seq uncovers APIP/SLC1A2 in SNU-C1. A subset of paired-end reads mapping to APIP/SLC1A2 as well as the gene fusion structure are displayed (left panel). The structure of the known gastric cancer gene fusion CD44/SLC1A2 is depicted for comparison (right panel). An internal start codon within exon 2 of SLC1A2 is predicted to initiate translation in both rearrangements. Inset : experimental validation of APIP/SLC1A2 by RT-PCR with primers flanking the gene fusion junction. ( C , D ) Gene expression profiling depicts high-level expression of APIP in normal colon ( C ) and overexpression of SLC1A2 in SNU-C1 ( D ). Mean-centered gene expression ratios are depicted by a log 2 pseudocolor scale and ranked in descending order from left to right.

Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Over Expression

$Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P$
Figure Legend Snippet: Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P

Techniques Used: RNA Sequencing Assay, Activation Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Transfection

Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P

Figure Legend Snippet: Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P

Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection

20) Product Images from "HIV-1 Tropism Determination Using a Phenotypic Env Recombinant Viral Assay Highlights Overestimation of CXCR4-Usage by Genotypic Prediction Algorithms for CRRF01_AE and CRF02_AG"

Article Title: HIV-1 Tropism Determination Using a Phenotypic Env Recombinant Viral Assay Highlights Overestimation of CXCR4-Usage by Genotypic Prediction Algorithms for CRRF01_AE and CRF02_AG

Journal: PLoS ONE

doi: 10.1371/journal.pone.0060566

Distribution of PCR amplification success stratified by viral load. The Env ectodomain was amplified from plasma viral RNA by a one-step RT-PCR followed by an inner PCR. Five independent PCR amplifications were pooled to minimize primer-related selection. 292 samples from patients infected with HIV subtypes A1, B, C, D, F, G, CRF01_AE and CRF02_AG were included. Viral load ranged from 466 to 1,350,000 RNA copies/mL.

Figure Legend Snippet: Distribution of PCR amplification success stratified by viral load. The Env ectodomain was amplified from plasma viral RNA by a one-step RT-PCR followed by an inner PCR. Five independent PCR amplifications were pooled to minimize primer-related selection. 292 samples from patients infected with HIV subtypes A1, B, C, D, F, G, CRF01_AE and CRF02_AG were included. Viral load ranged from 466 to 1,350,000 RNA copies/mL.

Techniques Used: Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Selection, Infection

Study design/RVA design. Viral RNA was extracted from patient plasma RT-PCR amplified. Env amplicons spanning the Env ectodomain were further amplified through an inner PCR. Five independent PCRs were pooled to minimize PCR-selection. Recombinant viruses were produced by co-transfecting HEK293T cells with Afe I-linearized, luciferase-tagged, Env-deleted, viral backbone and patient-derived PCR amplicon. Normalized amounts of recombinant viruses were used to infect U87.CD4.CCR5 or U87.CD4.CXCR4 indicator cells. Infection was monitored by quantifying luminescence in the cell lysates. Depending on the outcome of the infection, viruses were classified as either CCR5 tropic, CXCR4 tropic or dual/mixed. The same patient-derived PCR amplicon used for viral production was sequenced and tropism inferred by Geno2Pheno [coreceptor] and webPSSM algorithms. The phenotypic and genotypic results were compared. Abbreviations: Env EC: Env ectodomain; gp41-TM-CT: gp41 Transmembrane+cytoplasmic tail.

Figure Legend Snippet: Study design/RVA design. Viral RNA was extracted from patient plasma RT-PCR amplified. Env amplicons spanning the Env ectodomain were further amplified through an inner PCR. Five independent PCRs were pooled to minimize PCR-selection. Recombinant viruses were produced by co-transfecting HEK293T cells with Afe I-linearized, luciferase-tagged, Env-deleted, viral backbone and patient-derived PCR amplicon. Normalized amounts of recombinant viruses were used to infect U87.CD4.CCR5 or U87.CD4.CXCR4 indicator cells. Infection was monitored by quantifying luminescence in the cell lysates. Depending on the outcome of the infection, viruses were classified as either CCR5 tropic, CXCR4 tropic or dual/mixed. The same patient-derived PCR amplicon used for viral production was sequenced and tropism inferred by Geno2Pheno [coreceptor] and webPSSM algorithms. The phenotypic and genotypic results were compared. Abbreviations: Env EC: Env ectodomain; gp41-TM-CT: gp41 Transmembrane+cytoplasmic tail.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Selection, Recombinant, Produced, Luciferase, Derivative Assay, Infection

21) Product Images from "Sensitive Genotyping of Foodborne-Associated Human Noroviruses and Hepatitis A Virus Using an Array-Based Platform"

Article Title: Sensitive Genotyping of Foodborne-Associated Human Noroviruses and Hepatitis A Virus Using an Array-Based Platform

Journal: Sensors (Basel, Switzerland)

doi: 10.3390/s17092157

Steps of the array-based method for detecting distinct genotypes of NoV or HAV. The starting material was an RNA sample subjected to RT-PCR, purified, and enzymatically digested to remove the non-complementary strand. The hybridization steps was followed by the microarray labeling and signal amplification and quantification steps. Sample-to-result time is below 8 h.

Figure Legend Snippet: Steps of the array-based method for detecting distinct genotypes of NoV or HAV. The starting material was an RNA sample subjected to RT-PCR, purified, and enzymatically digested to remove the non-complementary strand. The hybridization steps was followed by the microarray labeling and signal amplification and quantification steps. Sample-to-result time is below 8 h.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Purification, Hybridization, Microarray, Labeling, Amplification

22) Product Images from "Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma"

Article Title: Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma

Journal: Molecular cell

doi: 10.1016/j.molcel.2010.11.020

Perturbing miR-211 but not melastatin affects melanoma invasion and motility. (A) Schematic presentation of the miR-211 gene in intron 6 of the melastatin ( TRPM1 ) gene. (B) qRT-PCR of TRPM1 (black bars) normalized to actin, and mature miR-211 (gray bars) normalized to RNU48 in multiple human primary melanocytes (HP) and melanoma short term cultures (MSTCs). Y-axis is logarithmic scale. (N=5; means ± s.e.m.). (C) Matrigel assays for WM3682, WM3526, and 451LU (panels at left) transfected with control antagomir (Anti-miR-Ctrl, row 1), a miR-211-specific antagomir (Anti-miR-211, row 2), a control siRNA (siCtrl, row 3), or a melastatin-specific siRNA (siTRPM1, row 4). Membranes prior to scraping non-invasive cells from the top are shown (row 5). Matrigel assays for WM1745, WM1716, or WM3314 (panels at right) transfected with control miRNA mimic (Ctrl mimic, row 1) a miR-211 mimic (miR-211-mimic, row 2), a control Renilla cDNA (Renilla) or TRPM1 cDNA (TRPM1, row 3). The membranes prior to scraping cells from the top of the membrane are shown (row 4). Graphical presentation of the data quantifies the number of invasive cells in 10 high power fields (means ± s.e.m.; *p

Figure Legend Snippet: Perturbing miR-211 but not melastatin affects melanoma invasion and motility. (A) Schematic presentation of the miR-211 gene in intron 6 of the melastatin ( TRPM1 ) gene. (B) qRT-PCR of TRPM1 (black bars) normalized to actin, and mature miR-211 (gray bars) normalized to RNU48 in multiple human primary melanocytes (HP) and melanoma short term cultures (MSTCs). Y-axis is logarithmic scale. (N=5; means ± s.e.m.). (C) Matrigel assays for WM3682, WM3526, and 451LU (panels at left) transfected with control antagomir (Anti-miR-Ctrl, row 1), a miR-211-specific antagomir (Anti-miR-211, row 2), a control siRNA (siCtrl, row 3), or a melastatin-specific siRNA (siTRPM1, row 4). Membranes prior to scraping non-invasive cells from the top are shown (row 5). Matrigel assays for WM1745, WM1716, or WM3314 (panels at right) transfected with control miRNA mimic (Ctrl mimic, row 1) a miR-211 mimic (miR-211-mimic, row 2), a control Renilla cDNA (Renilla) or TRPM1 cDNA (TRPM1, row 3). The membranes prior to scraping cells from the top of the membrane are shown (row 4). Graphical presentation of the data quantifies the number of invasive cells in 10 high power fields (means ± s.e.m.; *p

Techniques Used: Quantitative RT-PCR, Transfection

23) Product Images from "PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !"

Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !

Journal: Journal of immunology (Baltimore, Md. : 1950)

doi: 10.4049/jimmunol.1001445

T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.

Figure Legend Snippet: T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.

Techniques Used: Mouse Assay, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Knock-Out, Expressing

24) Product Images from "Dimethylfumarate protects against TNF-α-induced secretion of inflammatory cytokines in human endothelial cells"

Article Title: Dimethylfumarate protects against TNF-α-induced secretion of inflammatory cytokines in human endothelial cells

Journal: Journal of Inflammation (London, England)

doi: 10.1186/s12950-015-0094-z

Analysis of constitutive and TNF-α-induced MCP-1 mRNA expression during the treatment with DMF in HUVECs. We isoalted total cellular mRNA and performed RT-PCR analyses for MCP-1 and β2-microglobulin. a HUVECs were mock-treated (solvent only) or treated with DMF at the indicated concentrations for 24 h. b HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF at the indicated concentrations + TNF-α for 24 h. c HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF (100 μM) + TNF-α for 3 h. The experiments were performed with comparable results at least 5 times

Figure Legend Snippet: Analysis of constitutive and TNF-α-induced MCP-1 mRNA expression during the treatment with DMF in HUVECs. We isoalted total cellular mRNA and performed RT-PCR analyses for MCP-1 and β2-microglobulin. a HUVECs were mock-treated (solvent only) or treated with DMF at the indicated concentrations for 24 h. b HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF at the indicated concentrations + TNF-α for 24 h. c HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF (100 μM) + TNF-α for 3 h. The experiments were performed with comparable results at least 5 times

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

25) Product Images from "All-in-One Dual CRISPR-Cas12a (AIOD-CRISPR) Assay: A Case for Rapid, Ultrasensitive and Visual Detection of Novel Coronavirus SARS-CoV-2 and HIV virus"

Article Title: All-in-One Dual CRISPR-Cas12a (AIOD-CRISPR) Assay: A Case for Rapid, Ultrasensitive and Visual Detection of Novel Coronavirus SARS-CoV-2 and HIV virus

Journal: bioRxiv

doi: 10.1101/2020.03.19.998724

The melting curves for the OneStep RT-PCR products on detecting viral RNA extracted from various copies per microliter of HIV-1 plasma. The melting temperature of the products was about 83.5 °C.

Figure Legend Snippet: The melting curves for the OneStep RT-PCR products on detecting viral RNA extracted from various copies per microliter of HIV-1 plasma. The melting temperature of the products was about 83.5 °C.

Techniques Used: Reverse Transcription Polymerase Chain Reaction

26) Product Images from "Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish"

Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish

Journal: General and comparative endocrinology

doi: 10.1016/j.ygcen.2010.10.010

Temporal and spatial expression of pck1 during zebrafish development. (A) Phylogenetic analysis distinguishes Pck1- from Pck2-related proteins. (B) Semiquantitative RT-PCR showing onset of pck1 and pck2 gene expression. Note that a small amount of maternally provided pck1 is present in 16 cell embryos. Low-level zygotic expression of pck2 is first detectable at 6 hpf. (C) RNA:RNA in situ hybridization demonstrates pck1 expression in the 11 hpf YSL, brain, and tail. In 24 hpf embryos, pck1 is expressed in the eye and tail. By 48 hpf pck1 is expressed at the margin between the yolk extension and the embryo proper (red arrow). Expression in discrete YSL clusters (black arrows) as well as fin buds and pharyngeal arches is also seen. At 72 and 96 hpf, pck1 expression is seen in the liver, YSL, and cranial neuromasts. b, brain; e, eye; fb, fin bud; nm, neuromasts; pa, pharyngeal arch; tb, and tail bud.

Figure Legend Snippet: Temporal and spatial expression of pck1 during zebrafish development. (A) Phylogenetic analysis distinguishes Pck1- from Pck2-related proteins. (B) Semiquantitative RT-PCR showing onset of pck1 and pck2 gene expression. Note that a small amount of maternally provided pck1 is present in 16 cell embryos. Low-level zygotic expression of pck2 is first detectable at 6 hpf. (C) RNA:RNA in situ hybridization demonstrates pck1 expression in the 11 hpf YSL, brain, and tail. In 24 hpf embryos, pck1 is expressed in the eye and tail. By 48 hpf pck1 is expressed at the margin between the yolk extension and the embryo proper (red arrow). Expression in discrete YSL clusters (black arrows) as well as fin buds and pharyngeal arches is also seen. At 72 and 96 hpf, pck1 expression is seen in the liver, YSL, and cranial neuromasts. b, brain; e, eye; fb, fin bud; nm, neuromasts; pa, pharyngeal arch; tb, and tail bud.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, RNA In Situ Hybridization

Gene expression during zebrafish development. (A) Relative, quantitative expression of insa (open bars) and insb (black bars) during development. (B). Relative, quantitative expression of pck1 during development. (C) Non-quantitative RT-PCR demonstrates early expression of insulin receptors a and b .

Figure Legend Snippet: Gene expression during zebrafish development. (A) Relative, quantitative expression of insa (open bars) and insb (black bars) during development. (B). Relative, quantitative expression of pck1 during development. (C) Non-quantitative RT-PCR demonstrates early expression of insulin receptors a and b .

Techniques Used: Expressing, Quantitative RT-PCR

27) Product Images from "miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi"

Article Title: miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi

Journal: Non-Coding RNA

doi: 10.3390/ncrna1030222

Knockdown of miRNA expression by antagomirs. Knock-down of ( A ) miR-34; ( B ) miR-219 and ( C ) miR-277 expression in cells transfected with 50 pmol and 100 pmol of antagomirs. MicroRNA expression was profiled by RT-PCR at 48 h and 72 h post-transfection in control, scrambled RNA and antagomir transfected cells. Control transfected cells were used as a calibrator, in which expression (%) of miRNA was taken as 100; ( D ) Knock-down of miR-989 by nano-injecting miR-989 specific antagomir in female mosquito. MicroRNA expression was profiled in midgut tissue of PBS, scrambled and antagomir injected female mosquito taking PBS injected mosquitoes as calibrator. Expression (%) of miRNA in PBS injected midgut tissue was taken as 100. Values are mean ± s.e.m. of three biological replicates profiled in triplicate reactions. Data was statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p

Figure Legend Snippet: Knockdown of miRNA expression by antagomirs. Knock-down of ( A ) miR-34; ( B ) miR-219 and ( C ) miR-277 expression in cells transfected with 50 pmol and 100 pmol of antagomirs. MicroRNA expression was profiled by RT-PCR at 48 h and 72 h post-transfection in control, scrambled RNA and antagomir transfected cells. Control transfected cells were used as a calibrator, in which expression (%) of miRNA was taken as 100; ( D ) Knock-down of miR-989 by nano-injecting miR-989 specific antagomir in female mosquito. MicroRNA expression was profiled in midgut tissue of PBS, scrambled and antagomir injected female mosquito taking PBS injected mosquitoes as calibrator. Expression (%) of miRNA in PBS injected midgut tissue was taken as 100. Values are mean ± s.e.m. of three biological replicates profiled in triplicate reactions. Data was statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p

Techniques Used: Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, Injection

Validation of targets by miRNAs loss of function strategy: Expression profiling of mRNA target(s) of ( A – D ) miR-34; ( E ) miR-219 and ( F ) miR-277 was carried out by RT-PCR in control, scrambled and antagomir transfected cells. Expression (%) of mRNA was compared with miRNA expression at ( i ) 48 h and ( ii ) 72 h post-transfection; ( G ) MiRNA-989 target expression was profiled by RT-PCR in midgut of control, scrambled and miR-989 specific antagomir injected female mosquitoes. Expression (%) of miRNA and mRNA was compared at 24 h post blood-feeding. Expression (%) of mRNAs in control was taken as 100. Values are mean ± s.e.m of three biological replicates profiled in triplicate reaction. Data were statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p

Figure Legend Snippet: Validation of targets by miRNAs loss of function strategy: Expression profiling of mRNA target(s) of ( A – D ) miR-34; ( E ) miR-219 and ( F ) miR-277 was carried out by RT-PCR in control, scrambled and antagomir transfected cells. Expression (%) of mRNA was compared with miRNA expression at ( i ) 48 h and ( ii ) 72 h post-transfection; ( G ) MiRNA-989 target expression was profiled by RT-PCR in midgut of control, scrambled and miR-989 specific antagomir injected female mosquitoes. Expression (%) of miRNA and mRNA was compared at 24 h post blood-feeding. Expression (%) of mRNAs in control was taken as 100. Values are mean ± s.e.m of three biological replicates profiled in triplicate reaction. Data were statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Injection

28) Product Images from "Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers"

Article Title: Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers

Journal: Cancer Cell International

doi: 10.1186/1475-2867-12-17

Tumor tissues and breast cell lines express a higher proportion of the Δ exon 8 splice variant of paralemmin-1 than do reduction mammoplasty tissues. RNA was isolated and amplified with RT-PCR analysis using a primer set to detect Δ exon 8 splice variant. RT-PCR products were separated on a 2% low melting agarose gel and visualized by ethidium bromide. The full abbreviations of the cell lines are in Table 1 . Tumor tissue samples are represented by the prefix T and reduction mammoplasty tissue samples are represented by the prefix R. Numbers on the left of the figures represent the full length product (275 bp) and the Δ exon 8 splice variant (143 bp).

Figure Legend Snippet: Tumor tissues and breast cell lines express a higher proportion of the Δ exon 8 splice variant of paralemmin-1 than do reduction mammoplasty tissues. RNA was isolated and amplified with RT-PCR analysis using a primer set to detect Δ exon 8 splice variant. RT-PCR products were separated on a 2% low melting agarose gel and visualized by ethidium bromide. The full abbreviations of the cell lines are in Table 1 . Tumor tissue samples are represented by the prefix T and reduction mammoplasty tissue samples are represented by the prefix R. Numbers on the left of the figures represent the full length product (275 bp) and the Δ exon 8 splice variant (143 bp).

Techniques Used: Variant Assay, Isolation, Amplification, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

Paralemmin-1 is differentially expressed in breast epithelial cell lines. RNA and protein lysates were isolated from tumorigenic and non-tumorigenic breast cell lines. Top: Real time qRT-PCR shows mRNA expression of paralemmin-1; means and S.E. from three separate cell cultures are presented; ER-positive cell lines, (hatched bars), ER-negative cell lines (solid bars). Bottom: Protein lysates (15 μg) were probed for paralemmin-1 expression by Western immunoblotting. Image is a representative of at least three separate experiments with different biological samples.

Figure Legend Snippet: Paralemmin-1 is differentially expressed in breast epithelial cell lines. RNA and protein lysates were isolated from tumorigenic and non-tumorigenic breast cell lines. Top: Real time qRT-PCR shows mRNA expression of paralemmin-1; means and S.E. from three separate cell cultures are presented; ER-positive cell lines, (hatched bars), ER-negative cell lines (solid bars). Bottom: Protein lysates (15 μg) were probed for paralemmin-1 expression by Western immunoblotting. Image is a representative of at least three separate experiments with different biological samples.

Techniques Used: Isolation, Quantitative RT-PCR, Expressing, Western Blot

29) Product Images from "A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis"

Article Title: A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis

Journal: mBio

doi: 10.1128/mBio.01388-17

Figure Legend Snippet: Ca 2+ negatively regulates expression of ctpE . Role of Ca 2+ on expression of ctpE in Mycobacterium smegmatis mc 2 155 strains. Strains were grown to mid-log phase in Sauton’s medium without any supplementation or supplemented with 1.0 mM EGTA or CaCl 2 and used for uptake assays. (A and B) Uptake of 45 Ca 2+ in M. smegmatis mc 2 155 (WT) (A) and in the mutant (MHK1+pSMT3) and mutant complemented with M. smegmatis ctpE (MHK1+pRHK2) (B). (C) Semiquantitative reverse transcriptase PCR analysis of the M. smegmatis mc 2 155 ctpE and echA . M. smegmatis mc 2 155 was grown to mid-log phase in Sauton’s medium and treated with EGTA or CaCl 2 for 2 h. RNA was isolated, and RT-PCR was carried out for ctpE , echA , and sigA . (D) Transcription profile of ctpE and echA . Quantification of amplified PCR product ( Fig. 6C ) was done by densitometry. sigA was taken as an endogenous control. The experiment was performed three times independently; values are averages, and standard deviations are shown as error bars. Values that are significantly different are indicated by asterisks as follows: *, P

Techniques Used: Expressing, Mutagenesis, Polymerase Chain Reaction, Isolation, Reverse Transcription Polymerase Chain Reaction, Amplification

30) Product Images from "Modeling the neuropsychiatric manifestations of Lowe syndrome using induced pluripotent stem cells: defective F-actin polymerization and WAVE-1 expression in neuronal cells"

Article Title: Modeling the neuropsychiatric manifestations of Lowe syndrome using induced pluripotent stem cells: defective F-actin polymerization and WAVE-1 expression in neuronal cells

Journal: Molecular Autism

doi: 10.1186/s13229-018-0227-3

DNA and cDNA sequencing. a Genomic DNA sequences showing mutations in the CRISPR-engineered knockout line (690KO) and the LS samples (LS100, LS300, and LS500) along with controls. The arrows point to the mutations. b The LS100 splice acceptor mutation predicts the loss of the natural splice site at the intron 23/exon 24 border, as well as a cryptic splice site 16 bases into exon 24. c cDNA sequencing showing normal exon 22/23 and exon 23/24 combinations in controls, and aberrant splicing in LS300, which leads to the exclusion of exon 23, thereby connecting exon 22 to 24; and the cryptic splice in LS100, as predicted in panel b

Figure Legend Snippet: DNA and cDNA sequencing. a Genomic DNA sequences showing mutations in the CRISPR-engineered knockout line (690KO) and the LS samples (LS100, LS300, and LS500) along with controls. The arrows point to the mutations. b The LS100 splice acceptor mutation predicts the loss of the natural splice site at the intron 23/exon 24 border, as well as a cryptic splice site 16 bases into exon 24. c cDNA sequencing showing normal exon 22/23 and exon 23/24 combinations in controls, and aberrant splicing in LS300, which leads to the exclusion of exon 23, thereby connecting exon 22 to 24; and the cryptic splice in LS100, as predicted in panel b

Techniques Used: Sequencing, CRISPR, Knock-Out, Mutagenesis

31) Product Images from "Immunocompetent mouse model for Crimean-Congo hemorrhagic fever virus"

Article Title: Immunocompetent mouse model for Crimean-Congo hemorrhagic fever virus

Journal: eLife

doi: 10.7554/eLife.63906

MA-CCHFV replicates to high titers of multiple tissues in wild-type (WT) mice. Groups of 8-week-old WT C57BL/6J mice were infected with 10,000 TCID 50 of MA-CCHFV or CCHFV Hoti via the intraperitoneal (IP) route. At indicated time points, mice were necropsied and viral RNA burdens in tissues evaluated by qRT-PCR. Statistical comparison performed with two-way ANOVA with Tukey’s multiple comparison test. p-Values between MA-CCHFV and respective sex Hoti-infected mice indicated with * for females, # for males and between MA-CCHFV male and MA-CCHFV female mice with +. Plasma, liver, spleen, kidney, and lung: N = 2–4 (Hoti) and 7–8 (MA-CCHFV) per group per timepoint. Brain: N = 4 per group per timepoint. Study was performed once for Hoti and twice for MA-CCHFV. Data shown as mean plus standard deviation. Dashed line indicates limit of detection. *p

Figure Legend Snippet: MA-CCHFV replicates to high titers of multiple tissues in wild-type (WT) mice. Groups of 8-week-old WT C57BL/6J mice were infected with 10,000 TCID 50 of MA-CCHFV or CCHFV Hoti via the intraperitoneal (IP) route. At indicated time points, mice were necropsied and viral RNA burdens in tissues evaluated by qRT-PCR. Statistical comparison performed with two-way ANOVA with Tukey’s multiple comparison test. p-Values between MA-CCHFV and respective sex Hoti-infected mice indicated with * for females, # for males and between MA-CCHFV male and MA-CCHFV female mice with +. Plasma, liver, spleen, kidney, and lung: N = 2–4 (Hoti) and 7–8 (MA-CCHFV) per group per timepoint. Brain: N = 4 per group per timepoint. Study was performed once for Hoti and twice for MA-CCHFV. Data shown as mean plus standard deviation. Dashed line indicates limit of detection. *p

Techniques Used: Mouse Assay, Infection, Quantitative RT-PCR, Standard Deviation

32) Product Images from "Highly Specific Gene Silencing by Artificial miRNAs in Rice"

Article Title: Highly Specific Gene Silencing by Artificial miRNAs in Rice

Journal: PLoS ONE

doi: 10.1371/journal.pone.0001829

$Molecular characterization of transgenic plants. Cleavage site mapping was performed on mRNA from one transgenic plant for each transgene in both varieties (Nipponbare and IR64). Numbers above the arrows denote the number of clones ending at the particular position, with the total number of clones in parentheses. The binding energy (ΔG) of the RNA-RNA duplex between target (denoted by TIGR locus identifier) and amiRNA is given in kcal/mol and as a fraction of the calculated binding energy for a perfect match to the target site. Total RNA from two transgenic plants for each construct (leaf tissue for SPl11 and Pds , young panicles for Eui1 / CYP714D1 ) was used for RT-PCR for the target (histograms, top right), and small RNA blots (bottom right). Gel images are provided as loading control for small RNA blots. Comparison was to an empty vector control (IRS-154). Expression was normalized to the respective empty vector control. Error bars indicate the variation between technical replicates (range).$
Figure Legend Snippet: Molecular characterization of transgenic plants. Cleavage site mapping was performed on mRNA from one transgenic plant for each transgene in both varieties (Nipponbare and IR64). Numbers above the arrows denote the number of clones ending at the particular position, with the total number of clones in parentheses. The binding energy (ΔG) of the RNA-RNA duplex between target (denoted by TIGR locus identifier) and amiRNA is given in kcal/mol and as a fraction of the calculated binding energy for a perfect match to the target site. Total RNA from two transgenic plants for each construct (leaf tissue for SPl11 and Pds , young panicles for Eui1 / CYP714D1 ) was used for RT-PCR for the target (histograms, top right), and small RNA blots (bottom right). Gel images are provided as loading control for small RNA blots. Comparison was to an empty vector control (IRS-154). Expression was normalized to the respective empty vector control. Error bars indicate the variation between technical replicates (range).

Techniques Used: Transgenic Assay, Clone Assay, Binding Assay, Construct, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Expressing

33) Product Images from "High-Throughput Detection of West Nile Virus RNA"

Article Title: High-Throughput Detection of West Nile Virus RNA

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.39.4.1264-1271.2001

ABI Prism 6700 workstation extracts RNA as efficiently as the RNeasy method. Uninfected bird tissues spiked with titrated amounts of WNV were extracted by RNeasy methods (left panels) or with the ABI Prism 6700 workstation (right panels). The recovered RNA was subjected to standard RT-PCR amplification and analyzed on agarose gels stained with ethidium bromide. The amounts of WNV spiked into the sample (in PFU) are indicated above each lane. (A and B) Samples extracted from kidney and heart tissues, respectively. Lanes 1, 100-bp markers.

Figure Legend Snippet: ABI Prism 6700 workstation extracts RNA as efficiently as the RNeasy method. Uninfected bird tissues spiked with titrated amounts of WNV were extracted by RNeasy methods (left panels) or with the ABI Prism 6700 workstation (right panels). The recovered RNA was subjected to standard RT-PCR amplification and analyzed on agarose gels stained with ethidium bromide. The amounts of WNV spiked into the sample (in PFU) are indicated above each lane. (A and B) Samples extracted from kidney and heart tissues, respectively. Lanes 1, 100-bp markers.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Staining

Quantitation of WNV by real-time RT-PCR assay. C T values are plotted versus the log of a known amount of WNV (in PFU) (A) or in vitro transcribed RNA (B).

Figure Legend Snippet: Quantitation of WNV by real-time RT-PCR assay. C T values are plotted versus the log of a known amount of WNV (in PFU) (A) or in vitro transcribed RNA (B).

Techniques Used: Quantitation Assay, Quantitative RT-PCR, In Vitro

34) Product Images from "Spore Germination Mediated by Bacillus megaterium QM B1551 SleL and YpeB"

Article Title: Spore Germination Mediated by Bacillus megaterium QM B1551 SleL and YpeB

Journal: Journal of Bacteriology

doi: 10.1128/JB.01298-13

RT-PCR analysis of the expression of ypeB during sporulation of B. megaterium QM B1551 (A), B. megaterium sleB (GC103) (B), and B. megaterium sleB pHT- ypeB (GC123) (C) strains. RT-PCR was conducted using gene-specific primers designed to amplify an ∼500-bp fragment of ypeB from RNA isolated from sporulating cultures, as described in Materials and Methods. Numbers below the lanes refer to the times (h) after entry to sporulation. Molecular weight markers (lane M), and negative, i.e., no template RNA (-ve), control reactions are indicated. Isolated RNAs were verified as being free from genomic DNA by conducting PCRs with the same ypeB -specific primers (data not shown).

Figure Legend Snippet: RT-PCR analysis of the expression of ypeB during sporulation of B. megaterium QM B1551 (A), B. megaterium sleB (GC103) (B), and B. megaterium sleB pHT- ypeB (GC123) (C) strains. RT-PCR was conducted using gene-specific primers designed to amplify an ∼500-bp fragment of ypeB from RNA isolated from sporulating cultures, as described in Materials and Methods. Numbers below the lanes refer to the times (h) after entry to sporulation. Molecular weight markers (lane M), and negative, i.e., no template RNA (-ve), control reactions are indicated. Isolated RNAs were verified as being free from genomic DNA by conducting PCRs with the same ypeB -specific primers (data not shown).

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Molecular Weight

35) Product Images from "Prostate-derived Ets transcription factor (PDEF) downregulates survivin expression and inhibits breast cancer cell growth in vitro and xenograft tumor formation in vivo"

Article Title: Prostate-derived Ets transcription factor (PDEF) downregulates survivin expression and inhibits breast cancer cell growth in vitro and xenograft tumor formation in vivo

Journal: Breast cancer research and treatment

doi: 10.1007/s10549-006-9314-9

Survivin expression is inversely associated with PDEF protein expression. ( A ) Upper panel: Western blots show PDEF polyclonal antibodies (see Method section) specifically recognized a PDEF protein band from MCF-7 cell lysates but not from the lysates of U937, HeLa and Skbr3 cells. Lanes 1–4: 50 μ g of cell lysates per lane, lane 5: 0.1 ng of purified PDEF protein (positive control). Lower panel: PDEF mRNA expression in the same cell lines determined by RT-PCR. GAPDH is an internal control, and template in the lane 5 is 10 ng pcDNA3.1-PDEF plasmid. ( B ) Inverse expression pattern of PDEF and survivin in breast cancer cell lines. The expression of PDEF, survivin and actin was determined by Western blot analysis. Only the major survivin isoform was detected as the other isoforms are expressed at significantly lower levels in these cells. ( C ) Immunocytochemistry confirms PDEF expression in MCF-7 cells (400× magnification). ( D ) Immunohistochemistry showed PDEF expression in ductal and lobular epithelial cells of normal breast tissues ( E ). Inverse expression pattern of PDEF and survivin in normal and cancerous breast tissues. Protein expression was determined as in ( B ). Note: Actin expression shown in ( A ), ( B ) and ( E ) was used as a total protein loading control

Figure Legend Snippet: Survivin expression is inversely associated with PDEF protein expression. ( A ) Upper panel: Western blots show PDEF polyclonal antibodies (see Method section) specifically recognized a PDEF protein band from MCF-7 cell lysates but not from the lysates of U937, HeLa and Skbr3 cells. Lanes 1–4: 50 μ g of cell lysates per lane, lane 5: 0.1 ng of purified PDEF protein (positive control). Lower panel: PDEF mRNA expression in the same cell lines determined by RT-PCR. GAPDH is an internal control, and template in the lane 5 is 10 ng pcDNA3.1-PDEF plasmid. ( B ) Inverse expression pattern of PDEF and survivin in breast cancer cell lines. The expression of PDEF, survivin and actin was determined by Western blot analysis. Only the major survivin isoform was detected as the other isoforms are expressed at significantly lower levels in these cells. ( C ) Immunocytochemistry confirms PDEF expression in MCF-7 cells (400× magnification). ( D ) Immunohistochemistry showed PDEF expression in ductal and lobular epithelial cells of normal breast tissues ( E ). Inverse expression pattern of PDEF and survivin in normal and cancerous breast tissues. Protein expression was determined as in ( B ). Note: Actin expression shown in ( A ), ( B ) and ( E ) was used as a total protein loading control

Techniques Used: Expressing, Western Blot, Purification, Positive Control, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Immunocytochemistry, Immunohistochemistry

36) Product Images from "TMPRSS2 Is the Major Activating Protease of Influenza A Virus in Primary Human Airway Cells and Influenza B Virus in Human Type II Pneumocytes"

Article Title: TMPRSS2 Is the Major Activating Protease of Influenza A Virus in Primary Human Airway Cells and Influenza B Virus in Human Type II Pneumocytes

Journal: Journal of Virology

doi: 10.1128/JVI.00649-19

PPMO T-ex5 inhibits multicycle replication of IAV but not of IBV in primary human bronchial epithelial cells (HBEC). (A) Immunofluorescence analysis of the expression of TMPRSS2 in HBEC cultures. Permeabilized HBEC were immunostained using antibodies against mucin 5AC (MUC5AC) (goblet cells) and acetylated tubulin (cilia), and nonpermeabilized HBEC were immunostained against cilia and TMPRSS2. Sections of permeabilized HBEC cultures were immunostained against TMPRSS2 and cilia. Coexpression is presented as merged false color (yellow). The nuclei were stained using DAPI (blue) as a counterstain. ci, ciliated cell; go, goblet cell; ba, basal cell. (B) RT-PCR analysis of TMPRSS2 mRNA in T-ex5-treated HBEC cultures. Cells were treated with the indicated concentrations of PPMO T-ex5 for 24 h, the medium was then replaced, and the cells were incubated in the absence of T-ex5 for 24 h. Total RNA was isolated and amplified with TMPRSS2-specific primers to amplify a full-length mature mRNA fragment of 1,228 bp and the truncated Δex5 fragment. (C) Evaluation of the effect of PPMO treatment on cell viability. HBEC cultures were treated with 25 μM T-ex5 or a nonsense-sequence negative-control PPMO (scramble) for 24 h. Cell viability of untreated cells (w/o) was set as 100%. Results are mean values ± SD ( n = 3). (D) Multicycle replication of IAV and IBV in PPMO-treated HBEC. HBEC cultures were treated with 25 μM T-ex5 or scramble for 24 h or remained untreated (w/o); infected with Hamburg/H1N1pdm, Anhui/H7N9, Aichi/H3N2/PR8, or Malaysia/B at a low MOI of 0.01 to 0.005; and further incubated in the absence of PPMO for 24 h. Cells were fixed, permeabilized, and immunostained against the viral nucleoprotein (NP) and cilia. Coexpression is presented as merged false color (yellow). The nuclei were stained using DAPI as a counterstain. Representative images from two (H7N9 and IBV) or three (H1N1pdm and H3N2) independent experiments are shown. Bars, 100 μm. (E) Plaque assays of progeny virus released from H7N9/Anhui- and Malaysia/B-infected HBEC at 24 h p.i. Results show virus titers from one experiment (H7N9/Anhui) and mean values ± SD from three independent experiments (Malaysia/B). (F) Analysis of HA cleavage in PPMO-treated HBEC. HBEC cultures were treated with 25 μM T-ex5 or scramble PPMO for 24 h and then infected with Anhui/H7/PR8 or Malaysia/B at an MOI of 1 for 48 h. Cell lysates were subjected to SDS-PAGE and Western blotting with H7- or IBV HA-specific antibodies. Beta-actin served as a loading control.

Figure Legend Snippet: PPMO T-ex5 inhibits multicycle replication of IAV but not of IBV in primary human bronchial epithelial cells (HBEC). (A) Immunofluorescence analysis of the expression of TMPRSS2 in HBEC cultures. Permeabilized HBEC were immunostained using antibodies against mucin 5AC (MUC5AC) (goblet cells) and acetylated tubulin (cilia), and nonpermeabilized HBEC were immunostained against cilia and TMPRSS2. Sections of permeabilized HBEC cultures were immunostained against TMPRSS2 and cilia. Coexpression is presented as merged false color (yellow). The nuclei were stained using DAPI (blue) as a counterstain. ci, ciliated cell; go, goblet cell; ba, basal cell. (B) RT-PCR analysis of TMPRSS2 mRNA in T-ex5-treated HBEC cultures. Cells were treated with the indicated concentrations of PPMO T-ex5 for 24 h, the medium was then replaced, and the cells were incubated in the absence of T-ex5 for 24 h. Total RNA was isolated and amplified with TMPRSS2-specific primers to amplify a full-length mature mRNA fragment of 1,228 bp and the truncated Δex5 fragment. (C) Evaluation of the effect of PPMO treatment on cell viability. HBEC cultures were treated with 25 μM T-ex5 or a nonsense-sequence negative-control PPMO (scramble) for 24 h. Cell viability of untreated cells (w/o) was set as 100%. Results are mean values ± SD ( n = 3). (D) Multicycle replication of IAV and IBV in PPMO-treated HBEC. HBEC cultures were treated with 25 μM T-ex5 or scramble for 24 h or remained untreated (w/o); infected with Hamburg/H1N1pdm, Anhui/H7N9, Aichi/H3N2/PR8, or Malaysia/B at a low MOI of 0.01 to 0.005; and further incubated in the absence of PPMO for 24 h. Cells were fixed, permeabilized, and immunostained against the viral nucleoprotein (NP) and cilia. Coexpression is presented as merged false color (yellow). The nuclei were stained using DAPI as a counterstain. Representative images from two (H7N9 and IBV) or three (H1N1pdm and H3N2) independent experiments are shown. Bars, 100 μm. (E) Plaque assays of progeny virus released from H7N9/Anhui- and Malaysia/B-infected HBEC at 24 h p.i. Results show virus titers from one experiment (H7N9/Anhui) and mean values ± SD from three independent experiments (Malaysia/B). (F) Analysis of HA cleavage in PPMO-treated HBEC. HBEC cultures were treated with 25 μM T-ex5 or scramble PPMO for 24 h and then infected with Anhui/H7/PR8 or Malaysia/B at an MOI of 1 for 48 h. Cell lysates were subjected to SDS-PAGE and Western blotting with H7- or IBV HA-specific antibodies. Beta-actin served as a loading control.

Techniques Used: Immunofluorescence, Expressing, Staining, Reverse Transcription Polymerase Chain Reaction, Incubation, Isolation, Amplification, Sequencing, Negative Control, Infection, SDS Page, Western Blot

Knockdown of TMPRSS2 expression by PPMO T-ex5 inhibits activation and multicycle replication of IAV but not of IBV in Calu-3 cells. (A) Multicycle replication of Anhui/H7N9 in T-ex5-treated Calu-3 cells. Confluent Calu-3 cells were treated with 25 μM T-ex5 PPMO for 24 h or remained untreated (without [w/o]), inoculated with Anhui/H7N9 at an MOI of 0.001, and further incubated in the absence of T-ex5 for 72 h. Virus titers were determined as PFU per milliliter by a plaque assay of supernatants taken at the indicated time points. Results are mean values ± standard deviations (SD) from two independent experiments. (B) Analysis of HA cleavage in T-ex5-treated Calu-3 cells. Calu-3 cells treated with or without T-ex5 for 24 h were inoculated with Anhui/H7N9 at an MOI of 1 and incubated for 24 h in the absence of T-ex5. Cell lysates were subjected to SDS-PAGE and Western blotting using H7-specific antibodies. HA1 is not detected by the antibody. Beta-actin was used as a loading control. (C) Analysis of TMPRSS2 -specific mRNA in Calu-3 cells. Cells were treated with 25 μM T-ex5 for 24 h and then incubated without T-ex5 for 72 h. Total RNA was isolated and analyzed by RT-PCR using primers designed to amplify 1,228 nucleotides of full-length TMPRSS2 mRNA. Full-length and truncated Δex5 PCR products are indicated. (D) Multicycle replication of IBV in Calu-3 cells with or without T-ex5 treatment. Confluent Calu-3 monolayers were treated with 25 μM PPMO T-ex5 or remained untreated. Cells were then inoculated with Malaysia/B or Massachusetts/B at a low MOI of 0.01 and incubated for 72 h in the absence of PPMO T-ex5. At the indicated time points, virus titers were analyzed by a plaque assay. Data are mean values ± SD from three independent experiments. (E) Analysis of HA cleavage in T-ex5-treated Calu-3 cells. Cells incubated with or without T-ex5 as described above were infected with Malaysia/B or Massachusetts/B at an MOI of 1 and incubated without further PPMO treatment for 48 h. Cell lysates were subjected to SDS-PAGE and Western blotting using IBV HA-specific antibodies. Beta-actin was used as a loading control.

Figure Legend Snippet: Knockdown of TMPRSS2 expression by PPMO T-ex5 inhibits activation and multicycle replication of IAV but not of IBV in Calu-3 cells. (A) Multicycle replication of Anhui/H7N9 in T-ex5-treated Calu-3 cells. Confluent Calu-3 cells were treated with 25 μM T-ex5 PPMO for 24 h or remained untreated (without [w/o]), inoculated with Anhui/H7N9 at an MOI of 0.001, and further incubated in the absence of T-ex5 for 72 h. Virus titers were determined as PFU per milliliter by a plaque assay of supernatants taken at the indicated time points. Results are mean values ± standard deviations (SD) from two independent experiments. (B) Analysis of HA cleavage in T-ex5-treated Calu-3 cells. Calu-3 cells treated with or without T-ex5 for 24 h were inoculated with Anhui/H7N9 at an MOI of 1 and incubated for 24 h in the absence of T-ex5. Cell lysates were subjected to SDS-PAGE and Western blotting using H7-specific antibodies. HA1 is not detected by the antibody. Beta-actin was used as a loading control. (C) Analysis of TMPRSS2 -specific mRNA in Calu-3 cells. Cells were treated with 25 μM T-ex5 for 24 h and then incubated without T-ex5 for 72 h. Total RNA was isolated and analyzed by RT-PCR using primers designed to amplify 1,228 nucleotides of full-length TMPRSS2 mRNA. Full-length and truncated Δex5 PCR products are indicated. (D) Multicycle replication of IBV in Calu-3 cells with or without T-ex5 treatment. Confluent Calu-3 monolayers were treated with 25 μM PPMO T-ex5 or remained untreated. Cells were then inoculated with Malaysia/B or Massachusetts/B at a low MOI of 0.01 and incubated for 72 h in the absence of PPMO T-ex5. At the indicated time points, virus titers were analyzed by a plaque assay. Data are mean values ± SD from three independent experiments. (E) Analysis of HA cleavage in T-ex5-treated Calu-3 cells. Cells incubated with or without T-ex5 as described above were infected with Malaysia/B or Massachusetts/B at an MOI of 1 and incubated without further PPMO treatment for 48 h. Cell lysates were subjected to SDS-PAGE and Western blotting using IBV HA-specific antibodies. Beta-actin was used as a loading control.

Techniques Used: Expressing, Activation Assay, Incubation, Plaque Assay, SDS Page, Western Blot, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Infection

Knockdown of TMPRSS2 activity inhibits activation of both IAV and IBV with a monobasic HA cleavage site in primary human type II alveolar epithelial cells (AECII). (A) Multicycle replication of Anhui/H7/PR8 in T-ex5-treated AECII. Cells were treated with 30 μM T-ex5 or scramble PPMO or remained untreated (w/o) for 24 h. Cells were then infected with Anhui/H7/PR8 at an MOI of 0.005 and incubated in the presence of 30 μM PPMO for 72 h. At the indicated time points, virus titers were determined by a plaque assay. Data are mean values from two independent experiments ± SD. (B) Analysis of HA cleavage in PPMO-treated AECII. AECII treated with T-ex5 for 24 h were infected with Anhui/H7/PR8 at an MOI of 0.1 and incubated for 72 h in the presence of T-ex5. Untreated cells were used as controls. Cell lysates were analyzed for HA cleavage by SDS-PAGE and Western blotting. HA1 is not detected by the antibody. (C) RT-PCR analysis of TMPRSS2 mRNA in Anhui/H7/PR8-infected AECII with or without T-ex5 treatment for 72 h. Total RNA was isolated and amplified with TMPRSS2-specific primers to amplify a full-length mature mRNA fragment and the truncated Δex5 fragment. (D) Spread of IAV and IBV in T-ex5-treated cells. AECII cultures treated with T-ex5 for 24 h were inoculated with the indicated virus at an MOI of 0.01 to 0.001 and incubated in the presence of T-ex5 for 24 h. Cells were fixed and immunostained against viral NP, prosurfactant protein C (pro-SP-C) (AECII marker), and DAPI. Untreated cells were used as controls. Representative images from two independent experiments are shown. Bars, 100 μm. (E) Progeny virus released from Aichi/H3N2/PR8- and Malaysia/B-infected AECII was quantified using a plaque assay at 24 h postinfection. Virus titers from a representative experiment are shown. (F) Analysis of HA cleavage in T-ex5-treated AECII. AECII were treated with T-ex5 for 24 h, infected at an MOI of 0.5 (Aichi/H3N2/PR8) or 0.01 (Malaysia/B), and further incubated in the presence of T-ex5 for 24 and 72 h, respectively. Untreated cells were used as controls. Cell lysates were analyzed for HA cleavage by immunoblotting using H7- and IBV HA-specific antibodies, respectively. Beta-actin was used as a loading control. Lanes are spliced together from one immunoblot from one experiment. (G) Spread of FPV/H7N1 in T-ex5-treated AECII. Cells with or without T-ex5 treatment for 24 h were infected with FPV/H7N1 and incubated in the presence or absence of T-ex5 for 24 h. Cells were immunostained against viral NP, pro-SP-C, and DAPI. (H) Effect of PPMO treatment on AECII viability. AECII were treated with PPMO for 24 h. Cell viability of untreated (w/o) cells was set as 100%. Results are mean values ± SD ( n = 3).

Figure Legend Snippet: Knockdown of TMPRSS2 activity inhibits activation of both IAV and IBV with a monobasic HA cleavage site in primary human type II alveolar epithelial cells (AECII). (A) Multicycle replication of Anhui/H7/PR8 in T-ex5-treated AECII. Cells were treated with 30 μM T-ex5 or scramble PPMO or remained untreated (w/o) for 24 h. Cells were then infected with Anhui/H7/PR8 at an MOI of 0.005 and incubated in the presence of 30 μM PPMO for 72 h. At the indicated time points, virus titers were determined by a plaque assay. Data are mean values from two independent experiments ± SD. (B) Analysis of HA cleavage in PPMO-treated AECII. AECII treated with T-ex5 for 24 h were infected with Anhui/H7/PR8 at an MOI of 0.1 and incubated for 72 h in the presence of T-ex5. Untreated cells were used as controls. Cell lysates were analyzed for HA cleavage by SDS-PAGE and Western blotting. HA1 is not detected by the antibody. (C) RT-PCR analysis of TMPRSS2 mRNA in Anhui/H7/PR8-infected AECII with or without T-ex5 treatment for 72 h. Total RNA was isolated and amplified with TMPRSS2-specific primers to amplify a full-length mature mRNA fragment and the truncated Δex5 fragment. (D) Spread of IAV and IBV in T-ex5-treated cells. AECII cultures treated with T-ex5 for 24 h were inoculated with the indicated virus at an MOI of 0.01 to 0.001 and incubated in the presence of T-ex5 for 24 h. Cells were fixed and immunostained against viral NP, prosurfactant protein C (pro-SP-C) (AECII marker), and DAPI. Untreated cells were used as controls. Representative images from two independent experiments are shown. Bars, 100 μm. (E) Progeny virus released from Aichi/H3N2/PR8- and Malaysia/B-infected AECII was quantified using a plaque assay at 24 h postinfection. Virus titers from a representative experiment are shown. (F) Analysis of HA cleavage in T-ex5-treated AECII. AECII were treated with T-ex5 for 24 h, infected at an MOI of 0.5 (Aichi/H3N2/PR8) or 0.01 (Malaysia/B), and further incubated in the presence of T-ex5 for 24 and 72 h, respectively. Untreated cells were used as controls. Cell lysates were analyzed for HA cleavage by immunoblotting using H7- and IBV HA-specific antibodies, respectively. Beta-actin was used as a loading control. Lanes are spliced together from one immunoblot from one experiment. (G) Spread of FPV/H7N1 in T-ex5-treated AECII. Cells with or without T-ex5 treatment for 24 h were infected with FPV/H7N1 and incubated in the presence or absence of T-ex5 for 24 h. Cells were immunostained against viral NP, pro-SP-C, and DAPI. (H) Effect of PPMO treatment on AECII viability. AECII were treated with PPMO for 24 h. Cell viability of untreated (w/o) cells was set as 100%. Results are mean values ± SD ( n = 3).

Techniques Used: Activity Assay, Activation Assay, Infection, Incubation, Plaque Assay, SDS Page, Western Blot, Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Marker

37) Product Images from "Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-targeted T-cells"

Article Title: Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-targeted T-cells

Journal: Nature

doi: 10.1038/s41586-018-0178-z

Detection of TET2 chimaeric transcripts in Patient-10 CAR T cells and DNA sequencing for mutation detection. a, The strategy for detection of polyadenylated RNA corresponding to truncated TET2 transcripts is depicted. Boxes represent the genomic regions between TET2 exons 9 and 10 with the integrated vector present. Blue and red arrows indicate general locations of the forward and reverse primers, which are listed below the diagram. LTR, long terminal repeat; cPPT, polypurine tract; EF1α, elongation factor 1-α promoter. Sequences corresponding to the splice junctions for the three chimaeric messages (five total junctions) are listed in the bottom chart. Underlines indicate consensus splice donors and acceptors. b, Visualization of chimaeric TET2 RT–PCR products. PCR products were separated on a native agarose gel and stained with ethidium bromide. Expected sizes of amplicons are listed above the gel. Truncated transcripts are highlighted by blue boxes. A key to the RT–PCR reactions is shown below the diagram. *Band size not determined (two independent experiments). c, Genes interrogated by the next generation sequencing panel used to analyse DNA isolated from CD8 + CAR + T cells and CAR − T cells in Patient-10 at the peak of his response. d, Sanger sequencing of specific amplifications corresponding to the allele that was disrupted by integration of the CAR lentivirus is shown. The mutation that was detected by next generation sequencing of total genomic DNA from CAR + T cells () is not present in the TET2 allele hosting the lentiviral integration site. Fig. 3c

Figure Legend Snippet: Detection of TET2 chimaeric transcripts in Patient-10 CAR T cells and DNA sequencing for mutation detection. a, The strategy for detection of polyadenylated RNA corresponding to truncated TET2 transcripts is depicted. Boxes represent the genomic regions between TET2 exons 9 and 10 with the integrated vector present. Blue and red arrows indicate general locations of the forward and reverse primers, which are listed below the diagram. LTR, long terminal repeat; cPPT, polypurine tract; EF1α, elongation factor 1-α promoter. Sequences corresponding to the splice junctions for the three chimaeric messages (five total junctions) are listed in the bottom chart. Underlines indicate consensus splice donors and acceptors. b, Visualization of chimaeric TET2 RT–PCR products. PCR products were separated on a native agarose gel and stained with ethidium bromide. Expected sizes of amplicons are listed above the gel. Truncated transcripts are highlighted by blue boxes. A key to the RT–PCR reactions is shown below the diagram. *Band size not determined (two independent experiments). c, Genes interrogated by the next generation sequencing panel used to analyse DNA isolated from CD8 + CAR + T cells and CAR − T cells in Patient-10 at the peak of his response. d, Sanger sequencing of specific amplifications corresponding to the allele that was disrupted by integration of the CAR lentivirus is shown. The mutation that was detected by next generation sequencing of total genomic DNA from CAR + T cells () is not present in the TET2 allele hosting the lentiviral integration site. Fig. 3c

Techniques Used: DNA Sequencing, Mutagenesis, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Next-Generation Sequencing, Isolation, Sequencing

38) Product Images from "Human Stem Cell-Derived Neurons: A System to Study Human Tau Function and Dysfunction"

Article Title: Human Stem Cell-Derived Neurons: A System to Study Human Tau Function and Dysfunction

Journal: PLoS ONE

doi: 10.1371/journal.pone.0013947

Tau expression in hESC-derived neurons. (A) RT-PCR for 3R and 4R tau isoforms in hESCs before differentiation (hES) and in adult human brain. hESCs do not express tau protein while in the adult human brain the ratio between 3R and 4R tau mRNA is about 1∶1. (B) RT-PCR for 3R and 4R tau in hESCs at 7 DIV, 14 DIV, 21 DIV, 35 DIV, 72 DIV and adult brain tissue shows that 4R tau increases during neuronal differentiation. (C) (a–l): immunocytochemistry for 3R tau (green), β-IIItubulin (red) and DAPI (blue) after 14 DIV (a–d), 21 DIV (e–h) and 35 DIV (i–l). 3R tau co-localizes with β-IIItubulin and is strongly expressed in neuronal cell bodies and axons. (m–x): Immunocytochemistry for 4R tau (green), β-IIItubulin (red) and DAPI (blue) at 14 DIV (m–p), 21 DIV (q–t) and 35 DIV (u–x). Four repeat tau is not expressed at 14 DIV, but it starts to appear in cell bodies at 21 DIV. The expression of 4R tau becomes stronger at 35 DIV when is present also in axons. RD3 and RD4 antibodies were used to detect 3R and 4R tau.

Figure Legend Snippet: Tau expression in hESC-derived neurons. (A) RT-PCR for 3R and 4R tau isoforms in hESCs before differentiation (hES) and in adult human brain. hESCs do not express tau protein while in the adult human brain the ratio between 3R and 4R tau mRNA is about 1∶1. (B) RT-PCR for 3R and 4R tau in hESCs at 7 DIV, 14 DIV, 21 DIV, 35 DIV, 72 DIV and adult brain tissue shows that 4R tau increases during neuronal differentiation. (C) (a–l): immunocytochemistry for 3R tau (green), β-IIItubulin (red) and DAPI (blue) after 14 DIV (a–d), 21 DIV (e–h) and 35 DIV (i–l). 3R tau co-localizes with β-IIItubulin and is strongly expressed in neuronal cell bodies and axons. (m–x): Immunocytochemistry for 4R tau (green), β-IIItubulin (red) and DAPI (blue) at 14 DIV (m–p), 21 DIV (q–t) and 35 DIV (u–x). Four repeat tau is not expressed at 14 DIV, but it starts to appear in cell bodies at 21 DIV. The expression of 4R tau becomes stronger at 35 DIV when is present also in axons. RD3 and RD4 antibodies were used to detect 3R and 4R tau.

Techniques Used: Expressing, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Immunocytochemistry

RT-PCR quantification of tau isoform expression. (A) hESC-derived neurons: quantification (Image J software) of 3R and 4R tau RT-PCR bands shows that the ratio between 3R and 4R tau isoforms becomes similar to that in adult human brain [1] during neuronal differentiation. (B) hFSC-derived neurons: quantification (Image J software) of 3R and 4R tau RT-PCR bands shows that the time for differentiation of neurons derived from hFSCs is shorter than that for hESCs, at 21 DIV the ratio between 3R and 4R tau isoforms is already similar to that in adult human brain [1] .

Figure Legend Snippet: RT-PCR quantification of tau isoform expression. (A) hESC-derived neurons: quantification (Image J software) of 3R and 4R tau RT-PCR bands shows that the ratio between 3R and 4R tau isoforms becomes similar to that in adult human brain [1] during neuronal differentiation. (B) hFSC-derived neurons: quantification (Image J software) of 3R and 4R tau RT-PCR bands shows that the time for differentiation of neurons derived from hFSCs is shorter than that for hESCs, at 21 DIV the ratio between 3R and 4R tau isoforms is already similar to that in adult human brain [1] .

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Derivative Assay, Software

Tau expression in hFSC-derived neurons. (A) RT-PCR for 3R and 4R tau in hFSCs after 1 DIV, 7 DIV, 14 DIV and 21 DIV. Four repeat tau mRNA appears after 7 DIV and increases during neuronal differentiation. At 21DIV the level of expression of 3R tau is reduced. (B) (a–h): immunocytochemistry for 3R tau (green), β-IIItubulin (red) and DAPI (blue) in hFSC-derived neurons at 7 DIV (a–d) and 21 DIV (e–h). At 7 DIV 3R tau is strongly expressed in both cell bodies and axons as seen also at 21 DIV. (i–p): immunocytochemistry for 4R tau (green), β-IIItubulin (red) and DAPI (blue) in neurons at 7 DIV and 21 DIV. At 7 DIV 4R tau is visibile in cell bodies while at 21 DIV is present in both cell bodies and axons. (C) Immunoblot of tau isoforms extracted from hFSC-derived neurones. At 28 DIV only the two shortest 3R and 4R isoforms are visible while at 35 DIV and 56 DIV all six tau isoforms are present. Anti-human tau antibody (Dako, 1∶1000) is used for immunoblotting.

Figure Legend Snippet: Tau expression in hFSC-derived neurons. (A) RT-PCR for 3R and 4R tau in hFSCs after 1 DIV, 7 DIV, 14 DIV and 21 DIV. Four repeat tau mRNA appears after 7 DIV and increases during neuronal differentiation. At 21DIV the level of expression of 3R tau is reduced. (B) (a–h): immunocytochemistry for 3R tau (green), β-IIItubulin (red) and DAPI (blue) in hFSC-derived neurons at 7 DIV (a–d) and 21 DIV (e–h). At 7 DIV 3R tau is strongly expressed in both cell bodies and axons as seen also at 21 DIV. (i–p): immunocytochemistry for 4R tau (green), β-IIItubulin (red) and DAPI (blue) in neurons at 7 DIV and 21 DIV. At 7 DIV 4R tau is visibile in cell bodies while at 21 DIV is present in both cell bodies and axons. (C) Immunoblot of tau isoforms extracted from hFSC-derived neurones. At 28 DIV only the two shortest 3R and 4R isoforms are visible while at 35 DIV and 56 DIV all six tau isoforms are present. Anti-human tau antibody (Dako, 1∶1000) is used for immunoblotting.

Techniques Used: Expressing, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Immunocytochemistry

39) Product Images from "Tumor Necrosis Factor Alpha-Induced Hypoxia-Inducible Factor 1?-?-Catenin Axis Regulates Major Histocompatibility Complex Class I Gene Activation through Chromatin Remodeling"

Article Title: Tumor Necrosis Factor Alpha-Induced Hypoxia-Inducible Factor 1?-?-Catenin Axis Regulates Major Histocompatibility Complex Class I Gene Activation through Chromatin Remodeling

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.01254-12

$Increased association of CREB with Brg1 but not hBrm. (A) TNF-α has no effect on the levels of hBrm and Brg1. Shown is a Western blot analysis indicating nuclear hBrm and Brg1 levels in TNF-α-treated cells. C-23 levels are shown as a loading control (lane C). (B) TNF-α induces acetylation of hBrm. Nuclear extracts from TNF-α-treated cells were immunoprecipitated with anti-hBrm antibody and analyzed for the levels of acetylated hBrm with a pan-acetylated-lysine antibody. IB, immunoblot. (C) TNF-α increases the association between CREB and Brg1 but not hBrm in a β-catenin-dependent manner. Nuclear extracts from cells transfected with β-catenin siRNA and treated with TNF-α were immunoprecipitated with CREB antibody, and an immunoblot analysis was done with Brg1 and hBrm antibodies. Band density was normalized against IgG levels under the same conditions. NS, nonspecific. (D, E) ChIP and ChIP-qPCR analyses indicating the relative changes in hBrm and Brg1 binding levels at the SXY module of the MHC-I promoter upon TNF-α treatment in a β-catenin-dependent manner. A representative gel image of the precleared fraction (Input) and the anti-Brg1- or anti-hBrm antibody-immunoprecipitated sample after PCR amplification is shown. DNA samples immunoprecipitated with the indicated antibodies were also subjected to qPCR along with the diluted input (1%), and the n -fold enrichment was calculated relative to control levels after correction for background signals. qPCR data bars indicate relative changes ( n -fold) in enrichment over the control levels ± the standard deviations from two independent sets. (F) Brg1 activity is crucial for MHC-I expression. RT-PCR for MHC-I expression in TNF-α-treated cells transfected with ATPase-deficient Brg1 with a mutation in the ATPase subunit (K-R). GAPDH levels were used as internal controls. All experiments were performed with glioma cell line T98G.$
Figure Legend Snippet: Increased association of CREB with Brg1 but not hBrm. (A) TNF-α has no effect on the levels of hBrm and Brg1. Shown is a Western blot analysis indicating nuclear hBrm and Brg1 levels in TNF-α-treated cells. C-23 levels are shown as a loading control (lane C). (B) TNF-α induces acetylation of hBrm. Nuclear extracts from TNF-α-treated cells were immunoprecipitated with anti-hBrm antibody and analyzed for the levels of acetylated hBrm with a pan-acetylated-lysine antibody. IB, immunoblot. (C) TNF-α increases the association between CREB and Brg1 but not hBrm in a β-catenin-dependent manner. Nuclear extracts from cells transfected with β-catenin siRNA and treated with TNF-α were immunoprecipitated with CREB antibody, and an immunoblot analysis was done with Brg1 and hBrm antibodies. Band density was normalized against IgG levels under the same conditions. NS, nonspecific. (D, E) ChIP and ChIP-qPCR analyses indicating the relative changes in hBrm and Brg1 binding levels at the SXY module of the MHC-I promoter upon TNF-α treatment in a β-catenin-dependent manner. A representative gel image of the precleared fraction (Input) and the anti-Brg1- or anti-hBrm antibody-immunoprecipitated sample after PCR amplification is shown. DNA samples immunoprecipitated with the indicated antibodies were also subjected to qPCR along with the diluted input (1%), and the n -fold enrichment was calculated relative to control levels after correction for background signals. qPCR data bars indicate relative changes ( n -fold) in enrichment over the control levels ± the standard deviations from two independent sets. (F) Brg1 activity is crucial for MHC-I expression. RT-PCR for MHC-I expression in TNF-α-treated cells transfected with ATPase-deficient Brg1 with a mutation in the ATPase subunit (K-R). GAPDH levels were used as internal controls. All experiments were performed with glioma cell line T98G.

Techniques Used: Western Blot, Immunoprecipitation, Transfection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Polymerase Chain Reaction, Amplification, Activity Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Mutagenesis

40) Product Images from "Decoding the Substrate Supply to Human Neuronal Nitric Oxide Synthase"

Article Title: Decoding the Substrate Supply to Human Neuronal Nitric Oxide Synthase

Journal: PLoS ONE

doi: 10.1371/journal.pone.0067707

nNOS in TGW-nu-I cells can use both, citrulline-to-arginine recycling and protein degradation as intracellular substrate source. ( A ) and ( B ) NO measurements and data analyses were performed by RFL-6 reporter cell assays as described in Figure 1 . Thirty min pre-incubations and transfers were performed in LS with the indicated amino acids (single or in combination): 1 mM arginine, 1 mM lysine, 4 mM glutamine, 4 mM citrulline, or 4 mM histidine. The basal cGMP content of the RFL-6 cells was subtracted. The values obtained from cells incubated in 1mM lysine were calculated as % of the mean of the values obtained from the corresponding control cells incubated in 1 mM arginine. Columns represent mean ± S.E.M. ( n = 6 (A) and n = 6–12 (B), one way ANOVA with Bonferroni post hoc test). ( C ) Total RNA from A673, TGW-nu-I, and EA.hy926 cells (0.5 µg both) was analyzed by qRT/PCR for PHT1 expression as described in the methods section. GAPDH was chosen as housekeeping gene for relative determinations. (means ± S.E.M., n = 3).

Figure Legend Snippet: nNOS in TGW-nu-I cells can use both, citrulline-to-arginine recycling and protein degradation as intracellular substrate source. ( A ) and ( B ) NO measurements and data analyses were performed by RFL-6 reporter cell assays as described in Figure 1 . Thirty min pre-incubations and transfers were performed in LS with the indicated amino acids (single or in combination): 1 mM arginine, 1 mM lysine, 4 mM glutamine, 4 mM citrulline, or 4 mM histidine. The basal cGMP content of the RFL-6 cells was subtracted. The values obtained from cells incubated in 1mM lysine were calculated as % of the mean of the values obtained from the corresponding control cells incubated in 1 mM arginine. Columns represent mean ± S.E.M. ( n = 6 (A) and n = 6–12 (B), one way ANOVA with Bonferroni post hoc test). ( C ) Total RNA from A673, TGW-nu-I, and EA.hy926 cells (0.5 µg both) was analyzed by qRT/PCR for PHT1 expression as described in the methods section. GAPDH was chosen as housekeeping gene for relative determinations. (means ± S.E.M., n = 3).

Techniques Used: Incubation, Quantitative RT-PCR, Expressing

Nucleic Acid Electrophoresis:

Article Title: The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes
Article Snippet: .. Reverse-transcriptase PCR (RT-PCR) was used for analysis of tissue-specific gene expression using 1 μg of each RNA template and the One-Step RT-PCR kit (Qiagen, Germantown, MD, USA), followed by gel electrophoresis. .. Quantitative PCR was performed as previously described ( ) with Power SYBR Green PCR Mastermix on the StepOne or 7300 Real-time PCR System (Life Technologies, Grand Island, NY, USA); samples were compared with the levels of actin mRNA.

Amplification:

Article Title: RNA editing generates cellular subsets with diverse sequence within populations
Article Snippet: .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

Polymerase Chain Reaction:

Quantitative RT-PCR:

Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

Reverse Transcription Polymerase Chain Reaction:

Article Title: The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun
Article Snippet: .. RNA samples were then diluted with water to a final concentration of 5 ng/μl RNA and the RT-PCR reaction was carried out using the Qiagen One-Step RT-PCR Kit, using 0.4 mM dNTPs and 0.6 μM of each primer, according to published protocols. ..

Article Title: A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower
Article Snippet: .. Semi-quantitative (sq)RT-PCR was performed using a Qiagen One-step RT-PCR kit (Qiagen Co., Valencia, CA, USA) with 50ng total RNA. .. To visualize RNA loading concentrations, samples were amplified with Ph 18S primers and analyzed on an agarose gel.

Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
Article Snippet: .. All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. To visualize RNA-loading concentrations, samples were amplified with Ph 18S primers (forward primer 5′-TTAGCAGGCTGAGGTCTCGT-3′; reverse primer 5′-AGCGGATGTTGCTTTTAGGA-3′) and analyzed on an agarose gel.

Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1
Article Snippet: .. Afterwards, 1 µl was used as template for the One-Step RT PCR kit (Qiagen) using either KIN5 primers (tkin5.40s CCAGCAGCATAAGCTATGG ; tkin5.40a ATGAAGACTGTTGCCGCCACC ) or PGM1 primers (PGM3s AAAAGGTTAGTGGTTGTTAAGG ; PGM3a CTTGTGTAAATCATACTTTATTT ) in a total reaction volume of 25 µl. .. The reaction conditions were performed on the Geneamp PCR System 2400 (Perkin Elmer) as follows: 50°C – 30 min, 95°C – 15 min; 95°C – 45 sec, 57°C – 1 min, 72°C – 1 min for 35 cycles; 72°C – 10 min; 4°C hold.

Structured Review

Related Products / Commonly Used Together

Images

1) Product Images from "Simultaneous Extraction from Bacterioplankton of Total RNA and DNA Suitable for Quantitative Structure and Function Analyses"

2) Product Images from "Hmx3a Has Essential Functions in Zebrafish Spinal Cord, Ear and Lateral Line Development"

3) Product Images from "Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore"

4) Product Images from "RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †"

5) Product Images from "RNA editing generates cellular subsets with diverse sequence within populations"

6) Product Images from "The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun"

7) Product Images from "A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower"

8) Product Images from "EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]"

9) Product Images from "Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1"

10) Product Images from "The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes"

11) Product Images from "The arginine methyltransferase NDUFAF7 is essential for complex I assembly and early vertebrate embryogenesis"

12) Product Images from "Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia"

13) Product Images from "Loss of lysine-specific demethylase 1 nonautonomously causes stem cell tumors in the Drosophila ovary"

14) Product Images from "Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain G?1"

15) Product Images from "Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation"

16) Product Images from "Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)"

17) Product Images from "The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development"

18) Product Images from "Single injection recombinant vesicular stomatitis virus vaccines protect ferrets against lethal Nipah virus disease"

19) Product Images from "Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types"

20) Product Images from "HIV-1 Tropism Determination Using a Phenotypic Env Recombinant Viral Assay Highlights Overestimation of CXCR4-Usage by Genotypic Prediction Algorithms for CRRF01_AE and CRF02_AG"

21) Product Images from "Sensitive Genotyping of Foodborne-Associated Human Noroviruses and Hepatitis A Virus Using an Array-Based Platform"

22) Product Images from "Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma"

23) Product Images from "PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !"

24) Product Images from "Dimethylfumarate protects against TNF-α-induced secretion of inflammatory cytokines in human endothelial cells"

25) Product Images from "All-in-One Dual CRISPR-Cas12a (AIOD-CRISPR) Assay: A Case for Rapid, Ultrasensitive and Visual Detection of Novel Coronavirus SARS-CoV-2 and HIV virus"

26) Product Images from "Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish"

27) Product Images from "miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi"

28) Product Images from "Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers"

29) Product Images from "A Novel Calcium Uptake Transporter of Uncharacterized P-Type ATPase Family Supplies Calcium for Cell Surface Integrity in Mycobacterium smegmatis"

30) Product Images from "Modeling the neuropsychiatric manifestations of Lowe syndrome using induced pluripotent stem cells: defective F-actin polymerization and WAVE-1 expression in neuronal cells"

31) Product Images from "Immunocompetent mouse model for Crimean-Congo hemorrhagic fever virus"

32) Product Images from "Highly Specific Gene Silencing by Artificial miRNAs in Rice"

33) Product Images from "High-Throughput Detection of West Nile Virus RNA"

34) Product Images from "Spore Germination Mediated by Bacillus megaterium QM B1551 SleL and YpeB"

35) Product Images from "Prostate-derived Ets transcription factor (PDEF) downregulates survivin expression and inhibits breast cancer cell growth in vitro and xenograft tumor formation in vivo"

36) Product Images from "TMPRSS2 Is the Major Activating Protease of Influenza A Virus in Primary Human Airway Cells and Influenza B Virus in Human Type II Pneumocytes"

37) Product Images from "Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-targeted T-cells"

38) Product Images from "Human Stem Cell-Derived Neurons: A System to Study Human Tau Function and Dysfunction"

39) Product Images from "Tumor Necrosis Factor Alpha-Induced Hypoxia-Inducible Factor 1?-?-Catenin Axis Regulates Major Histocompatibility Complex Class I Gene Activation through Chromatin Remodeling"

40) Product Images from "Decoding the Substrate Supply to Human Neuronal Nitric Oxide Synthase"

Related Articles

Nucleic Acid Electrophoresis:

Amplification:

Polymerase Chain Reaction:

Quantitative RT-PCR:

Reverse Transcription Polymerase Chain Reaction:

SYBR Green Assay:

Concentration Assay:

Expressing:

Modification:

Nested PCR:

Similar Products

Image Search Results