transcription pcr rt pcr kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAGEN OneStep RT PCR Kit
    Description:
    For highly sensitive and specific one step RT PCR Kit contents Qiagen OneStep RT PCR Kit 25 x 50L rxns RNA Template Sample Reverse Transcription Enzyme Activity One step RT PCR Reaction With Hotstart Ideal for Gene expression Analysis Virus Detection For Highly Sensitive and Specific One step RT PCR Includes Qiagen OneStep RT PCR Enzyme Mix 1 x 50L 5x Qiagen OneStep RT PCR Buffer 1 x 250L dNTP Mix 1 x 50L 10mM Each 5x Q Solution 1 x 400L RNase free Water 1 x 1 9mL Benefits Fast and easy one tube setup Efficient one step RT PCR of any RNA template without optimization Unique enzyme mix for high specificity and sensitivity Balanced mixture of enzymes with optimized reverse transcription buffer
    Catalog Number:
    210210
    Price:
    161
    Category:
    QIAGEN OneStep RT PCR Kit
    Buy from Supplier


    Structured Review

    Qiagen transcription pcr rt pcr kit
    QIAGEN OneStep RT PCR Kit
    For highly sensitive and specific one step RT PCR Kit contents Qiagen OneStep RT PCR Kit 25 x 50L rxns RNA Template Sample Reverse Transcription Enzyme Activity One step RT PCR Reaction With Hotstart Ideal for Gene expression Analysis Virus Detection For Highly Sensitive and Specific One step RT PCR Includes Qiagen OneStep RT PCR Enzyme Mix 1 x 50L 5x Qiagen OneStep RT PCR Buffer 1 x 250L dNTP Mix 1 x 50L 10mM Each 5x Q Solution 1 x 400L RNase free Water 1 x 1 9mL Benefits Fast and easy one tube setup Efficient one step RT PCR of any RNA template without optimization Unique enzyme mix for high specificity and sensitivity Balanced mixture of enzymes with optimized reverse transcription buffer
    https://www.bioz.com/result/transcription pcr rt pcr kit/product/Qiagen
    Average 99 stars, based on 423 article reviews
    Price from $9.99 to $1999.99
    transcription pcr rt pcr kit - by Bioz Stars, 2020-10
    99/100 stars

    Images

    1) Product Images from "Autocrine Glutamate Signaling Promotes Glioma Cell Invasion"

    Article Title: Autocrine Glutamate Signaling Promotes Glioma Cell Invasion

    Journal:

    doi: 10.1158/0008-5472.CAN-07-2034

    Subunits of system x C − are expressed in glioma cell lines and patient tumor samples. A , RT-PCR indicated that transcripts of catalytic subunit xCT and the regulatory subunit 4F2hc of system x C − are expressed in primary cultures of rat
    Figure Legend Snippet: Subunits of system x C − are expressed in glioma cell lines and patient tumor samples. A , RT-PCR indicated that transcripts of catalytic subunit xCT and the regulatory subunit 4F2hc of system x C − are expressed in primary cultures of rat

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    2) Product Images from "Insights into the Gene Expression Profiles of Active and Restricted Red/Green-HIV+ Human Astrocytes: Implications for Shock or Lock Therapies in the Brain"

    Article Title: Insights into the Gene Expression Profiles of Active and Restricted Red/Green-HIV+ Human Astrocytes: Implications for Shock or Lock Therapies in the Brain

    Journal: Journal of Virology

    doi: 10.1128/JVI.01563-19

    Upregulation of interferon signaling pathways. (A) Pathway image from IPA core analysis illustrating gene expression associated with interferon signaling. (B) The molecular activity prediction (MAP) tool indicates the potential outcomes of activating the interferon signaling. The color intensity indicates the degree of upregulation (red). Predicted activation (orange), inhibition (blue), and unknown association (yellow) are also shown. Gray indicates molecules that were present in the data set but did not pass the cutoff values of a false discovery rate (FDR) of ≤0.05 and a log 2 fold change (FC) of either ≥1 or ≤−1. (C) Individual populations (red and yellow) were sorted, and STAT1 gene expression was measured by RT-PCR at 2 weeks postinfection. Data are mean fold changes ± standard error of mean (SEM) compared to D116A-infected cells. Data are cumulative for three individual astrocyte donors. Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*, P
    Figure Legend Snippet: Upregulation of interferon signaling pathways. (A) Pathway image from IPA core analysis illustrating gene expression associated with interferon signaling. (B) The molecular activity prediction (MAP) tool indicates the potential outcomes of activating the interferon signaling. The color intensity indicates the degree of upregulation (red). Predicted activation (orange), inhibition (blue), and unknown association (yellow) are also shown. Gray indicates molecules that were present in the data set but did not pass the cutoff values of a false discovery rate (FDR) of ≤0.05 and a log 2 fold change (FC) of either ≥1 or ≤−1. (C) Individual populations (red and yellow) were sorted, and STAT1 gene expression was measured by RT-PCR at 2 weeks postinfection. Data are mean fold changes ± standard error of mean (SEM) compared to D116A-infected cells. Data are cumulative for three individual astrocyte donors. Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*, P

    Techniques Used: Indirect Immunoperoxidase Assay, Expressing, Activity Assay, Activation Assay, Inhibition, Reverse Transcription Polymerase Chain Reaction, Infection

    3) Product Images from "Population differences in microRNA expression and biological implications"

    Article Title: Population differences in microRNA expression and biological implications

    Journal: RNA Biology

    doi: 10.4161/rna.8.4.16029

    The relationship between the expression of miR-342-3p and ANKRD49 in CEU and YRI samples. (A) The relationship between the expression of miR-342-3p and ANKRD49 in the discovery CEU I/II (open square) and YRI I/II (solid triangle) samples. miR-342-3p expression
    Figure Legend Snippet: The relationship between the expression of miR-342-3p and ANKRD49 in CEU and YRI samples. (A) The relationship between the expression of miR-342-3p and ANKRD49 in the discovery CEU I/II (open square) and YRI I/II (solid triangle) samples. miR-342-3p expression

    Techniques Used: Expressing

    Related Articles

    Amplification:

    Article Title: The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes
    Article Snippet: .. The open reading frames (ORFs) for r2d2, loqs-ra and loqs-rb were amplified using the One-Step Reverse Transcriptase PCR Kit (Qiagen, Germantown, MD, USA) and primers designed to add NdeI and SalI sites to the 5′ and 3′ ends, respectively (Supplementary Table S3). .. The PCR products were digested, purified by low melt agarose gel extraction, and ligated into the NdeI and SalI sites in the MCS of PUb -HA-MCS and/or PUb -FLAG-MCS vector plasmids.

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Concentration Assay:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Article Title: The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun
    Article Snippet: .. RNA samples were then diluted with water to a final concentration of 5 ng/μl RNA and the RT-PCR reaction was carried out using the Qiagen One-Step RT-PCR Kit, using 0.4 mM dNTPs and 0.6 μM of each primer, according to published protocols. ..

    Quantitative RT-PCR:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    SYBR Green Assay:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Article Title: The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun
    Article Snippet: .. RNA samples were then diluted with water to a final concentration of 5 ng/μl RNA and the RT-PCR reaction was carried out using the Qiagen One-Step RT-PCR Kit, using 0.4 mM dNTPs and 0.6 μM of each primer, according to published protocols. ..

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

    Article Title: A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower
    Article Snippet: .. Semi-quantitative (sq)RT-PCR was performed using a Qiagen One-step RT-PCR kit (Qiagen Co., Valencia, CA, USA) with 50ng total RNA. .. To visualize RNA loading concentrations, samples were amplified with Ph 18S primers and analyzed on an agarose gel.

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: .. All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. To visualize RNA-loading concentrations, samples were amplified with Ph 18S primers (forward primer 5′-TTAGCAGGCTGAGGTCTCGT-3′; reverse primer 5′-AGCGGATGTTGCTTTTAGGA-3′) and analyzed on an agarose gel.

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1
    Article Snippet: .. Afterwards, 1 µl was used as template for the One-Step RT PCR kit (Qiagen) using either KIN5 primers (tkin5.40s CCAGCAGCATAAGCTATGG ; tkin5.40a ATGAAGACTGTTGCCGCCACC ) or PGM1 primers (PGM3s AAAAGGTTAGTGGTTGTTAAGG ; PGM3a CTTGTGTAAATCATACTTTATTT ) in a total reaction volume of 25 µl. .. The reaction conditions were performed on the Geneamp PCR System 2400 (Perkin Elmer) as follows: 50°C – 30 min, 95°C – 15 min; 95°C – 45 sec, 57°C – 1 min, 72°C – 1 min for 35 cycles; 72°C – 10 min; 4°C hold.

    Polymerase Chain Reaction:

    Article Title: The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes
    Article Snippet: .. The open reading frames (ORFs) for r2d2, loqs-ra and loqs-rb were amplified using the One-Step Reverse Transcriptase PCR Kit (Qiagen, Germantown, MD, USA) and primers designed to add NdeI and SalI sites to the 5′ and 3′ ends, respectively (Supplementary Table S3). .. The PCR products were digested, purified by low melt agarose gel extraction, and ligated into the NdeI and SalI sites in the MCS of PUb -HA-MCS and/or PUb -FLAG-MCS vector plasmids.

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Modification:

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations
    Article Snippet: .. RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol. .. Single-transcript molecules were tagged with barcoded gene-specific primers that have an additional universal sequence, used in RT.

    Nested PCR:

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore
    Article Snippet: .. Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C). .. The expected size for the PCR amplification was 284 bp( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Qiagen transcription pcr rt pcr
    Upregulation of interferon signaling pathways. (A) Pathway image from IPA core analysis illustrating gene expression associated with interferon signaling. (B) The molecular activity prediction (MAP) tool indicates the potential outcomes of activating the interferon signaling. The color intensity indicates the degree of upregulation (red). Predicted activation (orange), inhibition (blue), and unknown association (yellow) are also shown. Gray indicates molecules that were present in the data set but did not pass the cutoff values of a false discovery rate (FDR) of ≤0.05 and a log 2 fold change (FC) of either ≥1 or ≤−1. (C) Individual populations (red and yellow) were sorted, and <t>STAT1</t> gene expression was measured by <t>RT-PCR</t> at 2 weeks postinfection. Data are mean fold changes ± standard error of mean (SEM) compared to D116A-infected cells. Data are cumulative for three individual astrocyte donors. Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*, P
    Transcription Pcr Rt Pcr, supplied by Qiagen, used in various techniques. Bioz Stars score: 92/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcription pcr rt pcr/product/Qiagen
    Average 92 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    transcription pcr rt pcr - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    99
    Qiagen transcription pcr rt pcr kit
    Subunits of system x C − are expressed in glioma cell lines and patient tumor samples. A , <t>RT-PCR</t> indicated that transcripts of catalytic subunit <t>xCT</t> and the regulatory subunit 4F2hc of system x C − are expressed in primary cultures of rat
    Transcription Pcr Rt Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcription pcr rt pcr kit/product/Qiagen
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    transcription pcr rt pcr kit - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    88
    Qiagen realtime pcr qpcr
    Cancer cell killing effect and viral replication of oAd/RLX-PCDP complex-loaded hMSCs on various pancreatic cancer cells. (A) Oncolytic effect by PBS, naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded or oAd/RLX-PCDP-loaded hMSCs at various MOIs. After 4 (AsPC-1 and PANC-1) or 6 (MIA PaCa-2) days post-infection, cell viability was measured by MTT assay. For oAd/RLX groups, the cell viability solely accounts for the absorbance readout of respective cancer cell types. For oAd/RLX- and oAd/RLX-PCDP-loaded hMSC groups, the total cell viability (as determined by absorbance readout) accounts for both respective types of pancreatic cancer cells and surviving hMSC carrier. (B) Viral production. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. At 72 h post-infection, viral genomic copies were measured by real-time quantitative <t>PCR.</t> Results represent the mean ± SD of triplicate experiments. *** P
    Realtime Pcr Qpcr, supplied by Qiagen, used in various techniques. Bioz Stars score: 88/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/realtime pcr qpcr/product/Qiagen
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    realtime pcr qpcr - by Bioz Stars, 2020-10
    88/100 stars
      Buy from Supplier

    93
    Qiagen quantitect probe pcr kit
    Cancer cell killing effect and viral replication of oAd/RLX-PCDP complex-loaded hMSCs on various pancreatic cancer cells. (A) Oncolytic effect by PBS, naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded or oAd/RLX-PCDP-loaded hMSCs at various MOIs. After 4 (AsPC-1 and PANC-1) or 6 (MIA PaCa-2) days post-infection, cell viability was measured by MTT assay. For oAd/RLX groups, the cell viability solely accounts for the absorbance readout of respective cancer cell types. For oAd/RLX- and oAd/RLX-PCDP-loaded hMSC groups, the total cell viability (as determined by absorbance readout) accounts for both respective types of pancreatic cancer cells and surviving hMSC carrier. (B) Viral production. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. At 72 h post-infection, viral genomic copies were measured by real-time quantitative <t>PCR.</t> Results represent the mean ± SD of triplicate experiments. *** P
    Quantitect Probe Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 196 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitect probe pcr kit/product/Qiagen
    Average 93 stars, based on 196 article reviews
    Price from $9.99 to $1999.99
    quantitect probe pcr kit - by Bioz Stars, 2020-10
    93/100 stars
      Buy from Supplier

    Image Search Results


    Upregulation of interferon signaling pathways. (A) Pathway image from IPA core analysis illustrating gene expression associated with interferon signaling. (B) The molecular activity prediction (MAP) tool indicates the potential outcomes of activating the interferon signaling. The color intensity indicates the degree of upregulation (red). Predicted activation (orange), inhibition (blue), and unknown association (yellow) are also shown. Gray indicates molecules that were present in the data set but did not pass the cutoff values of a false discovery rate (FDR) of ≤0.05 and a log 2 fold change (FC) of either ≥1 or ≤−1. (C) Individual populations (red and yellow) were sorted, and STAT1 gene expression was measured by RT-PCR at 2 weeks postinfection. Data are mean fold changes ± standard error of mean (SEM) compared to D116A-infected cells. Data are cumulative for three individual astrocyte donors. Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*, P

    Journal: Journal of Virology

    Article Title: Insights into the Gene Expression Profiles of Active and Restricted Red/Green-HIV+ Human Astrocytes: Implications for Shock or Lock Therapies in the Brain

    doi: 10.1128/JVI.01563-19

    Figure Lengend Snippet: Upregulation of interferon signaling pathways. (A) Pathway image from IPA core analysis illustrating gene expression associated with interferon signaling. (B) The molecular activity prediction (MAP) tool indicates the potential outcomes of activating the interferon signaling. The color intensity indicates the degree of upregulation (red). Predicted activation (orange), inhibition (blue), and unknown association (yellow) are also shown. Gray indicates molecules that were present in the data set but did not pass the cutoff values of a false discovery rate (FDR) of ≤0.05 and a log 2 fold change (FC) of either ≥1 or ≤−1. (C) Individual populations (red and yellow) were sorted, and STAT1 gene expression was measured by RT-PCR at 2 weeks postinfection. Data are mean fold changes ± standard error of mean (SEM) compared to D116A-infected cells. Data are cumulative for three individual astrocyte donors. Statistical analyses were performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons (*, P

    Article Snippet: The upregulation of interferon signaling in both populations was also confirmed by measuring the mRNA levels of the key transcription factor STAT1 in both populations by reverse transcription-PCR (RT-PCR) ( ).

    Techniques: Indirect Immunoperoxidase Assay, Expressing, Activity Assay, Activation Assay, Inhibition, Reverse Transcription Polymerase Chain Reaction, Infection

    Subunits of system x C − are expressed in glioma cell lines and patient tumor samples. A , RT-PCR indicated that transcripts of catalytic subunit xCT and the regulatory subunit 4F2hc of system x C − are expressed in primary cultures of rat

    Journal:

    Article Title: Autocrine Glutamate Signaling Promotes Glioma Cell Invasion

    doi: 10.1158/0008-5472.CAN-07-2034

    Figure Lengend Snippet: Subunits of system x C − are expressed in glioma cell lines and patient tumor samples. A , RT-PCR indicated that transcripts of catalytic subunit xCT and the regulatory subunit 4F2hc of system x C − are expressed in primary cultures of rat

    Article Snippet: For the detection of xCT, 4F2hc, and actin RNA transcripts, OneStep reverse transcription-PCR (RT-PCR) kit was used according to manufacturer’s instructions.

    Techniques: Reverse Transcription Polymerase Chain Reaction

    Cancer cell killing effect and viral replication of oAd/RLX-PCDP complex-loaded hMSCs on various pancreatic cancer cells. (A) Oncolytic effect by PBS, naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded or oAd/RLX-PCDP-loaded hMSCs at various MOIs. After 4 (AsPC-1 and PANC-1) or 6 (MIA PaCa-2) days post-infection, cell viability was measured by MTT assay. For oAd/RLX groups, the cell viability solely accounts for the absorbance readout of respective cancer cell types. For oAd/RLX- and oAd/RLX-PCDP-loaded hMSC groups, the total cell viability (as determined by absorbance readout) accounts for both respective types of pancreatic cancer cells and surviving hMSC carrier. (B) Viral production. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. At 72 h post-infection, viral genomic copies were measured by real-time quantitative PCR. Results represent the mean ± SD of triplicate experiments. *** P

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Systemic administration of human mesenchymal stromal cells infected with polymer-coated oncolytic adenovirus induces efficient pancreatic tumor homing and infiltration

    doi: 10.1016/j.jconrel.2019.04.040

    Figure Lengend Snippet: Cancer cell killing effect and viral replication of oAd/RLX-PCDP complex-loaded hMSCs on various pancreatic cancer cells. (A) Oncolytic effect by PBS, naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded or oAd/RLX-PCDP-loaded hMSCs at various MOIs. After 4 (AsPC-1 and PANC-1) or 6 (MIA PaCa-2) days post-infection, cell viability was measured by MTT assay. For oAd/RLX groups, the cell viability solely accounts for the absorbance readout of respective cancer cell types. For oAd/RLX- and oAd/RLX-PCDP-loaded hMSC groups, the total cell viability (as determined by absorbance readout) accounts for both respective types of pancreatic cancer cells and surviving hMSC carrier. (B) Viral production. Cells (AsPC-1, PANC-1, and MIA PaCa-2) were infected with naked oAd/RLX, oAd/RLX-loaded hMSCs, or oAd/RLX-PCDP-loaded hMSCs. At 72 h post-infection, viral genomic copies were measured by real-time quantitative PCR. Results represent the mean ± SD of triplicate experiments. *** P

    Article Snippet: Ad biodistribution profile for oAd/RLX, oAd/RLX-loaded hMSC, or oAd/RLX-PCDP-loaded hMSC was analyzed by quantitative realtime PCR (qPCR) using Ad protein IX-specific primer set and TaqMan probe as described previously [ ]. hMSC biodistribution profile for hMSC, oAd/RLX-loaded hMSC, or oAd/RLX-PCDP-loaded hMSC groups were analyzed using SYBR Green-based human Alu primer set (for the detection of hMSC in tissues) and assay protocol described elsewhere [ ].

    Techniques: Infection, MTT Assay, Real-time Polymerase Chain Reaction

    Viral replication and Relaxin production of oncolytic Ad/RLX-PCDP complex in hMSCs. (A) Viral production by oAd/RLX-PCDP in hMSCs. hMSC cells were infected with naked oAd/RLX, or oAd/RLX-PCDP at various MOIs. After 4 and 8 days post-infection, viral genomic copies was measured by real-time quantitative PCR. (B) Cytotoxicity of oncolytic Ad-PCDP complex in hMSCs. hMSC cells were treated with PCDP, naked oAd/RLX, or oAd/RLX-PCDP at various MOIs. After 4 and 8 days after infection, cell viability was measured by MTT assay. Data presented as mean ± SD. (C) Relaxin expression levels of oAd/RLX-PCDP in hMSCs. hMSC cells were infected with PBS, naked oAd/RLX, or oAd/RLX-PCDP at various MOIs between 0 and 50. Relaxin concentration in the culture supernatant was measured by ELISA assay at 7 days post-infection. The data represent the mean ± SD of triplicates that are representative of 3 independent experiments. * P

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Systemic administration of human mesenchymal stromal cells infected with polymer-coated oncolytic adenovirus induces efficient pancreatic tumor homing and infiltration

    doi: 10.1016/j.jconrel.2019.04.040

    Figure Lengend Snippet: Viral replication and Relaxin production of oncolytic Ad/RLX-PCDP complex in hMSCs. (A) Viral production by oAd/RLX-PCDP in hMSCs. hMSC cells were infected with naked oAd/RLX, or oAd/RLX-PCDP at various MOIs. After 4 and 8 days post-infection, viral genomic copies was measured by real-time quantitative PCR. (B) Cytotoxicity of oncolytic Ad-PCDP complex in hMSCs. hMSC cells were treated with PCDP, naked oAd/RLX, or oAd/RLX-PCDP at various MOIs. After 4 and 8 days after infection, cell viability was measured by MTT assay. Data presented as mean ± SD. (C) Relaxin expression levels of oAd/RLX-PCDP in hMSCs. hMSC cells were infected with PBS, naked oAd/RLX, or oAd/RLX-PCDP at various MOIs between 0 and 50. Relaxin concentration in the culture supernatant was measured by ELISA assay at 7 days post-infection. The data represent the mean ± SD of triplicates that are representative of 3 independent experiments. * P

    Article Snippet: Ad biodistribution profile for oAd/RLX, oAd/RLX-loaded hMSC, or oAd/RLX-PCDP-loaded hMSC was analyzed by quantitative realtime PCR (qPCR) using Ad protein IX-specific primer set and TaqMan probe as described previously [ ]. hMSC biodistribution profile for hMSC, oAd/RLX-loaded hMSC, or oAd/RLX-PCDP-loaded hMSC groups were analyzed using SYBR Green-based human Alu primer set (for the detection of hMSC in tissues) and assay protocol described elsewhere [ ].

    Techniques: Infection, Real-time Polymerase Chain Reaction, MTT Assay, Expressing, Concentration Assay, Enzyme-linked Immunosorbent Assay