multiplex pcr enzyme kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAGEN Multiplex PCR Kit
    Description:
    For highly specific and sensitive multiplex PCR without optimization requirements Kit contents Qiagen Multiplex PCR Kit 100 x 50L rxns Genomic DNA and cDNA Sample PCR Amplification Reaction 5 3 Exonuclease Enzyme Activity Easy to use and Cost effective For Highly Specific and Sensitive Multiplex PCR Without Optimization Requirements Includes 2x Qiagen Multiplex PCR Master Mix Providing a Final Concentration of 3mM MgCl2 3 x 0 85mL 5x Q Solution 1 x 2 0mL RNase free Water 2 x 1 7mL Benefits No optimization required High specificity and sensitivity with a built in hot start Highly suited for many types of multiplex PCR applications Easy to use and cost effectiv
    Catalog Number:
    206143
    Price:
    284
    Category:
    QIAGEN Multiplex PCR Kit
    Buy from Supplier


    Structured Review

    Qiagen multiplex pcr enzyme kit
    QIAGEN Multiplex PCR Kit
    For highly specific and sensitive multiplex PCR without optimization requirements Kit contents Qiagen Multiplex PCR Kit 100 x 50L rxns Genomic DNA and cDNA Sample PCR Amplification Reaction 5 3 Exonuclease Enzyme Activity Easy to use and Cost effective For Highly Specific and Sensitive Multiplex PCR Without Optimization Requirements Includes 2x Qiagen Multiplex PCR Master Mix Providing a Final Concentration of 3mM MgCl2 3 x 0 85mL 5x Q Solution 1 x 2 0mL RNase free Water 2 x 1 7mL Benefits No optimization required High specificity and sensitivity with a built in hot start Highly suited for many types of multiplex PCR applications Easy to use and cost effectiv
    https://www.bioz.com/result/multiplex pcr enzyme kit/product/Qiagen
    Average 99 stars, based on 13227 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr enzyme kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines "

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.02021-08

    The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product
    Figure Legend Snippet: The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product

    Techniques Used: Agarose Gel Electrophoresis, Multiplex Assay, Polymerase Chain Reaction

    2) Product Images from "Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos"

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0006532

    Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.
    Figure Legend Snippet: Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Positive Control, Purification, Negative Control

    3) Product Images from "Oral and Gastric Helicobacter Pylori: Effects and Associations"

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0126923

    H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.
    Figure Legend Snippet: H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Techniques Used: Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.
    Figure Legend Snippet: Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Techniques Used: Polymerase Chain Reaction, Amplification

    4) Product Images from "Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens"

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid1102.040492

    Analysis of clinical specimens. RNA extracts from clinical specimens containing known pathogens were reverse transcribed into cDNA (Superscript RT system, Invitrogen, Carlsbad, CA; 20-µL volume). Five microliters of the reaction were subjected to Mass Tag PCR by using primers coupled to Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). Detection of (A) influenza virus A (H1N1), (B) respiratory syncytial virus (RSV) group B, (C) human coronavirus SARS (HCoV-SARS), (D) human parainfluenza virus (HPIV) types 1 and (E) 3, and (F) enterovirus (EV) by using a 30-plex assay, including 60 primers targeting influenza A virus matrix gene (FLUAV-M), and for typing N1, N2, H1, H2, H3, and H5 sequences, as well as influenza B virus (FLUBV), RSV groups A and B, HCoV-229E, -OC43, and -SARS, HPIV types 1, 2, 3, and 4 (groups A and B combined; 4 primers), human metapneumovirus (HMPV, 4 primers), measles virus (MEV), EV (degenerate primer pair targeting all serogroups), human adenoviruses (HAdV, degenerate primer pair targeting all serogroups), human herpesvirus 1 (HHV-1, herpes simplex virus), human herpesvirus 3 (HHV-3; varicella-zoster virus), Mycoplasma pneumoniae , Chlamydia pneumoniae , Legionella pneumophila , Streptococcus pneumoniae , Haemophilus influenzae . The bar indicates an arbitrary cut-off threshold of 2.7 (4 times average background determined with random human DNA).
    Figure Legend Snippet: Analysis of clinical specimens. RNA extracts from clinical specimens containing known pathogens were reverse transcribed into cDNA (Superscript RT system, Invitrogen, Carlsbad, CA; 20-µL volume). Five microliters of the reaction were subjected to Mass Tag PCR by using primers coupled to Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). Detection of (A) influenza virus A (H1N1), (B) respiratory syncytial virus (RSV) group B, (C) human coronavirus SARS (HCoV-SARS), (D) human parainfluenza virus (HPIV) types 1 and (E) 3, and (F) enterovirus (EV) by using a 30-plex assay, including 60 primers targeting influenza A virus matrix gene (FLUAV-M), and for typing N1, N2, H1, H2, H3, and H5 sequences, as well as influenza B virus (FLUBV), RSV groups A and B, HCoV-229E, -OC43, and -SARS, HPIV types 1, 2, 3, and 4 (groups A and B combined; 4 primers), human metapneumovirus (HMPV, 4 primers), measles virus (MEV), EV (degenerate primer pair targeting all serogroups), human adenoviruses (HAdV, degenerate primer pair targeting all serogroups), human herpesvirus 1 (HHV-1, herpes simplex virus), human herpesvirus 3 (HHV-3; varicella-zoster virus), Mycoplasma pneumoniae , Chlamydia pneumoniae , Legionella pneumophila , Streptococcus pneumoniae , Haemophilus influenzae . The bar indicates an arbitrary cut-off threshold of 2.7 (4 times average background determined with random human DNA).

    Techniques Used: Polymerase Chain Reaction, Plex Assay

    5) Product Images from "A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)"

    Article Title: A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075268

    Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.
    Figure Legend Snippet: Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.

    Techniques Used: Isolation, DNA Extraction, Amplification, Digital PCR

    6) Product Images from "A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)"

    Article Title: A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075268

    Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.
    Figure Legend Snippet: Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.

    Techniques Used: Isolation, DNA Extraction, Amplification, Digital PCR

    In vivo activity of UGT73C14 against ABA. (A) Relative transcript abundance of G . hirsutum UGT73C14 in transgenic Arabidopsis lines evaluated by RT-qPCR analysis. Error bars represent the standard deviation from three plants of line. (B) Transgenic Arabidopsis thaliana seeds overexpressing UGT73C14 (lines 9, 17, and 23) and wild type (Wt) were plated on phytagel supplemented with 2.2g/L Murashige and Skoog basal salts at pH 6.0. Each transgenic or wild type line was plated with and without filter sterilized 0.5μM Abscisic Acid in the phytagel. After 4 days at 4°C in darkness, germination occurred over 14 days in 8: 16 hr dark: light cycles at 18°C and 22°C, respectively. The percentage of germinated seedlings showing 2 emerged cotyledons was determined on days 0, 3, 7, 10 and 14. Statistical analysis of cotyledon emergence rate between transgenic and wild type plants is provided in Data S1. Error bars represent the standard deviation. (C) Representative picture of cotyledon emergence of wild type and UGT73C14 in the absence (left) or presence of 0.5 µM Abscisic Acid (right). The pictures were taken on day 6 after planting of T2 transgenic seeds of line 9 and wild type.
    Figure Legend Snippet: In vivo activity of UGT73C14 against ABA. (A) Relative transcript abundance of G . hirsutum UGT73C14 in transgenic Arabidopsis lines evaluated by RT-qPCR analysis. Error bars represent the standard deviation from three plants of line. (B) Transgenic Arabidopsis thaliana seeds overexpressing UGT73C14 (lines 9, 17, and 23) and wild type (Wt) were plated on phytagel supplemented with 2.2g/L Murashige and Skoog basal salts at pH 6.0. Each transgenic or wild type line was plated with and without filter sterilized 0.5μM Abscisic Acid in the phytagel. After 4 days at 4°C in darkness, germination occurred over 14 days in 8: 16 hr dark: light cycles at 18°C and 22°C, respectively. The percentage of germinated seedlings showing 2 emerged cotyledons was determined on days 0, 3, 7, 10 and 14. Statistical analysis of cotyledon emergence rate between transgenic and wild type plants is provided in Data S1. Error bars represent the standard deviation. (C) Representative picture of cotyledon emergence of wild type and UGT73C14 in the absence (left) or presence of 0.5 µM Abscisic Acid (right). The pictures were taken on day 6 after planting of T2 transgenic seeds of line 9 and wild type.

    Techniques Used: In Vivo, Activity Assay, Transgenic Assay, Quantitative RT-PCR, Standard Deviation

    LCMS analysis of in vitro activity of UGT73C14 against ABA. Portions of negative LCMS extracted-ion chromatograms (m/z 263.1 + 375.1) show reaction products in the absence of enzyme (A) or with purified protein of UGT73C14 transferring UDP-glucose (C) or UDP-galactose (D) sugar-donors to the substrate acceptor - S. Panel B shows chromatogram of (+)-trans ,trans-ABA standard. S 1 peak represents trans,trans-ABA isoform and S 2 peak corresponds to mixture of (+)-cis,trans-ABA, whereas peaks of products P 1 and P 2 correspond to ABA-glucoside and ABA-galactoside, respectively. Insets represent MS spectra of ABA-glucoside (C) and ABA-galactoside (D).
    Figure Legend Snippet: LCMS analysis of in vitro activity of UGT73C14 against ABA. Portions of negative LCMS extracted-ion chromatograms (m/z 263.1 + 375.1) show reaction products in the absence of enzyme (A) or with purified protein of UGT73C14 transferring UDP-glucose (C) or UDP-galactose (D) sugar-donors to the substrate acceptor - S. Panel B shows chromatogram of (+)-trans ,trans-ABA standard. S 1 peak represents trans,trans-ABA isoform and S 2 peak corresponds to mixture of (+)-cis,trans-ABA, whereas peaks of products P 1 and P 2 correspond to ABA-glucoside and ABA-galactoside, respectively. Insets represent MS spectra of ABA-glucoside (C) and ABA-galactoside (D).

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, In Vitro, Activity Assay, Purification, Transferring, Mass Spectrometry

    7) Product Images from "An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR 1"

    Article Title: An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR 1

    Journal: Applications in Plant Sciences

    doi: 10.3732/apps.1300027

    (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.
    Figure Legend Snippet: (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Labeling, Multiplexing

    8) Product Images from "Chemically modified primers for improved multiplex PCR"

    Article Title: Chemically modified primers for improved multiplex PCR

    Journal: Analytical biochemistry

    doi: 10.1016/j.ab.2009.02.033

    Determining upper limit of targets for single modified OXP primers in multiplex PCR. The number of targets amplified was increased from three to nine targets sequentially with Platinum® Taq and modified OXP primers with 500 copies of Lambda genomic
    Figure Legend Snippet: Determining upper limit of targets for single modified OXP primers in multiplex PCR. The number of targets amplified was increased from three to nine targets sequentially with Platinum® Taq and modified OXP primers with 500 copies of Lambda genomic

    Techniques Used: Modification, Multiplex Assay, Polymerase Chain Reaction, Amplification

    Single modified OXP primers in comparison and combination with other “Hot Start” technologies. A. Triplex PCR reaction at 500 copies template DNA with single modified OXP primers and other modified DNA polymerases. The modified DNA polymerases
    Figure Legend Snippet: Single modified OXP primers in comparison and combination with other “Hot Start” technologies. A. Triplex PCR reaction at 500 copies template DNA with single modified OXP primers and other modified DNA polymerases. The modified DNA polymerases

    Techniques Used: Modification, Polymerase Chain Reaction

    Comparison of the PCR performance of unmodified, single modified and double modified OXP primers in the amplification of three individual targets separately and collectively from 500 copies of Lambda genomic DNA. A. Agarose gel image of individual amplifications
    Figure Legend Snippet: Comparison of the PCR performance of unmodified, single modified and double modified OXP primers in the amplification of three individual targets separately and collectively from 500 copies of Lambda genomic DNA. A. Agarose gel image of individual amplifications

    Techniques Used: Polymerase Chain Reaction, Modification, Amplification, Agarose Gel Electrophoresis

    9) Product Images from "Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos"

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0006532

    Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.
    Figure Legend Snippet: Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Positive Control, Purification, Negative Control

    10) Product Images from "The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota"

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189188

    Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.
    Figure Legend Snippet: Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.
    Figure Legend Snippet: Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    11) Product Images from "Assembly of eukaryotic algal chromosomes in yeast"

    Article Title: Assembly of eukaryotic algal chromosomes in yeast

    Journal: Journal of Biological Engineering

    doi: 10.1186/1754-1611-7-30

    Summary of assembly efficiency for chromosomes 25 and 26. Assembly of each of P. tricornutum chromosomes 25 (A and B) and 26 (C and D) from five overlapping fragments was performed using yeast spheroplast transformation. Fragments to assemble were modified with the URA3 selectable marker in the third fragment only ( A and C ) or URA3 selectable marker in the third fragment and yeast origins of replication in fragments 2, 3, and 4 ( B and D ). One hundred resulting colonies were screened by low resolution multiplex PCR (one amplicon per fragment), and the number of fragments cloned for each assembly was plotted.
    Figure Legend Snippet: Summary of assembly efficiency for chromosomes 25 and 26. Assembly of each of P. tricornutum chromosomes 25 (A and B) and 26 (C and D) from five overlapping fragments was performed using yeast spheroplast transformation. Fragments to assemble were modified with the URA3 selectable marker in the third fragment only ( A and C ) or URA3 selectable marker in the third fragment and yeast origins of replication in fragments 2, 3, and 4 ( B and D ). One hundred resulting colonies were screened by low resolution multiplex PCR (one amplicon per fragment), and the number of fragments cloned for each assembly was plotted.

    Techniques Used: Transformation Assay, Modification, Marker, Multiplex Assay, Polymerase Chain Reaction, Amplification, Clone Assay

    12) Product Images from "Improvements of rolling circle amplification (RCA) efficiency and accuracy using Thermus thermophilus SSB mutant protein"

    Article Title: Improvements of rolling circle amplification (RCA) efficiency and accuracy using Thermus thermophilus SSB mutant protein

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkl350

    PCR examinations of RCA amplified whole genome. PCR amplifications were carried out on 0.5 µl samples of RCA products using human genomic DNA as the template. The products were electrophoresed and stained with ethidium bromide. ( a ) A diagrammatic representation of the subdivided region (a-1–a-6, 8077 bp in GenBank Acc. No. X91835 ). Nucleotide (nt) numbers correspond to registries in GenBank. The PCR amplifications using the RCA products from the reaction shown in Figure 5a lane 1 ( b ), Figure 5a lane 3 ( c ), Figure 5c lane 1 ( d ) and Figure 5c lane 3 ( e ). Throughout (b–e), the six subdivided sites are indicated as lanes 1–6. Locations of the specific PCR products are indicated by arrows.
    Figure Legend Snippet: PCR examinations of RCA amplified whole genome. PCR amplifications were carried out on 0.5 µl samples of RCA products using human genomic DNA as the template. The products were electrophoresed and stained with ethidium bromide. ( a ) A diagrammatic representation of the subdivided region (a-1–a-6, 8077 bp in GenBank Acc. No. X91835 ). Nucleotide (nt) numbers correspond to registries in GenBank. The PCR amplifications using the RCA products from the reaction shown in Figure 5a lane 1 ( b ), Figure 5a lane 3 ( c ), Figure 5c lane 1 ( d ) and Figure 5c lane 3 ( e ). Throughout (b–e), the six subdivided sites are indicated as lanes 1–6. Locations of the specific PCR products are indicated by arrows.

    Techniques Used: Polymerase Chain Reaction, Amplification, Staining

    Multiplex PCR examinations of RCA amplified whole genome. ( a ) Control, multiplex PCR amplifications for the 12 randomly selected human genes using human genomic DNA as the template. Amount of the template DNA for the PCR is indicated. Multiplex PCR amplifications of the 12 human genes using RCA products as the template in the absence ( b ) or presence ( c ) of Tth SSB-255 protein. Amount of the template DNA for RCA is serially diluted as indicated. Throughout (a–c), all samples were amplified with primers at the same primer pair concentrations (0.1 µM per pair). Aliquots of 5 µl volume were electrophoresed through 12.5% acrylamide gel in Tris–borate/EDTA buffer, and stained with SYBR Green (SYBR Green I, Novagen). The signals were detected using a Fluoro Imager (Fluoro Imager 595, Molecular Dynamics). Product sizes (from 57 to 360 bp) are indicated on the right or left side of each panel. The oligonucleotide sequences used for the primers are as follows. Primer sets 1 (chromosome 11), 5′-GGGCA GAGCC ATCTA TTGCT TACA-3′, 5′-GGTTG CTAGT GAACA CAGTT GTGTC A-3′; Primer sets 2 (chromosome 16), 5′-GCACT CTTCT GGTCC CCACA GA, 5′-TTGGT CTTGT CGGCA GGAGA CA-3′; Primer sets 3 (chromosome 8), 5′-GTCCT TCCCC CGCTG GAAAC-3′, 5′-GCAGC AGAGA TCATC GCGCC-3′; Primer sets 4 (chromosome 7), 5′-CACAG ATTTC CAAGG ATGCG CTG, 5′-CGTGC TCTGT TCCAG ACTTG-3′; Primer sets 5 (chromosome 10), 5′-CGTCT GGCGA TTGCT CCAAA TG-3′, 5′-GGGCA GTTGT GATCC ATGAG AA-3′; Primer sets 6 (chromosome 17), 5′-GCCTC TGATT CCTCA CTGAT TGCTC T, 5′-TGTCA ACCAC CCTTA ACCCC TCC-3′; Primer sets 7 (chromosome 20), 5′-TTGGA GGGGT GGGTG AGTCA AG, 5′-GGAGG GGTGG GGGTT AATGG TTA-3′; Primer sets 8 (chromosome 13), 5′-GGAAC AAGAC ACGGC TGGGT T-3′, 5′-AGCAA GGCAG GGCAG GCAAG T-3′; Primer sets 9 (chromosome 3), 5′-CGGTC CCATT CTCAG GGAAT CT-3′, 5′-GCCCA GAGGA AGAAG AAGGA AA-3′; Primer sets 10 (chromosome 1), 5′-GCCCC CACCC AGGTT GGTTT CTA-3′, 5′-ATGCC TTCAT CTGGC TCAGT GAA-3′; Primer sets 11 (chromosome 6), 5′-GCTCA GCATG GTGGT GGCAT AA-3′, 5′-CCTCA TACCT TCCCC CCCAT TT-3′; Primer sets 12 (chromosome 22), 5′-GACTA CTCTA GCGAC TGTCC ATCTC-3′, 5′-GACAG CCACC AGATC CAATC-3′.
    Figure Legend Snippet: Multiplex PCR examinations of RCA amplified whole genome. ( a ) Control, multiplex PCR amplifications for the 12 randomly selected human genes using human genomic DNA as the template. Amount of the template DNA for the PCR is indicated. Multiplex PCR amplifications of the 12 human genes using RCA products as the template in the absence ( b ) or presence ( c ) of Tth SSB-255 protein. Amount of the template DNA for RCA is serially diluted as indicated. Throughout (a–c), all samples were amplified with primers at the same primer pair concentrations (0.1 µM per pair). Aliquots of 5 µl volume were electrophoresed through 12.5% acrylamide gel in Tris–borate/EDTA buffer, and stained with SYBR Green (SYBR Green I, Novagen). The signals were detected using a Fluoro Imager (Fluoro Imager 595, Molecular Dynamics). Product sizes (from 57 to 360 bp) are indicated on the right or left side of each panel. The oligonucleotide sequences used for the primers are as follows. Primer sets 1 (chromosome 11), 5′-GGGCA GAGCC ATCTA TTGCT TACA-3′, 5′-GGTTG CTAGT GAACA CAGTT GTGTC A-3′; Primer sets 2 (chromosome 16), 5′-GCACT CTTCT GGTCC CCACA GA, 5′-TTGGT CTTGT CGGCA GGAGA CA-3′; Primer sets 3 (chromosome 8), 5′-GTCCT TCCCC CGCTG GAAAC-3′, 5′-GCAGC AGAGA TCATC GCGCC-3′; Primer sets 4 (chromosome 7), 5′-CACAG ATTTC CAAGG ATGCG CTG, 5′-CGTGC TCTGT TCCAG ACTTG-3′; Primer sets 5 (chromosome 10), 5′-CGTCT GGCGA TTGCT CCAAA TG-3′, 5′-GGGCA GTTGT GATCC ATGAG AA-3′; Primer sets 6 (chromosome 17), 5′-GCCTC TGATT CCTCA CTGAT TGCTC T, 5′-TGTCA ACCAC CCTTA ACCCC TCC-3′; Primer sets 7 (chromosome 20), 5′-TTGGA GGGGT GGGTG AGTCA AG, 5′-GGAGG GGTGG GGGTT AATGG TTA-3′; Primer sets 8 (chromosome 13), 5′-GGAAC AAGAC ACGGC TGGGT T-3′, 5′-AGCAA GGCAG GGCAG GCAAG T-3′; Primer sets 9 (chromosome 3), 5′-CGGTC CCATT CTCAG GGAAT CT-3′, 5′-GCCCA GAGGA AGAAG AAGGA AA-3′; Primer sets 10 (chromosome 1), 5′-GCCCC CACCC AGGTT GGTTT CTA-3′, 5′-ATGCC TTCAT CTGGC TCAGT GAA-3′; Primer sets 11 (chromosome 6), 5′-GCTCA GCATG GTGGT GGCAT AA-3′, 5′-CCTCA TACCT TCCCC CCCAT TT-3′; Primer sets 12 (chromosome 22), 5′-GACTA CTCTA GCGAC TGTCC ATCTC-3′, 5′-GACAG CCACC AGATC CAATC-3′.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Amplification, Acrylamide Gel Assay, Staining, SYBR Green Assay, CTG Assay

    13) Product Images from "A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)"

    Article Title: A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075268

    Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.
    Figure Legend Snippet: Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.

    Techniques Used: Isolation, DNA Extraction, Amplification, Digital PCR

    14) Product Images from "Chemically modified primers for improved multiplex PCR"

    Article Title: Chemically modified primers for improved multiplex PCR

    Journal: Analytical biochemistry

    doi: 10.1016/j.ab.2009.02.033

    Determining upper limit of targets for single modified OXP primers in multiplex PCR. The number of targets amplified was increased from three to nine targets sequentially with Platinum® Taq and modified OXP primers with 500 copies of Lambda genomic
    Figure Legend Snippet: Determining upper limit of targets for single modified OXP primers in multiplex PCR. The number of targets amplified was increased from three to nine targets sequentially with Platinum® Taq and modified OXP primers with 500 copies of Lambda genomic

    Techniques Used: Modification, Multiplex Assay, Polymerase Chain Reaction, Amplification

    Single modified OXP primers in comparison and combination with other “Hot Start” technologies. A. Triplex PCR reaction at 500 copies template DNA with single modified OXP primers and other modified DNA polymerases. The modified DNA polymerases
    Figure Legend Snippet: Single modified OXP primers in comparison and combination with other “Hot Start” technologies. A. Triplex PCR reaction at 500 copies template DNA with single modified OXP primers and other modified DNA polymerases. The modified DNA polymerases

    Techniques Used: Modification, Polymerase Chain Reaction

    Comparison of the PCR performance of unmodified, single modified and double modified OXP primers in the amplification of three individual targets separately and collectively from 500 copies of Lambda genomic DNA. A. Agarose gel image of individual amplifications
    Figure Legend Snippet: Comparison of the PCR performance of unmodified, single modified and double modified OXP primers in the amplification of three individual targets separately and collectively from 500 copies of Lambda genomic DNA. A. Agarose gel image of individual amplifications

    Techniques Used: Polymerase Chain Reaction, Modification, Amplification, Agarose Gel Electrophoresis

    15) Product Images from "New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP"

    Article Title: New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP

    Journal: Molecular Vision

    doi:

    Pedigree and gel electrophoresis analysis of family RPT65. A : Pedigree of the adRP family RPT65, which carries the genetic variant c.307G > (p.Gly103Arg) causing the COL6A6 /827-bp deletion (g.9281_10108del) in RHO . The genetic varian in COL6A6 was detected by capillary Sanger sequencing and fluorescence resonance energy transfer (FRET) assay, with (+) indicating the presence of genetic variants and (−) indicating wild-type alleles. Squares and circles represent men and women, respectively. The open symbols represent unaffected family members. Completely filled symbols represent patients with retinitis pigmentosa who underwent ophthalmic examination before genetic variant analysis was performed. Semifilled symbols represent carriers of the genetic variants who were not clinically diagnosed with RP before the molecular analysis. Ophthalmic examination of III:8 and III:10 showed a RP phenotype. B : Gel electrophoresis of the PCR products obtained by amplification of genomic DNA from the family members showing the deletion (g.9281_10108del) in RHO.
    Figure Legend Snippet: Pedigree and gel electrophoresis analysis of family RPT65. A : Pedigree of the adRP family RPT65, which carries the genetic variant c.307G > (p.Gly103Arg) causing the COL6A6 /827-bp deletion (g.9281_10108del) in RHO . The genetic varian in COL6A6 was detected by capillary Sanger sequencing and fluorescence resonance energy transfer (FRET) assay, with (+) indicating the presence of genetic variants and (−) indicating wild-type alleles. Squares and circles represent men and women, respectively. The open symbols represent unaffected family members. Completely filled symbols represent patients with retinitis pigmentosa who underwent ophthalmic examination before genetic variant analysis was performed. Semifilled symbols represent carriers of the genetic variants who were not clinically diagnosed with RP before the molecular analysis. Ophthalmic examination of III:8 and III:10 showed a RP phenotype. B : Gel electrophoresis of the PCR products obtained by amplification of genomic DNA from the family members showing the deletion (g.9281_10108del) in RHO.

    Techniques Used: Nucleic Acid Electrophoresis, Variant Assay, Sequencing, Fluorescence, Förster Resonance Energy Transfer, Polymerase Chain Reaction, Amplification

    16) Product Images from "Finding Wolbachia in Filarial larvae and Culicidae Mosquitoes in Upper Egypt Governorate"

    Article Title: Finding Wolbachia in Filarial larvae and Culicidae Mosquitoes in Upper Egypt Governorate

    Journal: The Korean Journal of Parasitology

    doi: 10.3347/kjp.2016.54.3.265

    Detection of Wolbachia endosymbiotic bacterial DNA in pools by single PCR of indoor-resting mosquitoes. Lane 1, El-Nikhila village; lane 2, El-Matiaa village; lane 3, Sahel Seleem city; lane 4, El-Badary city; lane 5, Mankabad village; lane 6, Dairout city; lane 7, Manfalout city. M, 100 bp DNA marker; N, negative control (non-blood fed mosquitoes). Wolbachia detected at 438 bp.
    Figure Legend Snippet: Detection of Wolbachia endosymbiotic bacterial DNA in pools by single PCR of indoor-resting mosquitoes. Lane 1, El-Nikhila village; lane 2, El-Matiaa village; lane 3, Sahel Seleem city; lane 4, El-Badary city; lane 5, Mankabad village; lane 6, Dairout city; lane 7, Manfalout city. M, 100 bp DNA marker; N, negative control (non-blood fed mosquitoes). Wolbachia detected at 438 bp.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control

    Multiplex PCR pattern showing association of Wolbachia with filarial parasites within their respective vectors in the studied locality. Lanes 1-3, El-Nikhila village; lane 4, El-Matiaa village; lane 5, Sahel Seleem district; lane 6, Dairout district. Wuchereria bancrofti at 490 bp, Wolbachia at 438 bp, Dirofilaria repens at 300 bp, and Dirofilaria immitis at 200 bp.
    Figure Legend Snippet: Multiplex PCR pattern showing association of Wolbachia with filarial parasites within their respective vectors in the studied locality. Lanes 1-3, El-Nikhila village; lane 4, El-Matiaa village; lane 5, Sahel Seleem district; lane 6, Dairout district. Wuchereria bancrofti at 490 bp, Wolbachia at 438 bp, Dirofilaria repens at 300 bp, and Dirofilaria immitis at 200 bp.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction

    17) Product Images from "Gait Abnormalities and Progressive Myelin Degeneration in a New Murine Model of Pelizaeus-Merzbacher Disease with Tandem Genomic Duplication"

    Article Title: Gait Abnormalities and Progressive Myelin Degeneration in a New Murine Model of Pelizaeus-Merzbacher Disease with Tandem Genomic Duplication

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.1336-13.2013

    PCR-based genotyping.
    Figure Legend Snippet: PCR-based genotyping.

    Techniques Used: Polymerase Chain Reaction

    18) Product Images from "Effects of Shield1 on the viral replication of varicella-zoster virus containing FKBP-tagged ORF4 and 48"

    Article Title: Effects of Shield1 on the viral replication of varicella-zoster virus containing FKBP-tagged ORF4 and 48

    Journal: Molecular Medicine Reports

    doi: 10.3892/mmr.2017.7986

    Verification of galK-tagged VZV ORF4 and ORF48. Lane M, 100 bp DNA ladder; lanes 1 and 2, verification of galK-tagged ORF4 from two clones of SW102-VZVORF4-galK-BAC; lanes 3 and 4, verification of galK-tagged ORF48 from two clones of SW102-VZVORF48-galK-BAC; lanes 5–8, verification of galK-tagged ORF4 and ORF48 from four clones of SW102-VZVORF4-galK-ORF48-galK-BAC; Neg, negative control. BAC, bacterial artificial chromosome; galK, galactokinase; ORF, open reading frame; PCR, polymerase chain reaction; VZV, varicella-zoster virus.
    Figure Legend Snippet: Verification of galK-tagged VZV ORF4 and ORF48. Lane M, 100 bp DNA ladder; lanes 1 and 2, verification of galK-tagged ORF4 from two clones of SW102-VZVORF4-galK-BAC; lanes 3 and 4, verification of galK-tagged ORF48 from two clones of SW102-VZVORF48-galK-BAC; lanes 5–8, verification of galK-tagged ORF4 and ORF48 from four clones of SW102-VZVORF4-galK-ORF48-galK-BAC; Neg, negative control. BAC, bacterial artificial chromosome; galK, galactokinase; ORF, open reading frame; PCR, polymerase chain reaction; VZV, varicella-zoster virus.

    Techniques Used: Clone Assay, BAC Assay, Negative Control, Polymerase Chain Reaction

    Verification of FKBP-tagged VZV ORF4 and ORF48. Lane M, 100 bp DNA ladder; WT, negative control using VZV WT DNA as a PCR template; lanes 1 and 2, detection of ORF48-FKBP from SW102-VZVORF48-FKBP-BAC clones; lanes 3 and 4, detection of ORF48-FKBP from SW102-VZVORF4-FKBP-ORF48-FKBP-BAC clones; lanes 5 and 6 detection of ORF4-FKBP from SW102-VZVORF4-FKBP-BAC clones; lanes 7 and 8, detection ORF4-FKBP from SW102-VZVORF4-FKBP-ORF48-FKBP-BAC clones. BAC, bacterial artificial chromosome; FKBP, FK506 binding protein; ORF, open reading frame; PCR, polymerase chain reaction; VZV, varicella-zoster virus; WT, wild type.
    Figure Legend Snippet: Verification of FKBP-tagged VZV ORF4 and ORF48. Lane M, 100 bp DNA ladder; WT, negative control using VZV WT DNA as a PCR template; lanes 1 and 2, detection of ORF48-FKBP from SW102-VZVORF48-FKBP-BAC clones; lanes 3 and 4, detection of ORF48-FKBP from SW102-VZVORF4-FKBP-ORF48-FKBP-BAC clones; lanes 5 and 6 detection of ORF4-FKBP from SW102-VZVORF4-FKBP-BAC clones; lanes 7 and 8, detection ORF4-FKBP from SW102-VZVORF4-FKBP-ORF48-FKBP-BAC clones. BAC, bacterial artificial chromosome; FKBP, FK506 binding protein; ORF, open reading frame; PCR, polymerase chain reaction; VZV, varicella-zoster virus; WT, wild type.

    Techniques Used: Negative Control, Polymerase Chain Reaction, BAC Assay, Clone Assay, Binding Assay

    PCR amplification of galK and FKBP. (A) Lane M, 100 bp DNA ladder; lane 1, PCR amplification of VZV ORF4 galK cassette; lane 2, PCR amplification of VZV ORF48 galK cassette; lane 3, negative control. (B) Lane M, 100 bp DNA ladder; lane 1, PCR amplification of VZVORF4 FKBP cassette; lane 2, PCR amplification of VZV ORF48 FKBP cassette; lane 3, negative control. FKBP, FK506 binding protein; galK, galactokinase; ORF, open reading frame; PCR, polymerase chain reaction; VZV, varicella-zoster virus.
    Figure Legend Snippet: PCR amplification of galK and FKBP. (A) Lane M, 100 bp DNA ladder; lane 1, PCR amplification of VZV ORF4 galK cassette; lane 2, PCR amplification of VZV ORF48 galK cassette; lane 3, negative control. (B) Lane M, 100 bp DNA ladder; lane 1, PCR amplification of VZVORF4 FKBP cassette; lane 2, PCR amplification of VZV ORF48 FKBP cassette; lane 3, negative control. FKBP, FK506 binding protein; galK, galactokinase; ORF, open reading frame; PCR, polymerase chain reaction; VZV, varicella-zoster virus.

    Techniques Used: Polymerase Chain Reaction, Amplification, Negative Control, Binding Assay

    19) Product Images from "An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR 1"

    Article Title: An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR 1

    Journal: Applications in Plant Sciences

    doi: 10.3732/apps.1300027

    (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.
    Figure Legend Snippet: (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Labeling, Multiplexing

    20) Product Images from "Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay"

    Article Title: Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029967

    Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.
    Figure Legend Snippet: Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.

    Techniques Used: Polymerase Chain Reaction, Amplification

    21) Product Images from "Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay"

    Article Title: Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029967

    Scatter plots for three SNPs with 3 discordant genotypes. Scatter plots in genotyping with 192-plex PCR and 96-plex PCR are depicted side-by-side. The genotypes of discordant samples are indicated in the scatter plots by arrows.
    Figure Legend Snippet: Scatter plots for three SNPs with 3 discordant genotypes. Scatter plots in genotyping with 192-plex PCR and 96-plex PCR are depicted side-by-side. The genotypes of discordant samples are indicated in the scatter plots by arrows.

    Techniques Used: Polymerase Chain Reaction

    Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.
    Figure Legend Snippet: Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.

    Techniques Used: Polymerase Chain Reaction, Amplification

    22) Product Images from "Chemically modified primers for improved multiplex PCR"

    Article Title: Chemically modified primers for improved multiplex PCR

    Journal: Analytical biochemistry

    doi: 10.1016/j.ab.2009.02.033

    Determining upper limit of targets for single modified OXP primers in multiplex PCR. The number of targets amplified was increased from three to nine targets sequentially with Platinum® Taq and modified OXP primers with 500 copies of Lambda genomic
    Figure Legend Snippet: Determining upper limit of targets for single modified OXP primers in multiplex PCR. The number of targets amplified was increased from three to nine targets sequentially with Platinum® Taq and modified OXP primers with 500 copies of Lambda genomic

    Techniques Used: Modification, Multiplex Assay, Polymerase Chain Reaction, Amplification

    23) Product Images from "Clinical Variability of Familial Tumoral Calcinosis Caused by Novel GALNT3 Mutations"

    Article Title: Clinical Variability of Familial Tumoral Calcinosis Caused by Novel GALNT3 Mutations

    Journal: American Journal of Medical Genetics. Part a

    doi: 10.1002/ajmg.a.33337

    Mutational analysis of the GALNT3 gene. Electropherograms of PCR products show wild-type sequences (top) and mutated sequences (bottom) in four patients. Arrows indicate nucleotides involved in the mutations.
    Figure Legend Snippet: Mutational analysis of the GALNT3 gene. Electropherograms of PCR products show wild-type sequences (top) and mutated sequences (bottom) in four patients. Arrows indicate nucleotides involved in the mutations.

    Techniques Used: Polymerase Chain Reaction

    24) Product Images from "Bead-Based Multiplex Genotyping of 58 Cutaneous Human Papillomavirus Types ▿Bead-Based Multiplex Genotyping of 58 Cutaneous Human Papillomavirus Types ▿ †"

    Article Title: Bead-Based Multiplex Genotyping of 58 Cutaneous Human Papillomavirus Types ▿Bead-Based Multiplex Genotyping of 58 Cutaneous Human Papillomavirus Types ▿ †

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.01173-11

    Detection of multiple infections. McPG was performed using a 10-fold dilution series of single HPV types and mixtures comprising 5, 10, 15, and 20 HPV types in 100 ng of HP DNA/μl. Net MFI values obtained after hybridization of the PCR products
    Figure Legend Snippet: Detection of multiple infections. McPG was performed using a 10-fold dilution series of single HPV types and mixtures comprising 5, 10, 15, and 20 HPV types in 100 ng of HP DNA/μl. Net MFI values obtained after hybridization of the PCR products

    Techniques Used: Hybridization, Polymerase Chain Reaction

    Analytical sensitivity of integrated β-globin PCR. McPG was performed using a 10-fold dilution series of HP DNA. PCR was performed on 10 individually prepared dilution series. The net MFI values obtained after hybridization of the PCR products
    Figure Legend Snippet: Analytical sensitivity of integrated β-globin PCR. McPG was performed using a 10-fold dilution series of HP DNA. PCR was performed on 10 individually prepared dilution series. The net MFI values obtained after hybridization of the PCR products

    Techniques Used: Polymerase Chain Reaction, Hybridization

    25) Product Images from "Dissecting Loss of Heterozygosity (LOH) in Neurofibromatosis Type 1-Associated Neurofibromas: Importance of Copy Neutral LOH"

    Article Title: Dissecting Loss of Heterozygosity (LOH) in Neurofibromatosis Type 1-Associated Neurofibromas: Importance of Copy Neutral LOH

    Journal: Human Mutation

    doi: 10.1002/humu.21387

    Deletion breakpoint analysis. A: Breakpoint analysis by Multiplex Microsatellite PCR (MMP) and by MLPA analysis. B: Deletion breakpoint mapping refinement by SNP-array. Solid black bar: deletion mapped by either MMP (A, B), by MLPA (A), or SNP-array (B); dashed line: uncertain region by either MMP (A, B) or SNP-array (B). Black circle: no deletion by either MMP (A, B), by MLPA (A) or SNP-array (B). DFS, Deletion fragment size. [Color figures can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
    Figure Legend Snippet: Deletion breakpoint analysis. A: Breakpoint analysis by Multiplex Microsatellite PCR (MMP) and by MLPA analysis. B: Deletion breakpoint mapping refinement by SNP-array. Solid black bar: deletion mapped by either MMP (A, B), by MLPA (A), or SNP-array (B); dashed line: uncertain region by either MMP (A, B) or SNP-array (B). Black circle: no deletion by either MMP (A, B), by MLPA (A) or SNP-array (B). DFS, Deletion fragment size. [Color figures can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Multiplex Ligation-dependent Probe Amplification

    Mitotic recombination crossover mapping. A: Crossover analysis by Multiplex Microsatellite PCR (MMP). B: Mapping refinement by SNP-array compared to MMP. Solid black bar: uniparental isodisomy (B); dashed line: uncertain region; black circle: no uniparental isodisomy. HR, Homologous recombination. [Color figures can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
    Figure Legend Snippet: Mitotic recombination crossover mapping. A: Crossover analysis by Multiplex Microsatellite PCR (MMP). B: Mapping refinement by SNP-array compared to MMP. Solid black bar: uniparental isodisomy (B); dashed line: uncertain region; black circle: no uniparental isodisomy. HR, Homologous recombination. [Color figures can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Homologous Recombination

    26) Product Images from "Exonic Splicing Mutations Are More Prevalent than Currently Estimated and Can Be Predicted by Using In Silico Tools"

    Article Title: Exonic Splicing Mutations Are More Prevalent than Currently Estimated and Can Be Predicted by Using In Silico Tools

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1005756

    Detection of aberrant splicing in the blood cells of a patient carrying MLH1 c.793C > T variant. (A) Comparative RT-PCR analysis of fresh blood RNA samples obtained from 3 healthy control individuals (C1, C2 and C3) and from a patient carrying the heterozygous variant MLH1 c.793C > T (P 793CT.1 ). RT-PCR reactions were performed with primers mapping to MLH1 exon 8 (forward primer) and exon 12 (reverse primer), as described under Materials and Methods. The panel on the left shows the RT-PCR products separated on a 2% agarose gel, and is representative of 3 independent experiments. RT-PCR product identifiers are indicated on the left of the gel. The sequence on the right refers to the FL product obtained from patient P 793CT.1 , with a vertical line indicating the junction between exons 9 and 10. FL, full-length; Δ, exon skipping. (B) Allele-specific expression of MLH1 in the blood cells of patient P 793CT.1 carrying the heterozygous variant MLH1 c.793C > T. PCR, RT-PCR and primer extension reactions were performed as described under Materials and Methods, and are schematically represented above the graphs. The discriminating nucleotides C and T are indicated. Boxes represent exons, lines indicate intronic sequences, and arrows symbolize reaction primers. The discriminating fluorophore-labeled ddG and ddA terminators, incorporated into the noncoding strand at the c.793 position, are represented by stars. Results from complementary DNA (cDNA) analysis and genomic DNA (gDNA) are shown on the left-hand and on the right-hand graphs, respectively. Results (peak areas) obtained with cDNA were normalized to those obtained with gDNA and are expressed, in the left-hand graph, as relative level (in percentage) of FL transcripts produced by each MLH1 allele. (C) Relative contribution of each allele to the expression of full-length MLH1 transcripts in the blood cells of patient P 793CT.1 carrying the heterozygous variant MLH1 c.793C > T. The graph displays the expression level of the mutant allele ( MLH1 c.793C > T) relative to wild-type (WT). Results are shown as the average of 3 independent experiments performed as described in (B). Error bars indicate standard deviation values.
    Figure Legend Snippet: Detection of aberrant splicing in the blood cells of a patient carrying MLH1 c.793C > T variant. (A) Comparative RT-PCR analysis of fresh blood RNA samples obtained from 3 healthy control individuals (C1, C2 and C3) and from a patient carrying the heterozygous variant MLH1 c.793C > T (P 793CT.1 ). RT-PCR reactions were performed with primers mapping to MLH1 exon 8 (forward primer) and exon 12 (reverse primer), as described under Materials and Methods. The panel on the left shows the RT-PCR products separated on a 2% agarose gel, and is representative of 3 independent experiments. RT-PCR product identifiers are indicated on the left of the gel. The sequence on the right refers to the FL product obtained from patient P 793CT.1 , with a vertical line indicating the junction between exons 9 and 10. FL, full-length; Δ, exon skipping. (B) Allele-specific expression of MLH1 in the blood cells of patient P 793CT.1 carrying the heterozygous variant MLH1 c.793C > T. PCR, RT-PCR and primer extension reactions were performed as described under Materials and Methods, and are schematically represented above the graphs. The discriminating nucleotides C and T are indicated. Boxes represent exons, lines indicate intronic sequences, and arrows symbolize reaction primers. The discriminating fluorophore-labeled ddG and ddA terminators, incorporated into the noncoding strand at the c.793 position, are represented by stars. Results from complementary DNA (cDNA) analysis and genomic DNA (gDNA) are shown on the left-hand and on the right-hand graphs, respectively. Results (peak areas) obtained with cDNA were normalized to those obtained with gDNA and are expressed, in the left-hand graph, as relative level (in percentage) of FL transcripts produced by each MLH1 allele. (C) Relative contribution of each allele to the expression of full-length MLH1 transcripts in the blood cells of patient P 793CT.1 carrying the heterozygous variant MLH1 c.793C > T. The graph displays the expression level of the mutant allele ( MLH1 c.793C > T) relative to wild-type (WT). Results are shown as the average of 3 independent experiments performed as described in (B). Error bars indicate standard deviation values.

    Techniques Used: Variant Assay, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Sequencing, Expressing, Polymerase Chain Reaction, Labeling, Produced, Mutagenesis, Standard Deviation

    27) Product Images from "Differential-display reverse transcription-PCR (DDRT-PCR): a new technology for molecular detection and studying one of the antagonistic factors of Bacillus endophyticus strain SA against Staphylococcus aureus (MRSA)"

    Article Title: Differential-display reverse transcription-PCR (DDRT-PCR): a new technology for molecular detection and studying one of the antagonistic factors of Bacillus endophyticus strain SA against Staphylococcus aureus (MRSA)

    Journal: 3 Biotech

    doi: 10.1007/s13205-016-0439-1

    PCR of the 16S rRNA amplified gene, M 1 kb DNA ladder; E amplified gene product of the endophytic isolate
    Figure Legend Snippet: PCR of the 16S rRNA amplified gene, M 1 kb DNA ladder; E amplified gene product of the endophytic isolate

    Techniques Used: Polymerase Chain Reaction, Amplification

    28) Product Images from "Gait Abnormalities and Progressive Myelin Degeneration in a New Murine Model of Pelizaeus-Merzbacher Disease with Tandem Genomic Duplication"

    Article Title: Gait Abnormalities and Progressive Myelin Degeneration in a New Murine Model of Pelizaeus-Merzbacher Disease with Tandem Genomic Duplication

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.1336-13.2013

    Developmental time course of Mbp mRNA and MBP protein levels in Plp1 dup compared with wild-type mouse brain. A , Levels of Mbp mRNA measured by qRT-PCR of total RNA prepared from Plp1 dup and wild-type brain and expressed as RQ with the average of P7 wild-type
    Figure Legend Snippet: Developmental time course of Mbp mRNA and MBP protein levels in Plp1 dup compared with wild-type mouse brain. A , Levels of Mbp mRNA measured by qRT-PCR of total RNA prepared from Plp1 dup and wild-type brain and expressed as RQ with the average of P7 wild-type

    Techniques Used: Quantitative RT-PCR

    Developmental time course of Cnp mRNA and CNP protein levels in Plp1 dup compared with wild-type mouse brain. A , Levels of Cnp mRNA measured by qRT-PCR of total RNA prepared from Plp1 dup and wild-type brain and expressed as RQ with the average of P7 wild-type
    Figure Legend Snippet: Developmental time course of Cnp mRNA and CNP protein levels in Plp1 dup compared with wild-type mouse brain. A , Levels of Cnp mRNA measured by qRT-PCR of total RNA prepared from Plp1 dup and wild-type brain and expressed as RQ with the average of P7 wild-type

    Techniques Used: Quantitative RT-PCR

    Developmental time course of Plp1 mRNA and PLP protein levels in Plp1 dup compared with wild-type mouse brain. A , Levels of Plp1 mRNA measured by qRT-PCR of total RNA prepared from Plp1 dup and wild-type brain and expressed as RQ with the average of P7
    Figure Legend Snippet: Developmental time course of Plp1 mRNA and PLP protein levels in Plp1 dup compared with wild-type mouse brain. A , Levels of Plp1 mRNA measured by qRT-PCR of total RNA prepared from Plp1 dup and wild-type brain and expressed as RQ with the average of P7

    Techniques Used: Plasmid Purification, Quantitative RT-PCR

    29) Product Images from "Multilevel genomics of colorectal cancers with microsatellite instability—clinical impact of JAK1 mutations and consensus molecular subtype 1"

    Article Title: Multilevel genomics of colorectal cancers with microsatellite instability—clinical impact of JAK1 mutations and consensus molecular subtype 1

    Journal: Genome Medicine

    doi: 10.1186/s13073-017-0434-0

    Patient samples and data analyses. a A total of 333 MSI+ CRCs were analyzed, including 192 in-house tumor samples and publicly available data from 141 patients; 248 were analyzed for gene mutations and 213 for gene expression. Among the 68 samples in Norwegian series I analyzed for JAK1 mutations by PCR-based analysis, 33 were exome sequenced, 27 were analyzed for DNA copy number aberrations, and 63 were analyzed for gene expression. b Molecular result parameters are shown in red , clinical endpoints in green , and the data types used for analysis in grey . Significant associations are indicated by red arrows and the red cross indicates no association
    Figure Legend Snippet: Patient samples and data analyses. a A total of 333 MSI+ CRCs were analyzed, including 192 in-house tumor samples and publicly available data from 141 patients; 248 were analyzed for gene mutations and 213 for gene expression. Among the 68 samples in Norwegian series I analyzed for JAK1 mutations by PCR-based analysis, 33 were exome sequenced, 27 were analyzed for DNA copy number aberrations, and 63 were analyzed for gene expression. b Molecular result parameters are shown in red , clinical endpoints in green , and the data types used for analysis in grey . Significant associations are indicated by red arrows and the red cross indicates no association

    Techniques Used: Expressing, Polymerase Chain Reaction

    30) Product Images from "Estimating and mitigating amplification bias in qualitative and quantitative arthropod metabarcoding"

    Article Title: Estimating and mitigating amplification bias in qualitative and quantitative arthropod metabarcoding

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-17333-x

    ( A ) Coefficient of determination (R 2 ) of the linear association between input DNA and recovered read proportions for 43 arthropod taxa. The boxplots show R 2 for 1. nuclear and 2. mitochondrial markers, as well as 3. mitochondrial COI amplified with varying first round PCR cycle numbers and increased amount of DNA template during PCR. ( B ) Fold change between input DNA and recovered read proportions for the same taxa and experimental conditions. Red squares indicate the median fold change for the same taxa and loci based on a gDNA library prepared without locus specific amplification. Red diamonds indicate the location of upper and lower whiskers for the boxplots of the same gDNA samples.
    Figure Legend Snippet: ( A ) Coefficient of determination (R 2 ) of the linear association between input DNA and recovered read proportions for 43 arthropod taxa. The boxplots show R 2 for 1. nuclear and 2. mitochondrial markers, as well as 3. mitochondrial COI amplified with varying first round PCR cycle numbers and increased amount of DNA template during PCR. ( B ) Fold change between input DNA and recovered read proportions for the same taxa and experimental conditions. Red squares indicate the median fold change for the same taxa and loci based on a gDNA library prepared without locus specific amplification. Red diamonds indicate the location of upper and lower whiskers for the boxplots of the same gDNA samples.

    Techniques Used: Amplification, Polymerase Chain Reaction

    ( A ) Alpha diversity (Simpson Index) of arthropod mock communities. The upper black bar shows the median alpha diversity of the actual communities based on morphospecies assignments. The boxplots show alpha diversity for the same communities based on DNA sequencing for 1. nuclear and 2. mitochondrial markers, and 3. for mitochondrial COI at varying PCR cycle numbers and increased DNA template amount during PCR. Red squares indicate alpha diversity for the same loci based on a genomic DNA sample prepared without locus specific amplification. ( B ) Beta diversity (Bray Curtis dissimilarity) between actual morphospecies based mock communities and sequence based analyses. The boxplots and red present the same experimental conditions as described above. Red squares indicate beta diversity for the same loci and based on a genomic DNA sample prepared without locus specific amplification.
    Figure Legend Snippet: ( A ) Alpha diversity (Simpson Index) of arthropod mock communities. The upper black bar shows the median alpha diversity of the actual communities based on morphospecies assignments. The boxplots show alpha diversity for the same communities based on DNA sequencing for 1. nuclear and 2. mitochondrial markers, and 3. for mitochondrial COI at varying PCR cycle numbers and increased DNA template amount during PCR. Red squares indicate alpha diversity for the same loci based on a genomic DNA sample prepared without locus specific amplification. ( B ) Beta diversity (Bray Curtis dissimilarity) between actual morphospecies based mock communities and sequence based analyses. The boxplots and red present the same experimental conditions as described above. Red squares indicate beta diversity for the same loci and based on a genomic DNA sample prepared without locus specific amplification.

    Techniques Used: DNA Sequencing, Polymerase Chain Reaction, Amplification, Sequencing

    31) Product Images from "Accurate diagnosis of mismatch repair deficiency in colorectal cancer using high-quality DNA samples from cultured stem cells"

    Article Title: Accurate diagnosis of mismatch repair deficiency in colorectal cancer using high-quality DNA samples from cultured stem cells

    Journal: Oncotarget

    doi: 10.18632/oncotarget.26495

    Electropherograms of on-chip MSI analysis using spheroid-derived DNA samples ( A ) HC51T. Representative electropherograms of an MSS case for five microsatellite markers of the Bethesda panel. Red lines show the PCR products amplified from the cancer cell spheroid DNA samples, whereas blue lines indicate those from the normal epithelial stem cell DNA of the same patient. HC26T and HC4T. Representative electropherograms of MSI-H cases. The peak patterns between tumor-initiating cells (red) and the normal epithelial stem cells (blue) are separated for all loci tested. The ordinate shows fluorescence intensity in arbitrary unit (FU). ( B ) On-chip electropherogram of a representative case in which FFPE tumor-derived DNA sample (blue) showed much lower peaks with poorer resolution than spheroid-derived DNA (red) of the same patient normal mucosal stem cells (HC6N). The ordinate shows fluorescence intensity in arbitrary unit (FU). ( C ) Maximum electrophoretic peak-heights of PCR-amplified MSI markers (shown at bottom) compared between spheroid- and FFPE tumor-derived DNA samples. Note that spheroid-derived (Sph) DNA gave taller peaks than FFPE tumor-derived (FFPE) DNA for all five Bethesda panel markers. **** P
    Figure Legend Snippet: Electropherograms of on-chip MSI analysis using spheroid-derived DNA samples ( A ) HC51T. Representative electropherograms of an MSS case for five microsatellite markers of the Bethesda panel. Red lines show the PCR products amplified from the cancer cell spheroid DNA samples, whereas blue lines indicate those from the normal epithelial stem cell DNA of the same patient. HC26T and HC4T. Representative electropherograms of MSI-H cases. The peak patterns between tumor-initiating cells (red) and the normal epithelial stem cells (blue) are separated for all loci tested. The ordinate shows fluorescence intensity in arbitrary unit (FU). ( B ) On-chip electropherogram of a representative case in which FFPE tumor-derived DNA sample (blue) showed much lower peaks with poorer resolution than spheroid-derived DNA (red) of the same patient normal mucosal stem cells (HC6N). The ordinate shows fluorescence intensity in arbitrary unit (FU). ( C ) Maximum electrophoretic peak-heights of PCR-amplified MSI markers (shown at bottom) compared between spheroid- and FFPE tumor-derived DNA samples. Note that spheroid-derived (Sph) DNA gave taller peaks than FFPE tumor-derived (FFPE) DNA for all five Bethesda panel markers. **** P

    Techniques Used: Chromatin Immunoprecipitation, Derivative Assay, Polymerase Chain Reaction, Amplification, Fluorescence, Formalin-fixed Paraffin-Embedded

    32) Product Images from "Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay"

    Article Title: Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029967

    Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.
    Figure Legend Snippet: Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.

    Techniques Used: Polymerase Chain Reaction, Amplification

    33) Product Images from "Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay"

    Article Title: Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029967

    Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.
    Figure Legend Snippet: Electropherogram of singleplex PCR products using Kapa 2GFast HotStart DNA polymerase. Singleplex PCR was performed with varied extension periods (15 s, 30 s, 60 s and 120 s) and with varied Mg 2+ concentrations (3.0 mM and 4.5 mM) using three pairs of locus-specific primers. The designed amplicon size is depicted below each lane.

    Techniques Used: Polymerase Chain Reaction, Amplification

    34) Product Images from "An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR 1"

    Article Title: An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR 1

    Journal: Applications in Plant Sciences

    doi: 10.3732/apps.1300027

    (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.
    Figure Legend Snippet: (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Labeling, Multiplexing

    35) Product Images from "A Mouse Geneticist’s Practical Guide to CRISPR Applications"

    Article Title: A Mouse Geneticist’s Practical Guide to CRISPR Applications

    Journal: Genetics

    doi: 10.1534/genetics.114.169771

    Sequencing-based methods to identify CRISPR-edited alleles in founder mice. (A) Sanger sequencing of PCR products around gRNA binding site. PCR amplification from mouse tail biopsy DNA will generate a mixture of two or more (mosaic) amplicons representing allelic variants in the mouse. This can cause overlapping peaks on the chromatogram (red arrow) and difficulty in identifying the mutation(s). (B) Sequencing of plasmid-cloned PCR products. Each clone contains one amplicon/allelic variant present in a mouse. This requires sequencing at least 10 single colonies per targeting event per mouse ( e.g. , one gene × 20 founder mice × 10 colonies = 200 sequences). In the case of multiplexed editing, proportionately more clones must be sequenced. (C) Next-Gen-based multiplexed sequencing. This method also allows testing for off-target (OT) events and the presence of mosaicism. Target and OT PCR products from one founder mouse are labeled with unique barcode. All PCR products from up to 96 mice (one mouse = one barcode) are pooled together and sequenced. *, mosaic animal.
    Figure Legend Snippet: Sequencing-based methods to identify CRISPR-edited alleles in founder mice. (A) Sanger sequencing of PCR products around gRNA binding site. PCR amplification from mouse tail biopsy DNA will generate a mixture of two or more (mosaic) amplicons representing allelic variants in the mouse. This can cause overlapping peaks on the chromatogram (red arrow) and difficulty in identifying the mutation(s). (B) Sequencing of plasmid-cloned PCR products. Each clone contains one amplicon/allelic variant present in a mouse. This requires sequencing at least 10 single colonies per targeting event per mouse ( e.g. , one gene × 20 founder mice × 10 colonies = 200 sequences). In the case of multiplexed editing, proportionately more clones must be sequenced. (C) Next-Gen-based multiplexed sequencing. This method also allows testing for off-target (OT) events and the presence of mosaicism. Target and OT PCR products from one founder mouse are labeled with unique barcode. All PCR products from up to 96 mice (one mouse = one barcode) are pooled together and sequenced. *, mosaic animal.

    Techniques Used: Sequencing, CRISPR, Mouse Assay, Polymerase Chain Reaction, Binding Assay, Amplification, Mutagenesis, Plasmid Preparation, Clone Assay, Variant Assay, Labeling

    36) Product Images from "Computational Evaluation of B-Cell Clone Sizes in Bulk Populations"

    Article Title: Computational Evaluation of B-Cell Clone Sizes in Bulk Populations

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2018.01472

    Schematic of experiments. In experiment 1, genomic DNA is extracted from spleen tissue of an organ donor. Immunoglobulin heavy chain gene rearrangements were amplified and sequenced from genomic DNA in 19 biological replicates. In experiment 2, splenocytes from eight different organ donors were cryopreserved at the time of organ recovery. All samples were thawed on the same day and analyzed for the B cell fraction by flow cytometry. Genomic DNA (normalized for the B cell fraction) was separately amplified and sequenced (two biological replicates per subject).
    Figure Legend Snippet: Schematic of experiments. In experiment 1, genomic DNA is extracted from spleen tissue of an organ donor. Immunoglobulin heavy chain gene rearrangements were amplified and sequenced from genomic DNA in 19 biological replicates. In experiment 2, splenocytes from eight different organ donors were cryopreserved at the time of organ recovery. All samples were thawed on the same day and analyzed for the B cell fraction by flow cytometry. Genomic DNA (normalized for the B cell fraction) was separately amplified and sequenced (two biological replicates per subject).

    Techniques Used: Amplification, Flow Cytometry, Cytometry

    37) Product Images from "A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)"

    Article Title: A Transcript Profiling Approach Reveals an Abscisic Acid-Specific Glycosyltransferase (UGT73C14) Induced in Developing Fiber of Ligon lintless-2 Mutant of Cotton (Gossypium hirsutum L.)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075268

    Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.
    Figure Legend Snippet: Copy Number Variation Assay of UGT73C14 using the single copy GhMYB25 as a reference gene. Genomic DNA was isolated from frozen leaf tissues using Qiagen DNeasy DNA extraction kit, and subjected to a 5 cycle Specific Template Amplification (STA) reaction. The STA reaction product was then subject to Taqman digital PCR following the manufacturer’s recommendations and microfluidic chips provided by Fluidigm. A ratio of UGT73C14 positive wells to GhMYB25 positive wells determined the relative copy number. To determine the copy number (y-axis values), for tetraploid lines (G. hirsutum ), the UGT73C14/GhMYB25 ratio was multiplied by four, and for diploid lines (G. raimondii, G . herbaceum and G . arboreum ), the UGT73C14/GhMYB25 ratio was muliplied by two. Error Bars represents the 95% Confidence Interval.

    Techniques Used: Isolation, DNA Extraction, Amplification, Digital PCR

    38) Product Images from "Promises and pitfalls of a Pannexin1 transgenic mouse line"

    Article Title: Promises and pitfalls of a Pannexin1 transgenic mouse line

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2013.00061

    Panx1 KO-first mice express Panx1 mRNA. (A) Tail PCR products obtained using specific primers (primer sets F1a—R1a and F1b—R1b depicted in Figure 1 ) designed to detect wild-type (579 bp amplicon; lane 7), homozygous Panx1 KO-first (381 bp amplicon; lanes 3 and 6) and the heterozygous (579 and 381 bp amplicons; lanes 1, 2, 4, and 5) alleles. Data are from a litter derived from heterozygous breeding. (B) Top : RT-PCR products obtained from tissues of wild-type (WT) and Panx1 KO-first (KO) using primers (primer set F2—R2 depicted in Figure 1 ) designed to detect wild-type Panx1 mRNA (1278 bp) coding region. T. ganglia, trigeminal ganglia; sp, spleen; br, brain; nt, no template. Bottom : PCR products obtained from RT-PCR amplicons extracted from gel on top part using primers spanning exons 4 and 5 of Panx1 (primer set F3—R3 depicted in Figure 1 ). Wild-type (lane 1) and Panx1 KO-first (lane 2) trigeminal ganglia, Panx1 cDNA plasmid (lane 3), and no template (lane 4). (C) Histograms of the mean ± s.e.m. values of Panx1 mRNA expression levels detected from tail tips of wild-type (WT) and Panx1 KO-first (KO) mice by qRT-PCR using primer set F3—R3. Statistical significance obtained by unpaired T -test, N = 3 mice per group.
    Figure Legend Snippet: Panx1 KO-first mice express Panx1 mRNA. (A) Tail PCR products obtained using specific primers (primer sets F1a—R1a and F1b—R1b depicted in Figure 1 ) designed to detect wild-type (579 bp amplicon; lane 7), homozygous Panx1 KO-first (381 bp amplicon; lanes 3 and 6) and the heterozygous (579 and 381 bp amplicons; lanes 1, 2, 4, and 5) alleles. Data are from a litter derived from heterozygous breeding. (B) Top : RT-PCR products obtained from tissues of wild-type (WT) and Panx1 KO-first (KO) using primers (primer set F2—R2 depicted in Figure 1 ) designed to detect wild-type Panx1 mRNA (1278 bp) coding region. T. ganglia, trigeminal ganglia; sp, spleen; br, brain; nt, no template. Bottom : PCR products obtained from RT-PCR amplicons extracted from gel on top part using primers spanning exons 4 and 5 of Panx1 (primer set F3—R3 depicted in Figure 1 ). Wild-type (lane 1) and Panx1 KO-first (lane 2) trigeminal ganglia, Panx1 cDNA plasmid (lane 3), and no template (lane 4). (C) Histograms of the mean ± s.e.m. values of Panx1 mRNA expression levels detected from tail tips of wild-type (WT) and Panx1 KO-first (KO) mice by qRT-PCR using primer set F3—R3. Statistical significance obtained by unpaired T -test, N = 3 mice per group.

    Techniques Used: Mouse Assay, Polymerase Chain Reaction, Amplification, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Expressing, Quantitative RT-PCR

    39) Product Images from "Paired analysis of TCR? and TCR? chains at the single-cell level in mice"

    Article Title: Paired analysis of TCR? and TCR? chains at the single-cell level in mice

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI44752

    Unbiased single-cell amplification of TCR CDR3α and CDR3β. ( A ) Schematic diagram of the multiplex PCR method used to simultaneously amplify and sequence the TCR CDR3α and CDR3β regions. Following single-cell sorting of K b PB1 703 + CD8 + T cells into a PCR plate, the first round of PCR used a primer mixture of 23 TRAV and 19 TRBV forward and single TRAC and TRBC reverse primers. Subsequently, a nested PCR was performed for α and β in a separate plate using a corresponding internal primer mix (23 TRAV forward, single TRAC reverse, and 19 TRBV forward, single TRBC reverse, respectively). ( B ) Schematic representation of the TCR CDR3 region, showing the relative positions of the oligonucleotide primers. An agarose gel electrophoresis image of TCR segments containing CDR3α and CDR3β amplified from single K b PB1 703 + CD8 + T cells is also shown. L, 100-bp ladder lane. The α and β products were loaded alternately in each twin-lane (separated by vertical lines). Negative control PCR reactions (for contamination) without any cDNA are shown in the boxed region. ( C ) TRBV usage in the primary K b PB1 703 + CD8 + T cell response determined by multiplex RT-PCR and sequencing ( n = 9 mice). ( D ) Correlation of the data in C to data acquired by costaining tetramer-specific K b PB1 703 + CD8 + T cells with a panel of anti-TRBV antibodies.
    Figure Legend Snippet: Unbiased single-cell amplification of TCR CDR3α and CDR3β. ( A ) Schematic diagram of the multiplex PCR method used to simultaneously amplify and sequence the TCR CDR3α and CDR3β regions. Following single-cell sorting of K b PB1 703 + CD8 + T cells into a PCR plate, the first round of PCR used a primer mixture of 23 TRAV and 19 TRBV forward and single TRAC and TRBC reverse primers. Subsequently, a nested PCR was performed for α and β in a separate plate using a corresponding internal primer mix (23 TRAV forward, single TRAC reverse, and 19 TRBV forward, single TRBC reverse, respectively). ( B ) Schematic representation of the TCR CDR3 region, showing the relative positions of the oligonucleotide primers. An agarose gel electrophoresis image of TCR segments containing CDR3α and CDR3β amplified from single K b PB1 703 + CD8 + T cells is also shown. L, 100-bp ladder lane. The α and β products were loaded alternately in each twin-lane (separated by vertical lines). Negative control PCR reactions (for contamination) without any cDNA are shown in the boxed region. ( C ) TRBV usage in the primary K b PB1 703 + CD8 + T cell response determined by multiplex RT-PCR and sequencing ( n = 9 mice). ( D ) Correlation of the data in C to data acquired by costaining tetramer-specific K b PB1 703 + CD8 + T cells with a panel of anti-TRBV antibodies.

    Techniques Used: Amplification, Multiplex Assay, Polymerase Chain Reaction, Sequencing, FACS, Nested PCR, Agarose Gel Electrophoresis, Negative Control, Reverse Transcription Polymerase Chain Reaction, Mouse Assay

    40) Product Images from "Chemically modified primers for improved multiplex PCR"

    Article Title: Chemically modified primers for improved multiplex PCR

    Journal: Analytical biochemistry

    doi: 10.1016/j.ab.2009.02.033

    Triplex Real-time PCR experiments using TaqMan® probe detection of 50 to 50,000 copies of Lambda genomic template DNA. Standard curve for the A. L533, B. L600, and C. L962 targets from a triplex reaction comparing the performance of unmodified,
    Figure Legend Snippet: Triplex Real-time PCR experiments using TaqMan® probe detection of 50 to 50,000 copies of Lambda genomic template DNA. Standard curve for the A. L533, B. L600, and C. L962 targets from a triplex reaction comparing the performance of unmodified,

    Techniques Used: Real-time Polymerase Chain Reaction

    Single modified OXP primers in comparison and combination with other “Hot Start” technologies. A. Triplex PCR reaction at 500 copies template DNA with single modified OXP primers and other modified DNA polymerases. The modified DNA polymerases
    Figure Legend Snippet: Single modified OXP primers in comparison and combination with other “Hot Start” technologies. A. Triplex PCR reaction at 500 copies template DNA with single modified OXP primers and other modified DNA polymerases. The modified DNA polymerases

    Techniques Used: Modification, Polymerase Chain Reaction

    Comparison of the PCR performance of unmodified, single modified and double modified OXP primers in the amplification of three individual targets separately and collectively from 500 copies of Lambda genomic DNA. A. Agarose gel image of individual amplifications
    Figure Legend Snippet: Comparison of the PCR performance of unmodified, single modified and double modified OXP primers in the amplification of three individual targets separately and collectively from 500 copies of Lambda genomic DNA. A. Agarose gel image of individual amplifications

    Techniques Used: Polymerase Chain Reaction, Modification, Amplification, Agarose Gel Electrophoresis

    41) Product Images from "The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota"

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189188

    Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.
    Figure Legend Snippet: Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.
    Figure Legend Snippet: Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    42) Product Images from "Comparative analyses of the Conserved Oligomeric Golgi (COG) complex in vertebrates"

    Article Title: Comparative analyses of the Conserved Oligomeric Golgi (COG) complex in vertebrates

    Journal: BMC Evolutionary Biology

    doi: 10.1186/1471-2148-10-212

    RT-PCR analyses of the eight COG genes expression in 20 human tissues . GAPDH was used as an internal control for the cDNA.
    Figure Legend Snippet: RT-PCR analyses of the eight COG genes expression in 20 human tissues . GAPDH was used as an internal control for the cDNA.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing

    43) Product Images from "Molecular prey identification in Central European piscivores"

    Article Title: Molecular prey identification in Central European piscivores

    Journal: Molecular Ecology Resources

    doi: 10.1111/1755-0998.12436

    The two‐step multiplex PCR system comprising six assays (FishTax, SalForm, PercMorph, CypForm 1–3) to identify fish DNA in dietary samples, depicting the assays and the identity and number of the target taxa. Coloured areas indicate which target groups from the FishTax assay are subjected to further identification.
    Figure Legend Snippet: The two‐step multiplex PCR system comprising six assays (FishTax, SalForm, PercMorph, CypForm 1–3) to identify fish DNA in dietary samples, depicting the assays and the identity and number of the target taxa. Coloured areas indicate which target groups from the FishTax assay are subjected to further identification.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Fluorescence In Situ Hybridization

    qiaxcel gel view of amplicons generated by the diagnostic multiplex PCR assays. The leftmost lane shows a mixture of all targeted taxa per reaction with equal target DNA concentrations and the amplicon lengths in base pairs. The single bands displayed in the other lanes were generated with ~150 double strands of target template DNA in the presence of ~300 ng nontarget DNA ( Phalacrocorax carbo sinensis ). FishTax: 1: Acipenser ruthenus , 2: Siluriformes, 3: Anguilla anguilla , 4: Salmoniformes, 5: Lota lota , 6: Esox lucius , 7: Cobitidae/Nemacheilidae/Cyprinidae, 8: Gobiidae/Gasterosteidae/Cottidae/Centrarchidae/Percidae, 9: Petromyzontidae. SalForm: 10: Oncorhynchus mykiss , 11: Salvelinus spp., 12: Thymallus thymallus , 13: Hucho hucho , 14: Salmo salar , 15: Salmo trutta / labrax , 16: Coregonus spp. PercMorph: 17: Lepomis gibbosus , 18: Cottus gobio , 19: Gasterosteus spp./ Pungitius pungitius , 20: Sander lucioperca , 21: Perca fluviatilis , 22: Gymnocephalus spp. CypForm 1: 23: Rutilus rutilus , 24: Phoxinus phoxinus , 25: Abramis brama , 26: Alburnus mento , 27: Ctenopharyngodon idella , 28: Rutilus meidingeri . CypForm 2: 29: Barbus barbus , 30: Rutilus virgo , 31: Squalius cephalus , 32: Leuciscus leuciscus / idus , 33: Scardinius eryhthrophthalmus , 34: Carassius spp. CypForm 3: 35: Tinca tinca , 36: Leuciscus aspius , 37: Chondrostoma nasus , 38: Blicca bjoerkna , 39: Vimba vimba , 40: Cyprinus carpio , 41: Alburnoides bipunctatus , 42: Telestes souffia , 43: Alburnus alburnus .
    Figure Legend Snippet: qiaxcel gel view of amplicons generated by the diagnostic multiplex PCR assays. The leftmost lane shows a mixture of all targeted taxa per reaction with equal target DNA concentrations and the amplicon lengths in base pairs. The single bands displayed in the other lanes were generated with ~150 double strands of target template DNA in the presence of ~300 ng nontarget DNA ( Phalacrocorax carbo sinensis ). FishTax: 1: Acipenser ruthenus , 2: Siluriformes, 3: Anguilla anguilla , 4: Salmoniformes, 5: Lota lota , 6: Esox lucius , 7: Cobitidae/Nemacheilidae/Cyprinidae, 8: Gobiidae/Gasterosteidae/Cottidae/Centrarchidae/Percidae, 9: Petromyzontidae. SalForm: 10: Oncorhynchus mykiss , 11: Salvelinus spp., 12: Thymallus thymallus , 13: Hucho hucho , 14: Salmo salar , 15: Salmo trutta / labrax , 16: Coregonus spp. PercMorph: 17: Lepomis gibbosus , 18: Cottus gobio , 19: Gasterosteus spp./ Pungitius pungitius , 20: Sander lucioperca , 21: Perca fluviatilis , 22: Gymnocephalus spp. CypForm 1: 23: Rutilus rutilus , 24: Phoxinus phoxinus , 25: Abramis brama , 26: Alburnus mento , 27: Ctenopharyngodon idella , 28: Rutilus meidingeri . CypForm 2: 29: Barbus barbus , 30: Rutilus virgo , 31: Squalius cephalus , 32: Leuciscus leuciscus / idus , 33: Scardinius eryhthrophthalmus , 34: Carassius spp. CypForm 3: 35: Tinca tinca , 36: Leuciscus aspius , 37: Chondrostoma nasus , 38: Blicca bjoerkna , 39: Vimba vimba , 40: Cyprinus carpio , 41: Alburnoides bipunctatus , 42: Telestes souffia , 43: Alburnus alburnus .

    Techniques Used: Generated, Diagnostic Assay, Multiplex Assay, Polymerase Chain Reaction, Amplification

    Fish DNA detected in field‐collected faeces (Common Kingfisher, Great Cormorant) and pellets (Great Cormorant) via the multiplex PCR system. Pie charts display the percentage of positive (light grey) and negative (dark grey) samples with amplifiable fish DNA , whilst bar charts show detection rates (%) per target taxon within the FishTax and the follow‐up assays left and right of the dotted line, respectively. Note that species‐specific bars do not add up to the detection rate at family level as one sample can test positive for more than one species.
    Figure Legend Snippet: Fish DNA detected in field‐collected faeces (Common Kingfisher, Great Cormorant) and pellets (Great Cormorant) via the multiplex PCR system. Pie charts display the percentage of positive (light grey) and negative (dark grey) samples with amplifiable fish DNA , whilst bar charts show detection rates (%) per target taxon within the FishTax and the follow‐up assays left and right of the dotted line, respectively. Note that species‐specific bars do not add up to the detection rate at family level as one sample can test positive for more than one species.

    Techniques Used: Fluorescence In Situ Hybridization, Multiplex Assay, Polymerase Chain Reaction

    44) Product Images from "Analysis of the Prevalence of HTLV-1 Proviral DNA in Cervical Smears and Carcinomas from HIV Positive and Negative Kenyan Women"

    Article Title: Analysis of the Prevalence of HTLV-1 Proviral DNA in Cervical Smears and Carcinomas from HIV Positive and Negative Kenyan Women

    Journal: Viruses

    doi: 10.3390/v8090245

    Sensitivity of human T-cell lymphotropic virus type 1 (HTLV-1) Tax PCR detection. End-point PCR method able to specifically detect a single HTLV-1 Tax DNA amplimer from 0.1 fg of input genomic DNA (DNA from the human JPX9 cell line was used as a positive control for Tax). GAPDH: glyceraldehyde 3-phosphate dehydrogenase.
    Figure Legend Snippet: Sensitivity of human T-cell lymphotropic virus type 1 (HTLV-1) Tax PCR detection. End-point PCR method able to specifically detect a single HTLV-1 Tax DNA amplimer from 0.1 fg of input genomic DNA (DNA from the human JPX9 cell line was used as a positive control for Tax). GAPDH: glyceraldehyde 3-phosphate dehydrogenase.

    Techniques Used: Polymerase Chain Reaction, Positive Control

    45) Product Images from "Limitations and challenges of genetic barcode quantification"

    Article Title: Limitations and challenges of genetic barcode quantification

    Journal: Scientific Reports

    doi: 10.1038/srep43249

    PCR protocol modifications – BC16. Every barcode mixture was analysed using a successive reduction of PCR cycle numbers from 65 down to 30 PCR cycles in combination with different sample preparation strategies, namely the ( a ) standard protocol (gDNA), ( b ) an improved protocol with an additional restriction digest (EcoRI) and ( c ) a totally artificial protocol consisting of previously build and afterwards mixed 1 kb long DNA fragments (1 kb). The relative average barcode abundances of all miniBulk replicates are shown as barplots.
    Figure Legend Snippet: PCR protocol modifications – BC16. Every barcode mixture was analysed using a successive reduction of PCR cycle numbers from 65 down to 30 PCR cycles in combination with different sample preparation strategies, namely the ( a ) standard protocol (gDNA), ( b ) an improved protocol with an additional restriction digest (EcoRI) and ( c ) a totally artificial protocol consisting of previously build and afterwards mixed 1 kb long DNA fragments (1 kb). The relative average barcode abundances of all miniBulk replicates are shown as barplots.

    Techniques Used: Polymerase Chain Reaction, Sample Prep

    PCR protocol modifications – BC32. Every barcode mixture was analysed using a successive reduction of PCR cycle numbers from 40 down to 20 PCR cycles in combination with different sample preparation strategies, namely the standard protocol (gDNA), an improved protocol with an additional restriction digest (EcoRI) and a totally artificial protocol consisting of previously build and afterwards mixed 1 kb long DNA fragments (1 kb). Depicted are the average barcode abundances including their standard deviation of all miniBulk replicates.
    Figure Legend Snippet: PCR protocol modifications – BC32. Every barcode mixture was analysed using a successive reduction of PCR cycle numbers from 40 down to 20 PCR cycles in combination with different sample preparation strategies, namely the standard protocol (gDNA), an improved protocol with an additional restriction digest (EcoRI) and a totally artificial protocol consisting of previously build and afterwards mixed 1 kb long DNA fragments (1 kb). Depicted are the average barcode abundances including their standard deviation of all miniBulk replicates.

    Techniques Used: Polymerase Chain Reaction, Sample Prep, Standard Deviation

    46) Product Images from "The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota"

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189188

    Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.
    Figure Legend Snippet: Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.
    Figure Legend Snippet: Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    47) Product Images from "Detection of Human Papillomaviruses by Polymerase Chain Reaction and Ligation Reaction on Universal Microarray"

    Article Title: Detection of Human Papillomaviruses by Polymerase Chain Reaction and Ligation Reaction on Universal Microarray

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0034211

    Comparison of the PGMY-t and the original PGMY multiplex PCR primer mixes as measured by HPV LDR signals on microarray. Both primer mixes at 0.2 µM primer concentration amplify all five HPV types from 1 ng of template (A) (B) and from 1 pg of template (C) (D). With the original PGMY mix at 1 ng template concentration, HPV 59 gives a false positive signal (B). HPV 33 signal is also relatively weak with the original PGMY at 1 pg template concentrations (D). Data are presented as means±SD from two independent microarrays. Y-axis shows signal intensity in arbitrary units. Asterisk (*) indicates the target HPV types present in the experiment.
    Figure Legend Snippet: Comparison of the PGMY-t and the original PGMY multiplex PCR primer mixes as measured by HPV LDR signals on microarray. Both primer mixes at 0.2 µM primer concentration amplify all five HPV types from 1 ng of template (A) (B) and from 1 pg of template (C) (D). With the original PGMY mix at 1 ng template concentration, HPV 59 gives a false positive signal (B). HPV 33 signal is also relatively weak with the original PGMY at 1 pg template concentrations (D). Data are presented as means±SD from two independent microarrays. Y-axis shows signal intensity in arbitrary units. Asterisk (*) indicates the target HPV types present in the experiment.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Microarray, Concentration Assay

    48) Product Images from "A Rapid Genetic Assay for the Identification of the Most Common Pocillopora damicornis Genetic Lineages on the Great Barrier Reef"

    Article Title: A Rapid Genetic Assay for the Identification of the Most Common Pocillopora damicornis Genetic Lineages on the Great Barrier Reef

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0058447

    Results of the Factorial Correspondence Analysis on 329 Pocillopora damicornis sensu [ 10 ] microsatellite genotypes. The first two coordinates explain 100% of the variability. Genetic lineage was determined by the PCR RFLP assay.
    Figure Legend Snippet: Results of the Factorial Correspondence Analysis on 329 Pocillopora damicornis sensu [ 10 ] microsatellite genotypes. The first two coordinates explain 100% of the variability. Genetic lineage was determined by the PCR RFLP assay.

    Techniques Used: Polymerase Chain Reaction, RFLP Assay

    49) Product Images from "Novel One-Step Multiplex PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of β-Thalassemia"

    Article Title: Novel One-Step Multiplex PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of β-Thalassemia

    Journal: BioMed Research International

    doi: 10.1155/2013/585106

    Profiles of 2 different combinations of markers throughout the HLA region after the update of the method on single blastomeres biopsied from nonrelated embryos. Although the efficiency of the PCR varies depending on the marker, the amplification levels obtained for them are adequate to perform the analysis simultaneously. Appropriate zoom of the y -axis of the fluorescence level (proportional to the amplification level), let us to observe and analyze all the peaks, corresponding to the different markers.
    Figure Legend Snippet: Profiles of 2 different combinations of markers throughout the HLA region after the update of the method on single blastomeres biopsied from nonrelated embryos. Although the efficiency of the PCR varies depending on the marker, the amplification levels obtained for them are adequate to perform the analysis simultaneously. Appropriate zoom of the y -axis of the fluorescence level (proportional to the amplification level), let us to observe and analyze all the peaks, corresponding to the different markers.

    Techniques Used: Polymerase Chain Reaction, Marker, Amplification, Fluorescence

    50) Product Images from "Self-Transmissibility of the Integrative and Conjugative Element ICEPm1 between Clinical Isolates Requires a Functional Integrase, Relaxase, and Type IV Secretion System ▿"

    Article Title: Self-Transmissibility of the Integrative and Conjugative Element ICEPm1 between Clinical Isolates Requires a Functional Integrase, Relaxase, and Type IV Secretion System ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.05119-11

    ICE Pm1 -carried T4SS genes are important for conjugative transfer. (A) Disruption of the ICE Pm1 relaxase gene ( traI ) and conjugative pore-forming gene ( traP ) had no effect on the ability of ICE Pm1 to excise from the chromosome, as all amplification products that represent excised and integrated forms are obtained. Additionally, insertional inactivation of the relaxase of the SXT-like ICE ( traI SXT ) also did not affect excision. (B) Mating assays performed with the traI :: kan and traP mutants decreased the transfer frequency of ICE Pm1 by approximately 1,000-fold. The transfer frequency of ICE Pm1 in the SXT-like relaxase mutant (Ω traI SXT ICE Pm1 :: kan ) was similar to wild-type levels, suggesting that the SXT-like ICE cannot transfer ICE Pm1 in trans. Limit of detection, 2.5 × 10 −8 transconjugants/donor. (C) Active excision of the SXT-like ICE (ICE Pmi Usa1) from the chromosome of P. mirabilis HI4320. Primers were designed in a similar way as for the PCR assay for detection of ICE Pm1 excision. Primer pair SXT-P1 and SXT-P2 was used to amplify SXT- attL . Primer pair SXT-P3 and SXT-P4 was used to amplify SXT- attR . Primer pairs SXT-P1 with SXT-P4 and SXT-P2 with SXT-P3 were used to amplify the attB and attI sites, respectively.
    Figure Legend Snippet: ICE Pm1 -carried T4SS genes are important for conjugative transfer. (A) Disruption of the ICE Pm1 relaxase gene ( traI ) and conjugative pore-forming gene ( traP ) had no effect on the ability of ICE Pm1 to excise from the chromosome, as all amplification products that represent excised and integrated forms are obtained. Additionally, insertional inactivation of the relaxase of the SXT-like ICE ( traI SXT ) also did not affect excision. (B) Mating assays performed with the traI :: kan and traP mutants decreased the transfer frequency of ICE Pm1 by approximately 1,000-fold. The transfer frequency of ICE Pm1 in the SXT-like relaxase mutant (Ω traI SXT ICE Pm1 :: kan ) was similar to wild-type levels, suggesting that the SXT-like ICE cannot transfer ICE Pm1 in trans. Limit of detection, 2.5 × 10 −8 transconjugants/donor. (C) Active excision of the SXT-like ICE (ICE Pmi Usa1) from the chromosome of P. mirabilis HI4320. Primers were designed in a similar way as for the PCR assay for detection of ICE Pm1 excision. Primer pair SXT-P1 and SXT-P2 was used to amplify SXT- attL . Primer pair SXT-P3 and SXT-P4 was used to amplify SXT- attR . Primer pairs SXT-P1 with SXT-P4 and SXT-P2 with SXT-P3 were used to amplify the attB and attI sites, respectively.

    Techniques Used: Amplification, Mutagenesis, Polymerase Chain Reaction

    Confirmation of ICE Pm1 transfer to a clinical P. mirabilis commensal isolate and its retained function. (A) Mating assays were performed, and three transconjugants were selected for isolation and extraction of genomic DNA to confirm transfer of ICE Pm1 by PCR. Amplification products were obtained for the beginning (PMI2551), middle (PMI2602), and end (PMI2641) of ICE Pm1 to demonstrate complete transfer of the ICE. The att Tn 7 site, which produces products of different sizes in the donor ( P. mirabilis HI4320 ICE:: kan ) and the recipient ( P. mirabilis 378L) strains, was used to differentiate between the donor and recipient genetic backgrounds. (B) Amplification products for attI and attB in the transconjugant (378L ICE Pm1 ) demonstrate that ICE Pm1 is capable of excising in the recipient host background. NTC, no-template control.
    Figure Legend Snippet: Confirmation of ICE Pm1 transfer to a clinical P. mirabilis commensal isolate and its retained function. (A) Mating assays were performed, and three transconjugants were selected for isolation and extraction of genomic DNA to confirm transfer of ICE Pm1 by PCR. Amplification products were obtained for the beginning (PMI2551), middle (PMI2602), and end (PMI2641) of ICE Pm1 to demonstrate complete transfer of the ICE. The att Tn 7 site, which produces products of different sizes in the donor ( P. mirabilis HI4320 ICE:: kan ) and the recipient ( P. mirabilis 378L) strains, was used to differentiate between the donor and recipient genetic backgrounds. (B) Amplification products for attI and attB in the transconjugant (378L ICE Pm1 ) demonstrate that ICE Pm1 is capable of excising in the recipient host background. NTC, no-template control.

    Techniques Used: Isolation, Polymerase Chain Reaction, Amplification

    51) Product Images from "A Large X-Chromosomal Deletion is Associated with Microphthalmia with Linear Skin Defects (MLS) and Amelogenesis Imperfecta (XAI)"

    Article Title: A Large X-Chromosomal Deletion is Associated with Microphthalmia with Linear Skin Defects (MLS) and Amelogenesis Imperfecta (XAI)

    Journal: American journal of medical genetics. Part A

    doi: 10.1002/ajmg.a.32968

    Molecular analyses of the patient's DNA. A. Semi-quantitative multiplex PCR using the AMELX primers indicated by horizontal arrows and aCGH revealed that the patient has a heterozygous deletion from Xpter to Xp22.2 and totaling 12 Mb. More than 50 genes
    Figure Legend Snippet: Molecular analyses of the patient's DNA. A. Semi-quantitative multiplex PCR using the AMELX primers indicated by horizontal arrows and aCGH revealed that the patient has a heterozygous deletion from Xpter to Xp22.2 and totaling 12 Mb. More than 50 genes

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction

    52) Product Images from "Accurate diagnosis of mismatch repair deficiency in colorectal cancer using high-quality DNA samples from cultured stem cells"

    Article Title: Accurate diagnosis of mismatch repair deficiency in colorectal cancer using high-quality DNA samples from cultured stem cells

    Journal: Oncotarget

    doi: 10.18632/oncotarget.26495

    Electropherograms of on-chip MSI analysis using spheroid-derived DNA samples ( A ) HC51T. Representative electropherograms of an MSS case for five microsatellite markers of the Bethesda panel. Red lines show the PCR products amplified from the cancer cell spheroid DNA samples, whereas blue lines indicate those from the normal epithelial stem cell DNA of the same patient. HC26T and HC4T. Representative electropherograms of MSI-H cases. The peak patterns between tumor-initiating cells (red) and the normal epithelial stem cells (blue) are separated for all loci tested. The ordinate shows fluorescence intensity in arbitrary unit (FU). ( B ) On-chip electropherogram of a representative case in which FFPE tumor-derived DNA sample (blue) showed much lower peaks with poorer resolution than spheroid-derived DNA (red) of the same patient normal mucosal stem cells (HC6N). The ordinate shows fluorescence intensity in arbitrary unit (FU). ( C ) Maximum electrophoretic peak-heights of PCR-amplified MSI markers (shown at bottom) compared between spheroid- and FFPE tumor-derived DNA samples. Note that spheroid-derived (Sph) DNA gave taller peaks than FFPE tumor-derived (FFPE) DNA for all five Bethesda panel markers. **** P
    Figure Legend Snippet: Electropherograms of on-chip MSI analysis using spheroid-derived DNA samples ( A ) HC51T. Representative electropherograms of an MSS case for five microsatellite markers of the Bethesda panel. Red lines show the PCR products amplified from the cancer cell spheroid DNA samples, whereas blue lines indicate those from the normal epithelial stem cell DNA of the same patient. HC26T and HC4T. Representative electropherograms of MSI-H cases. The peak patterns between tumor-initiating cells (red) and the normal epithelial stem cells (blue) are separated for all loci tested. The ordinate shows fluorescence intensity in arbitrary unit (FU). ( B ) On-chip electropherogram of a representative case in which FFPE tumor-derived DNA sample (blue) showed much lower peaks with poorer resolution than spheroid-derived DNA (red) of the same patient normal mucosal stem cells (HC6N). The ordinate shows fluorescence intensity in arbitrary unit (FU). ( C ) Maximum electrophoretic peak-heights of PCR-amplified MSI markers (shown at bottom) compared between spheroid- and FFPE tumor-derived DNA samples. Note that spheroid-derived (Sph) DNA gave taller peaks than FFPE tumor-derived (FFPE) DNA for all five Bethesda panel markers. **** P

    Techniques Used: Chromatin Immunoprecipitation, Derivative Assay, Polymerase Chain Reaction, Amplification, Fluorescence, Formalin-fixed Paraffin-Embedded

    53) Product Images from "16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife"

    Article Title: 16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife

    Journal: mSystems

    doi: 10.1128/mSystems.00032-16

    Taxonomic assignment of the V4 16S rRNA sequences in wild rodents and in negative controls for extraction and PCR. The histograms show the percentages of sequences for the most abundant bacterial genera in the two MiSeq runs combined. Notice the presence in the controls of several bacterial genera, which was likely due to the inherent contamination of laboratory reagents by bacterial DNA (termed “contaminant genera”). These contaminant genera are also present (to a lesser extent) in the rodent samples. The insertions represent the proportion of sequences from rodent samples which were incorrectly assigned to the controls. See Fig. S1 for separate histograms for the two MiSeq runs.
    Figure Legend Snippet: Taxonomic assignment of the V4 16S rRNA sequences in wild rodents and in negative controls for extraction and PCR. The histograms show the percentages of sequences for the most abundant bacterial genera in the two MiSeq runs combined. Notice the presence in the controls of several bacterial genera, which was likely due to the inherent contamination of laboratory reagents by bacterial DNA (termed “contaminant genera”). These contaminant genera are also present (to a lesser extent) in the rodent samples. The insertions represent the proportion of sequences from rodent samples which were incorrectly assigned to the controls. See Fig. S1 for separate histograms for the two MiSeq runs.

    Techniques Used: Polymerase Chain Reaction

    54) Product Images from "The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota"

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0189188

    Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.
    Figure Legend Snippet: Associations of OTU read proportions between exact PCR replicates and between high and low molecular weight DNA fractions. A) Relative OTU abundances for two exact replicates at the same PCR conditions. B) For mitochondrial COI amplified from samples stored at -20°C and C) at room temperature. D) For microbial 16SrDNA amplified from samples stored at -20°C and E) at room temperature. The dashed line represents the 1:1 line.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.
    Figure Legend Snippet: Bray Curtis dissimilarity between PCR replicates and between high and low molecular weight DNA fractions in the degradation experiment and from Malaise trap samples. A) Bray Curtis dissimilarity between PCR replicates of the same mock community samples at 5°C different annealing temperatures (51°C from 46°C), with a reduced PCR cycle number (22 x from 32 x), using a different forward primer (mlCOIintF instead of ARF1), and for two exact replicates under identical conditions (to test for stochastic PCR bias). B) Bray Curtis dissimilarity between high and low molecular weight DNA fractions for community samples stored under freezer (FT) and room temperature (RT) conditions or from an actual Malaise trap (M) and amplified for mitochondrial COI and C) for microbial 16SrDNA.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Amplification

    55) Product Images from "Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay"

    Article Title: Highly Parallel and Short-Acting Amplification with Locus-Specific Primers to Detect Single Nucleotide Polymorphisms by the DigiTag2 Assay

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029967

    Scatter plots for three SNPs with 3 discordant genotypes. Scatter plots in genotyping with 192-plex PCR and 96-plex PCR are depicted side-by-side. The genotypes of discordant samples are indicated in the scatter plots by arrows.
    Figure Legend Snippet: Scatter plots for three SNPs with 3 discordant genotypes. Scatter plots in genotyping with 192-plex PCR and 96-plex PCR are depicted side-by-side. The genotypes of discordant samples are indicated in the scatter plots by arrows.

    Techniques Used: Polymerase Chain Reaction

    56) Product Images from "Is human cytomegalovirus associated with breast cancer progression?"

    Article Title: Is human cytomegalovirus associated with breast cancer progression?

    Journal: Infectious Agents and Cancer

    doi: 10.1186/1750-9378-8-12

    Quality control for breast carcinomas and fibroadenomas. Multiplex PCR for GADPH. ( A ) Lines 1−9 and 19−26 breast carcinomas; 10−18 fibroadenomas. ( B ) Lines 27, 37−45 breast carcinomas; 19−30, 46 and 47 fibroadenomas. Base pairs (bp); control positive (+), HCMV strain AD-169 (ATCC® VR-583); control negative (−), DNA white blood cells from healthy individual (blood donor) and reaction mix without DNA.
    Figure Legend Snippet: Quality control for breast carcinomas and fibroadenomas. Multiplex PCR for GADPH. ( A ) Lines 1−9 and 19−26 breast carcinomas; 10−18 fibroadenomas. ( B ) Lines 27, 37−45 breast carcinomas; 19−30, 46 and 47 fibroadenomas. Base pairs (bp); control positive (+), HCMV strain AD-169 (ATCC® VR-583); control negative (−), DNA white blood cells from healthy individual (blood donor) and reaction mix without DNA.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Gene target standards were cloned by PCR into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA) by using DNA template (bacterial and DNA viral targets) or cDNA template (RNA viral targets) obtained by reverse transcription of extracts from infected cultured cells or by assembly of overlapping synthetic polynucleotides. .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen). .. Plasmids from clones positive for all five amplicons were isolated by alkaline lysis and transformed into E. coli strain Epi300.

    Amplification:

    Article Title: New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP
    Article Snippet: Paragraph title: Oligonucleotide design and multiplex PCR amplification from gDNA ... Multiplex PCR reactions were performed in a 25-μl reaction mix containing 20 ng gDNA as the template, using the Qiagen Multiplex PCR Kit (Qiagen, Barcelona, Spain) supplemented with a 0.5X final concentration of Q-Solution (Qiagen) and following the manufacturer’s recommendations.

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: .. Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad).

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: .. However, there were indications of a slight increase in amplicon yield for all three targets for all OXP-modified primer combinations with the exception of the Qiagen Multiplex PCR kit. ..

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). .. Amplification products were separated from unused primers by using QIAquick 96 PCR purification cartridges (Qiagen, with modified binding and wash buffers).

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: .. Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen). .. Primers used for multiplex PCR can be found in Additional file : Table S4 and are listed as “low resolution multiplex PCR”.

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: Single modified OXP primers were compared to other “Hot Start” technologies for amplicon yield. .. The single modified OXP primers, Platinum® Taq , and Qiagen’s Multiplex PCR kit all displayed similar efficiency in amplifying each individual target and similar overall yields.

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: .. A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ). ..

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota
    Article Snippet: Both markers amplified very similar amplicon sizes of about 350 bp. .. PCRs were run in 10 μl volumes with ~15 ng of template DNA and 32 cycles using the Qiagen Multiplex PCR kit according to the manufacturer’s protocols.

    Positive Control:

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Synthesized:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Primers, synthesized with a 5´ C6 spacer and aminohexyl modification, were covalently conjugated by a photocleavable link to Masscode tags (Qiagen Masscode technology) ( , ). .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    Electrophoresis:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad).

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ). .. Multiplex PCR products were separated by capillary electrophoresis (Applied Biosystems Genetic Analyzer 3130 at the Macromolecular Resource Facility, CSU) and FLA to determine the major allele for each VNTR locus using GeneMapper, version 3.7, software.

    Infection:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: The samples were then analyzed and each result would be classified as positive or negative for H . pylori infection. .. Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Gene target standards were cloned by PCR into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA) by using DNA template (bacterial and DNA viral targets) or cDNA template (RNA viral targets) obtained by reverse transcription of extracts from infected cultured cells or by assembly of overlapping synthetic polynucleotides. .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    Mass Spectrometry:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Masscode tags have a modular structure, including a tetrafluorophenyl ester for tag conjugation to primary amines; an o-nitrobenzyl photolabile linker for photoredox cleavage of the tag from the analyte; a mass spectrometry sensitivity enhancer, which improves the efficiency of atmospheric pressure chemical ionization of the cleaved tag; and a variable mass unit for variation of the cleaved tag mass ( , – ). .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota
    Article Snippet: One primer pair amplified the bacterial 16SrDNA (MS-27F/MS-338R [ ]) at 55°C annealing temperature, while the other targeted the mitochondrial COI (mlCOIintF/Fol-degen-rev [ , ]) at 46°C annealing temperature. .. PCRs were run in 10 μl volumes with ~15 ng of template DNA and 32 cycles using the Qiagen Multiplex PCR kit according to the manufacturer’s protocols.

    Modification:

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: Paragraph title: Evaluation of single modified OXP primers in comparison to and in combination with other “Hot Start” Technologies ... However, there were indications of a slight increase in amplicon yield for all three targets for all OXP-modified primer combinations with the exception of the Qiagen Multiplex PCR kit.

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Primers, synthesized with a 5´ C6 spacer and aminohexyl modification, were covalently conjugated by a photocleavable link to Masscode tags (Qiagen Masscode technology) ( , ). .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: .. The single modified OXP primers, Platinum® Taq , and Qiagen’s Multiplex PCR kit all displayed similar efficiency in amplifying each individual target and similar overall yields. .. However, while the smaller L533 and L600 products were amplified well, the longer L962 proved difficult to amplify for some of the modified DNA polymerases such as AmpliTaq® Gold, HotStart-IT®, and DyNAzyme™ II Hot Start Polymerase.

    Transformation Assay:

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: Digested fragments were mixed with 500–1000 ng of vector and transformed into yeast spheroplasts as previously described [ ]. .. Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen).

    Conjugation Assay:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Masscode tags have a modular structure, including a tetrafluorophenyl ester for tag conjugation to primary amines; an o-nitrobenzyl photolabile linker for photoredox cleavage of the tag from the analyte; a mass spectrometry sensitivity enhancer, which improves the efficiency of atmospheric pressure chemical ionization of the cleaved tag; and a variable mass unit for variation of the cleaved tag mass ( , – ). .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    Flow Cytometry:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). .. Masscode tags were decoupled from amplified products through UV light-induced photolysis in a flow cell and analyzed in a single quadrapole mass spectrometer using positive-mode atmospheric pressure chemical ionization (Agilent Technologies, Palo Alto, CA, USA).

    Cell Culture:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Gene target standards were cloned by PCR into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA) by using DNA template (bacterial and DNA viral targets) or cDNA template (RNA viral targets) obtained by reverse transcription of extracts from infected cultured cells or by assembly of overlapping synthetic polynucleotides. .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    DNA Sequencing:

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ). .. When DNA sequencing was performed, a multiplex PCR sample was diluted 10-fold; 1 to 2 μl was combined with 10 pmol of the unlabeled forward primer for the ABI Big Dye cycle sequencing reaction at the Macromolecular Resource Facility, CSU ( ).

    Sequencing:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. DNA bands with the expected molecular weight were excised from the agarose gel, purified with ULTRAPrep Agarose Gel Extraction kits (AHN), and sequenced with BigDye Terminator Sequencing Kit (Applied Biosystems).

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ). .. When DNA sequencing was performed, a multiplex PCR sample was diluted 10-fold; 1 to 2 μl was combined with 10 pmol of the unlabeled forward primer for the ABI Big Dye cycle sequencing reaction at the Macromolecular Resource Facility, CSU ( ).

    Binding Assay:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). .. Amplification products were separated from unused primers by using QIAquick 96 PCR purification cartridges (Qiagen, with modified binding and wash buffers).

    Molecular Weight:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. DNA bands with the expected molecular weight were excised from the agarose gel, purified with ULTRAPrep Agarose Gel Extraction kits (AHN), and sequenced with BigDye Terminator Sequencing Kit (Applied Biosystems).

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota
    Article Snippet: One contained the intact high molecular weight DNA, and the other was composed of degraded low molecular weight DNA. .. PCRs were run in 10 μl volumes with ~15 ng of template DNA and 32 cycles using the Qiagen Multiplex PCR kit according to the manufacturer’s protocols.

    DNA Extraction:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: .. Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad).

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: A sterile scalpel blade was used to excise several pieces of tissue, at least 1cm3 each, and placed in individual sterile 5 ml plastic tubes containing 70% ethanol to fix the specimen before DNA extraction. .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: A sterile scalpel blade was used to excise several pieces of tissue, at least 1cm3 each, and placed in individual sterile 5 ml plastic tubes containing 70% ethanol to fix the specimen before DNA extraction. .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome.

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: Paragraph title: DNA extraction, multiplex PCR, and FLA for 15 VNTRs. ... A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ).

    Isolation:

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen). .. Plasmids from clones positive for all five amplicons were isolated by alkaline lysis and transformed into E. coli strain Epi300.

    Multiplex Assay:

    Article Title: New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP
    Article Snippet: .. Multiplex PCR reactions were performed in a 25-μl reaction mix containing 20 ng gDNA as the template, using the Qiagen Multiplex PCR Kit (Qiagen, Barcelona, Spain) supplemented with a 0.5X final concentration of Q-Solution (Qiagen) and following the manufacturer’s recommendations. ..

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: .. Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad).

    Article Title: Improvements of rolling circle amplification (RCA) efficiency and accuracy using Thermus thermophilus SSB mutant protein
    Article Snippet: .. PCR was performed using DNA polymerase from Thermus aquaticus (Taq ) according to the manufacturer's instructions (QIAGEN HotSartTaq DNA polymerase kit and QIAGEN Multiplex PCR kit, QIAGEN). .. PCR thermal cycles used were 15 min at 95°C for DNA denaturation, followed by 35 cycles of 30 s at 94°C, 90 s at 60°C and 90 s at 72°C.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: .. However, there were indications of a slight increase in amplicon yield for all three targets for all OXP-modified primer combinations with the exception of the Qiagen Multiplex PCR kit. ..

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). .. Amplification products were separated from unused primers by using QIAquick 96 PCR purification cartridges (Qiagen, with modified binding and wash buffers).

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: .. Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen). .. Primers used for multiplex PCR can be found in Additional file : Table S4 and are listed as “low resolution multiplex PCR”.

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: .. The single modified OXP primers, Platinum® Taq , and Qiagen’s Multiplex PCR kit all displayed similar efficiency in amplifying each individual target and similar overall yields. .. However, while the smaller L533 and L600 products were amplified well, the longer L962 proved difficult to amplify for some of the modified DNA polymerases such as AmpliTaq® Gold, HotStart-IT®, and DyNAzyme™ II Hot Start Polymerase.

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: .. A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ). ..

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota
    Article Snippet: .. PCRs were run in 10 μl volumes with ~15 ng of template DNA and 32 cycles using the Qiagen Multiplex PCR kit according to the manufacturer’s protocols. .. Each primer possessed a tail with conserved sequences, which served as priming sites for a second-round indexing PCR of 6 cycles.

    Labeling:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: H . pylori detection From the total sample of 447 adolescents, 437 were screened for gastric H . pylori infection using the UBT that consists in the exhalation of carbon dioxide in samples before and after swallowing urea labeled with non-radioactive carbon-13. .. Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Purification:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. DNA bands with the expected molecular weight were excised from the agarose gel, purified with ULTRAPrep Agarose Gel Extraction kits (AHN), and sequenced with BigDye Terminator Sequencing Kit (Applied Biosystems).

    Article Title: Improvements of rolling circle amplification (RCA) efficiency and accuracy using Thermus thermophilus SSB mutant protein
    Article Snippet: PCR was performed using DNA polymerase from Thermus aquaticus (Taq ) according to the manufacturer's instructions (QIAGEN HotSartTaq DNA polymerase kit and QIAGEN Multiplex PCR kit, QIAGEN). .. PCR products were purified by a kit (DNA purification kit, Amersham Biosciences).

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). .. Amplification products were separated from unused primers by using QIAquick 96 PCR purification cartridges (Qiagen, with modified binding and wash buffers).

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota
    Article Snippet: PCRs were run in 10 μl volumes with ~15 ng of template DNA and 32 cycles using the Qiagen Multiplex PCR kit according to the manufacturer’s protocols. .. After each PCR round, samples were cleaned of residual primers by 1 X Ampure Beads XP purification.

    Polymerase Chain Reaction:

    Article Title: New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP
    Article Snippet: .. Multiplex PCR reactions were performed in a 25-μl reaction mix containing 20 ng gDNA as the template, using the Qiagen Multiplex PCR Kit (Qiagen, Barcelona, Spain) supplemented with a 0.5X final concentration of Q-Solution (Qiagen) and following the manufacturer’s recommendations. ..

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: .. Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad).

    Article Title: Improvements of rolling circle amplification (RCA) efficiency and accuracy using Thermus thermophilus SSB mutant protein
    Article Snippet: .. PCR was performed using DNA polymerase from Thermus aquaticus (Taq ) according to the manufacturer's instructions (QIAGEN HotSartTaq DNA polymerase kit and QIAGEN Multiplex PCR kit, QIAGEN). .. PCR thermal cycles used were 15 min at 95°C for DNA denaturation, followed by 35 cycles of 30 s at 94°C, 90 s at 60°C and 90 s at 72°C.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: .. However, there were indications of a slight increase in amplicon yield for all three targets for all OXP-modified primer combinations with the exception of the Qiagen Multiplex PCR kit. ..

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). .. Amplification products were separated from unused primers by using QIAquick 96 PCR purification cartridges (Qiagen, with modified binding and wash buffers).

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: .. Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen). .. Primers used for multiplex PCR can be found in Additional file : Table S4 and are listed as “low resolution multiplex PCR”.

    Article Title: Chemically modified primers for improved multiplex PCR
    Article Snippet: .. The single modified OXP primers, Platinum® Taq , and Qiagen’s Multiplex PCR kit all displayed similar efficiency in amplifying each individual target and similar overall yields. .. However, while the smaller L533 and L600 products were amplified well, the longer L962 proved difficult to amplify for some of the modified DNA polymerases such as AmpliTaq® Gold, HotStart-IT®, and DyNAzyme™ II Hot Start Polymerase.

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: .. A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ). ..

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota
    Article Snippet: .. PCRs were run in 10 μl volumes with ~15 ng of template DNA and 32 cycles using the Qiagen Multiplex PCR kit according to the manufacturer’s protocols. .. Each primer possessed a tail with conserved sequences, which served as priming sites for a second-round indexing PCR of 6 cycles.

    Plasmid Preparation:

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens
    Article Snippet: .. Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA). .. Amplification products were separated from unused primers by using QIAquick 96 PCR purification cartridges (Qiagen, with modified binding and wash buffers).

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: Digested fragments were mixed with 500–1000 ng of vector and transformed into yeast spheroplasts as previously described [ ]. .. Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen).

    Software:

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines
    Article Snippet: A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ). .. Multiplex PCR products were separated by capillary electrophoresis (Applied Biosystems Genetic Analyzer 3130 at the Macromolecular Resource Facility, CSU) and FLA to determine the major allele for each VNTR locus using GeneMapper, version 3.7, software.

    Negative Control:

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome. .. The primer sequences and the protocol used were adapted from Donoghue [ ] using the following PCR protocol: denaturation at 95°C for 15 min, 40 cycles of denaturation at 94°C for 30 s, primer annealing at 58°C for 40 s, extension at 72°C for 30 s, and final extension at 72°C for 10 min. Each reaction set included a positive control tube using purified M . leprae DNA (2 ng) and a negative control tube without template DNA.

    Agarose Gel Electrophoresis:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad).

    Sampling:

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: Environmental approval of wild armadillo tissue sampling was obtained with ICMBio authorization for research activities (SISBIO 44831–1). .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome.

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos
    Article Snippet: Environmental approval of wild armadillo tissue sampling was obtained with ICMBio authorization for research activities (SISBIO 44831–1). .. The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome.

    Concentration Assay:

    Article Title: New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP
    Article Snippet: .. Multiplex PCR reactions were performed in a 25-μl reaction mix containing 20 ng gDNA as the template, using the Qiagen Multiplex PCR Kit (Qiagen, Barcelona, Spain) supplemented with a 0.5X final concentration of Q-Solution (Qiagen) and following the manufacturer’s recommendations. ..

    Alkaline Lysis:

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen). .. Plasmids from clones positive for all five amplicons were isolated by alkaline lysis and transformed into E. coli strain Epi300.

    DNA Purification:

    Article Title: Improvements of rolling circle amplification (RCA) efficiency and accuracy using Thermus thermophilus SSB mutant protein
    Article Snippet: PCR was performed using DNA polymerase from Thermus aquaticus (Taq ) according to the manufacturer's instructions (QIAGEN HotSartTaq DNA polymerase kit and QIAGEN Multiplex PCR kit, QIAGEN). .. PCR products were purified by a kit (DNA purification kit, Amersham Biosciences).

    Marker:

    Article Title: The effect of DNA degradation bias in passive sampling devices on metabarcoding studies of arthropod communities and their associated microbiota
    Article Snippet: The two marker types were targeted to test for differences in DNA degradation between arthropod DNA and DNA of arthropod associated microbes. .. PCRs were run in 10 μl volumes with ~15 ng of template DNA and 32 cycles using the Qiagen Multiplex PCR kit according to the manufacturer’s protocols.

    Staining:

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations
    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). .. PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad).

    Article Title: Assembly of eukaryotic algal chromosomes in yeast
    Article Snippet: The gel was then stained briefly with ethidium bromide, and the excised fragments were each separated from genomic DNA and vector by electroelution using RECO chips (Takara). .. Resulting yeast colonies were screened by colony PCR using a multiplex primer set containing one amplicon on each assembled fragment using the Multiplex PCR Kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen multiplex pcr enzyme kit
    The relationship between the 21-3 <t>VNTR</t> allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex <t>PCR</t> for four VNTR loci. The 21-3 product
    Multiplex Pcr Enzyme Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1028 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex pcr enzyme kit/product/Qiagen
    Average 99 stars, based on 1028 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr enzyme kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product

    Journal: Journal of Clinical Microbiology

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines

    doi: 10.1128/JCM.02021-08

    Figure Lengend Snippet: The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product

    Article Snippet: A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ).

    Techniques: Agarose Gel Electrophoresis, Multiplex Assay, Polymerase Chain Reaction

    Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Evidence of zoonotic leprosy in Pará, Brazilian Amazon, and risks associated with human contact or consumption of armadillos

    doi: 10.1371/journal.pntd.0006532

    Figure Lengend Snippet: Detection of RLEP sequence by PCR in armadillo tissues. A) Analysis of PCR RLEP product from spleen samples from nine different armadillos. B) Analysis of RLEP from paired samples of liver (L) and spleen (S) from five different armadillos. The signal from positive samples is consistently stronger in the spleen for each individual. The positive control (+ve) reaction included purified M . leprae DNA, 2 ng, while the negative control (-ve) lacked DNA template.

    Article Snippet: The M . leprae- specific repetitive sequence, RLEP, was amplified by PCR using a Qiagen Multiplex PCR Kit (Qiagen) and primers (LP1 forward primer: 5'-TGCATGTCATGGCCTTGAGG-3' and LP2 reverse primer: 5'-CACCGATACCAGCGGCAGAA-3') that amplifies a 129-base pair fragment found in the M . leprae genome.

    Techniques: Sequencing, Polymerase Chain Reaction, Positive Control, Purification, Negative Control

    H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification

    Analysis of clinical specimens. RNA extracts from clinical specimens containing known pathogens were reverse transcribed into cDNA (Superscript RT system, Invitrogen, Carlsbad, CA; 20-µL volume). Five microliters of the reaction were subjected to Mass Tag PCR by using primers coupled to Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). Detection of (A) influenza virus A (H1N1), (B) respiratory syncytial virus (RSV) group B, (C) human coronavirus SARS (HCoV-SARS), (D) human parainfluenza virus (HPIV) types 1 and (E) 3, and (F) enterovirus (EV) by using a 30-plex assay, including 60 primers targeting influenza A virus matrix gene (FLUAV-M), and for typing N1, N2, H1, H2, H3, and H5 sequences, as well as influenza B virus (FLUBV), RSV groups A and B, HCoV-229E, -OC43, and -SARS, HPIV types 1, 2, 3, and 4 (groups A and B combined; 4 primers), human metapneumovirus (HMPV, 4 primers), measles virus (MEV), EV (degenerate primer pair targeting all serogroups), human adenoviruses (HAdV, degenerate primer pair targeting all serogroups), human herpesvirus 1 (HHV-1, herpes simplex virus), human herpesvirus 3 (HHV-3; varicella-zoster virus), Mycoplasma pneumoniae , Chlamydia pneumoniae , Legionella pneumophila , Streptococcus pneumoniae , Haemophilus influenzae . The bar indicates an arbitrary cut-off threshold of 2.7 (4 times average background determined with random human DNA).

    Journal: Emerging Infectious Diseases

    Article Title: Diagnostic System for Rapid and Sensitive Differential Detection of Pathogens

    doi: 10.3201/eid1102.040492

    Figure Lengend Snippet: Analysis of clinical specimens. RNA extracts from clinical specimens containing known pathogens were reverse transcribed into cDNA (Superscript RT system, Invitrogen, Carlsbad, CA; 20-µL volume). Five microliters of the reaction were subjected to Mass Tag PCR by using primers coupled to Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). Detection of (A) influenza virus A (H1N1), (B) respiratory syncytial virus (RSV) group B, (C) human coronavirus SARS (HCoV-SARS), (D) human parainfluenza virus (HPIV) types 1 and (E) 3, and (F) enterovirus (EV) by using a 30-plex assay, including 60 primers targeting influenza A virus matrix gene (FLUAV-M), and for typing N1, N2, H1, H2, H3, and H5 sequences, as well as influenza B virus (FLUBV), RSV groups A and B, HCoV-229E, -OC43, and -SARS, HPIV types 1, 2, 3, and 4 (groups A and B combined; 4 primers), human metapneumovirus (HMPV, 4 primers), measles virus (MEV), EV (degenerate primer pair targeting all serogroups), human adenoviruses (HAdV, degenerate primer pair targeting all serogroups), human herpesvirus 1 (HHV-1, herpes simplex virus), human herpesvirus 3 (HHV-3; varicella-zoster virus), Mycoplasma pneumoniae , Chlamydia pneumoniae , Legionella pneumophila , Streptococcus pneumoniae , Haemophilus influenzae . The bar indicates an arbitrary cut-off threshold of 2.7 (4 times average background determined with random human DNA).

    Article Snippet: Assays were initially established by using plasmid standards diluted in 2.5-µg/mL human placenta DNA (Sigma, St. Louis, MO, USA) and subjected to PCR amplification with a multiplex PCR kit (Qiagen), primers at 0.5 µmol/L each, and the following cycling protocol: an annealing step with a temperature reduction in 1°C increments from 65°C to 51°C during the first 15 cycles and then continuing with a cycling profile of 94°C for 20 s, 50°C for 20 s, and 72°C for 30 s in an MJ PTC200 thermal cycler (MJ Research, Waltham, MA, USA).

    Techniques: Polymerase Chain Reaction, Plex Assay