204054 quantifast sybr green pcr kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    QuantiFast SYBR Green PCR Kit
    Description:
    For fast real time PCR and two step qRT PCR using SYBR Green Kit contents Qiagen QuantiFast SYBR Green PCR Kit 400 x 25L rxns SYBR Green I cDNA and DNA Sample Real time and two step RT PCR Reaction Q bond Technology For use in Gene Expression Analysis of cDNA Targets and Quantitative gDNA Analysis Delivers Fast and Specific Quantification of gDNA or cDNA Targets Includes 3 x 1 7mL 2x QuantiFast SYBR Green PCR Master Mix Contains ROX Dye 2 x 2mL RNase free Water Benefits Specific and sensitive detection of even low copy targets Optimized master mix for reliable results without optimization 5 minute enzyme activation and fast cycling conditions Accurate detection of a wide range of template amounts Universal protocol for all standard and fast cycl
    Catalog Number:
    204054
    Price:
    449
    Category:
    QuantiFast SYBR Green PCR Kit
    Buy from Supplier


    Structured Review

    Qiagen 204054 quantifast sybr green pcr kit
    QuantiFast SYBR Green PCR Kit
    For fast real time PCR and two step qRT PCR using SYBR Green Kit contents Qiagen QuantiFast SYBR Green PCR Kit 400 x 25L rxns SYBR Green I cDNA and DNA Sample Real time and two step RT PCR Reaction Q bond Technology For use in Gene Expression Analysis of cDNA Targets and Quantitative gDNA Analysis Delivers Fast and Specific Quantification of gDNA or cDNA Targets Includes 3 x 1 7mL 2x QuantiFast SYBR Green PCR Master Mix Contains ROX Dye 2 x 2mL RNase free Water Benefits Specific and sensitive detection of even low copy targets Optimized master mix for reliable results without optimization 5 minute enzyme activation and fast cycling conditions Accurate detection of a wide range of template amounts Universal protocol for all standard and fast cycl
    https://www.bioz.com/result/204054 quantifast sybr green pcr kit/product/Qiagen
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    204054 quantifast sybr green pcr kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: Validation of microarray by real-time qRT-PCR To validate the results of microarray analysis, the differential expression of representative genes in the microarray analysis was confirmed using the same RNA samples that were used for microarray, by qRT-PCR amplification. .. For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction.

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: The specific primer pairs used for PCR amplification are listed in . .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested.

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: The cDNA was subjected to real-time PCR using primers specific for the RL ORF (Fwd: 5′-ATCGGACCCAGGATTCTTTT-3′; Rev: 5′-ACTCGCTCAACGAACGATTT-3′), which amplified nucleotides 768–917 (amplicon length 150 nt), and primers specific for Gallus gallus β-actin (Fwd: 5′-AGCAACATGTGTGACGAGGA-3′; Rev: 5′-ACCCCACCCTGCTCACTGA-3′), which amplified nucleotides 7–339 (amplicon length 333 nt). .. The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl.

    Synthesized:

    Article Title: Prognostic impact of MutT homolog‐1 expression on esophageal squamous cell carcinoma
    Article Snippet: Complementary DNA was synthesized from 1 μ g total RNA using High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). .. Quantitative PCR was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and LightCycler 480 II (Roche Diagnostics, Basel, Switzerland).

    Quantitative RT-PCR:

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: .. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen). .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Article Title: Fetal microglial phenotype in vitro carries memory of prior in vivo exposure to inflammation
    Article Snippet: .. HMOX1 and FBP mRNA were quantified by qRT-PCR using a QuantiFast SYBR Green PCR Kit (Qiagen) with STRATAGENE 3000 P, mRNA relative expression was calculated by the 2−ΔΔCt method over housekeeping gene GAPDH compared to baseline (Livak and Schmittgen, ). .. Sheep specific HMOX1 primers were designed with primer3 (Untergasser et al., ) and FBP primers were designed using Integrated DNA Technologies online tool and listed in Table .

    Article Title: Expression of D-Amino Acid Oxidase (DAO/DAAO) and D-Amino Acid Oxidase Activator (DAOA/G72) during Development and Aging in the Human Post-mortem Brain
    Article Snippet: .. In a subset of samples, negative controls were prepared with RNA without reverse transcriptase enzyme. qRT-PCR was performed using cDNA, QuantiFast SYBR Green PCR kit (Qiagen, Switzerland), 1 μM forward and reverse DAO primers (Microsynth, Switzerland), and reference genes [β-actin (ACTB ) (QT01680476), aminolevulinate synthetase (ALAS1 ) (QT00073122), ribosomal protein L13a (RPL13A ) (QT00089915), alanyl-tRNA synthetase (AARS ) (QT00054747), glyceraldehyde-3-phosphate dehydrogenase (GAPDH ) (QT01192646), peptidylprolyl isomerase A (PPIA ) (QT00866137), ribosomal RNA (R18S ) (QT00019936), and X-prolyl aminopeptidase 1 (XPNPEP1 ) (QT00051471); all from Qiagen, Switzerland]. ..

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: Paragraph title: RNA isolation and real-time RT-PCR ... Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit.

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: Paragraph title: Validation of microarray by real-time qRT-PCR ... For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction.

    Article Title: Effect of microRNA-133a-3p/matrix metalloproteinase-9 axis on the growth of atherosclerotic vascular smooth muscle cells
    Article Snippet: Paragraph title: RT-qPCR ... The temperature protocol for the reverse transcription reaction was as follows: 25°C for 5 min, 42°C for 60 min and 80°C for 2 min. PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen GmbH).

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: Paragraph title: RNA extraction and qRT–PCR ... The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl.

    Article Title: Prognostic impact of MutT homolog‐1 expression on esophageal squamous cell carcinoma
    Article Snippet: Quantitative reverse transcription‐PCR For quantitative reverse transcription‐PCR (qRT‐PCR), total RNA was extracted from each cell line using RNeasy Mini Kit (Qiagen, Hilden, Germany) or from the clinical specimens of 47 patients with ESCC (normal epithelium and cancerous region) using Trizol (Thermo Fisher Scientific, Waltham, MA, USA). .. Quantitative PCR was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and LightCycler 480 II (Roche Diagnostics, Basel, Switzerland).

    SYBR Green Assay:

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: .. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen). .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Article Title: Agnoprotein Is an Essential Egress Factor during BK Polyomavirus Infection
    Article Snippet: .. Quantitative Real-time PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen) and specific primers against VP1. .. The PCR reaction was carried out on a Corbett Rotor-Gene 6000 (Qiagen) following three different steps.

    Article Title: Fetal microglial phenotype in vitro carries memory of prior in vivo exposure to inflammation
    Article Snippet: .. HMOX1 and FBP mRNA were quantified by qRT-PCR using a QuantiFast SYBR Green PCR Kit (Qiagen) with STRATAGENE 3000 P, mRNA relative expression was calculated by the 2−ΔΔCt method over housekeeping gene GAPDH compared to baseline (Livak and Schmittgen, ). .. Sheep specific HMOX1 primers were designed with primer3 (Untergasser et al., ) and FBP primers were designed using Integrated DNA Technologies online tool and listed in Table .

    Article Title: Expression of D-Amino Acid Oxidase (DAO/DAAO) and D-Amino Acid Oxidase Activator (DAOA/G72) during Development and Aging in the Human Post-mortem Brain
    Article Snippet: .. In a subset of samples, negative controls were prepared with RNA without reverse transcriptase enzyme. qRT-PCR was performed using cDNA, QuantiFast SYBR Green PCR kit (Qiagen, Switzerland), 1 μM forward and reverse DAO primers (Microsynth, Switzerland), and reference genes [β-actin (ACTB ) (QT01680476), aminolevulinate synthetase (ALAS1 ) (QT00073122), ribosomal protein L13a (RPL13A ) (QT00089915), alanyl-tRNA synthetase (AARS ) (QT00054747), glyceraldehyde-3-phosphate dehydrogenase (GAPDH ) (QT01192646), peptidylprolyl isomerase A (PPIA ) (QT00866137), ribosomal RNA (R18S ) (QT00019936), and X-prolyl aminopeptidase 1 (XPNPEP1 ) (QT00051471); all from Qiagen, Switzerland]. ..

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: .. Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit. .. QIAGEN QuantiTect Primer Assays were used to determine gene expression of Egr-1 (Hs_Egr1_2_SG), HO-1 (Hs_HMOX1_1_SG), and glyceraldehyde-3-phosphate dehydrogenase (Hs_GAPDH_2_SG), respectively.

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: .. For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction. .. The following primers (10 pmol/µL) were designed using Primer 3 software (23) and used for qRT-PCR: Agtr1 sense ( CCATCGTCCACCCAATGAAG ) and antisense ( GTGACTTTGGCCACCAGCAT ), Agtr2 sense ( AATTACCCGTGACCAAGTCTTG ) and antisense ( ATACCCATCCAGGTCAGAGCAT ), Prkca sense ( ATGCTCATGTTTCCAGTCTGC ) and antisense ( CTGATAGAGTGCCAGTGTGTGG ), Agtrap sense ( CAAAGAAGACAAGAAGCCCAAG ) and antisense ( AGCGCTCTACCACTGAGCTAAA ), Map2k4 sense ( GTGGACAGCTCGTGGACTCTAT ) and antisense ( TCATACCCTTGTCTTGATGCAC ), Hbegf sense ( GGAGAGTGCAGATACCTGAAGGA ) and antisense ( GTCAGCCCATGACACCTCTGT ), Ctgf sense ( AAGAAGACTCAGCCAGACC ) and antisense ( AGAGGAGGAGCACCAAGG ), Nlrp3 sense ( CAGACCTCCAAGACCACGACTG ) and antisense ( CATCCGCAGCCAATGAACAGAG ), Bcar1 sense ( GCACACAGCAAGTTTGTCATTC ) and antisense ( GCTGTAGTGGGTCACTTTGCTT ), Aqp2 sense ( CTGGTGCTGTGCATCTTTGC ) and antisense ( ATGGAGCAACCGGTGAAAT ), Lamb1 sense ( GCGTAAAGCTGCCCAGAACTCTG ) and antisense ( TCCTCCTGGCATCTGCTGACTC ), Vegfa sense ( GCCCATGAAGTGGTGAAGTT ) and antisense ( TATGTGCTGGCTTTGGTGAG ), and Gapdh sense ( GACATGCCGCCTGGAGAAAC ) and antisense ( AGCCCAGGATGCCCTTTAGT ), this last used as a housekeeping gene.

    Article Title: Effect of microRNA-133a-3p/matrix metalloproteinase-9 axis on the growth of atherosclerotic vascular smooth muscle cells
    Article Snippet: .. The temperature protocol for the reverse transcription reaction was as follows: 25°C for 5 min, 42°C for 60 min and 80°C for 2 min. PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen GmbH). ..

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested. ..

    Article Title: Preferential Targeting of Disseminated Liver Tumors Using a Recombinant Adeno-Associated Viral Vector
    Article Snippet: .. A qPCR assay SYBR Green (QuantiFast SYBR Green PCR Kit; Quiagen) was used to evaluate the biodistribution of rAAV8 vectors in genomic DNA using the following primers: HLP forward 5′-CAGGACGCTGTGGTTTCTG-3′ and reverse 5′-TGCCTGAAGCTGAGGAGAC-3′; GAPDH forward 5′-GGAGTCCACTGGCGTCTTCAC-3′ and reverse 5′-GAGGCATTGCTGATGATCTTGAGG-3′. .. Data analysis was performed using unpaired and one-sample t -test (GraphPad Software Inc.). p < 0.05 was considered statistically significant.

    Article Title: The N terminus of Ascl1 underlies differing proneural activity of mouse andXenopus Ascl1 proteins
    Article Snippet: .. Whole embryo RNA was extracted using the RNeasy® Mini kit (Qiagen) and template cDNAs synthesised with the QuantiTect® Reverse Transcription Kit (Qiagen). qPCR was performed using the Quantifast® SYBR Green PCR kit (Qiagen) in a LightCycler® ): Forward, TGGATTTGGAACCAGGCA; Reverse, GCTCAGCTCCTTCGGTGTA. .. For western blot analysis, 12 embryos were snap frozen at stage 12.5 and whole embryo protein was extracted as described in .

    Article Title: Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death
    Article Snippet: .. Quantitative real-time PCR (qPCR) analysis was performed in triplicate using QuantiFast™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany). .. All gene-specific mRNA expression values were compared to β-actin mRNA levels as a standard.

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: .. The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl. .. The reaction, with an amplification protocol of a 5-min hot start at 95°C followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s, was performed using the MX3000p thermocycler (Stratagene) and analyzed using MxPro software (Stratagene).

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: .. Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen). .. NKX2‐5 gene expression was normalized against the expression of the β‐actin gene or the TATA box binding protein, as indicated below.

    Article Title: Prognostic impact of MutT homolog‐1 expression on esophageal squamous cell carcinoma
    Article Snippet: .. Quantitative PCR was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and LightCycler 480 II (Roche Diagnostics, Basel, Switzerland). .. Relative expression of MTH1 mRNA was normalized to that of β‐actin mRNA.

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: .. Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA). .. Three viable lines ( line 4 , line 52 , and line 53 ) were generated from independent founders.

    Microarray:

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: Paragraph title: Validation of microarray by real-time qRT-PCR ... For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction.

    Incubation:

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: For cDNA synthesis, an aliquot of 0,5 µg of total RNA from each sample was incubated with 1 µL of Oligo(dT) 0,05 µg/µL, 1 µL de SuperScript II Reverse Transcriptase and completed with 20 µL of DEPC treated water. .. For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen). .. Immunohistochemistry was performed on formalin‐fixed paraffin‐embedded tissue.

    Expressing:

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: Paragraph title: Elovl2 and Elovl5 expression levels ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen).

    Article Title: Fetal microglial phenotype in vitro carries memory of prior in vivo exposure to inflammation
    Article Snippet: .. HMOX1 and FBP mRNA were quantified by qRT-PCR using a QuantiFast SYBR Green PCR Kit (Qiagen) with STRATAGENE 3000 P, mRNA relative expression was calculated by the 2−ΔΔCt method over housekeeping gene GAPDH compared to baseline (Livak and Schmittgen, ). .. Sheep specific HMOX1 primers were designed with primer3 (Untergasser et al., ) and FBP primers were designed using Integrated DNA Technologies online tool and listed in Table .

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: .. Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit. .. QIAGEN QuantiTect Primer Assays were used to determine gene expression of Egr-1 (Hs_Egr1_2_SG), HO-1 (Hs_HMOX1_1_SG), and glyceraldehyde-3-phosphate dehydrogenase (Hs_GAPDH_2_SG), respectively.

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: Validation of microarray by real-time qRT-PCR To validate the results of microarray analysis, the differential expression of representative genes in the microarray analysis was confirmed using the same RNA samples that were used for microarray, by qRT-PCR amplification. .. For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction.

    Article Title: Effect of microRNA-133a-3p/matrix metalloproteinase-9 axis on the growth of atherosclerotic vascular smooth muscle cells
    Article Snippet: The temperature protocol for the reverse transcription reaction was as follows: 25°C for 5 min, 42°C for 60 min and 80°C for 2 min. PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen GmbH). .. The relative expression levels of genes were calculated using the 2−ΔΔCq method ( ).

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: Paragraph title: Gene expression analysis ... For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested.

    Article Title: The N terminus of Ascl1 underlies differing proneural activity of mouse andXenopus Ascl1 proteins
    Article Snippet: GFP expression was used to confirm successful injection and samples of four embryos were snap frozen. .. Whole embryo RNA was extracted using the RNeasy® Mini kit (Qiagen) and template cDNAs synthesised with the QuantiTect® Reverse Transcription Kit (Qiagen). qPCR was performed using the Quantifast® SYBR Green PCR kit (Qiagen) in a LightCycler® ): Forward, TGGATTTGGAACCAGGCA; Reverse, GCTCAGCTCCTTCGGTGTA.

    Article Title: Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed in triplicate using QuantiFast™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany). .. All gene-specific mRNA expression values were compared to β-actin mRNA levels as a standard.

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl. .. Relative gene expression normalized to β -Actin expression was calculated using the ΔΔCT method ( ).

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen). .. NKX2‐5 gene expression was normalized against the expression of the β‐actin gene or the TATA box binding protein, as indicated below.

    Article Title: Prognostic impact of MutT homolog‐1 expression on esophageal squamous cell carcinoma
    Article Snippet: Quantitative PCR was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and LightCycler 480 II (Roche Diagnostics, Basel, Switzerland). .. Relative expression of MTH1 mRNA was normalized to that of β‐actin mRNA.

    Western Blot:

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: Elovl2 and Elovl5 expression levels Dark Agouti rats consumed a fat free AIN-93G rodent diet (Glen Forrest Stockfeeders, Glen Forrest, Western Australia) blended with flaxseed oil to obtain 1%en ALA and 2.1%en LA, to a level of 5% (w/w) fat. .. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen).

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: Cell lysates were subjected to SDS‐PAGE and Western blotting. .. Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen).

    Over Expression:

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: Paragraph title: Generation of transgenic mice with cardiac overexpression of wild-type mTOR. ... Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA).

    Activation Assay:

    Article Title: Agnoprotein Is an Essential Egress Factor during BK Polyomavirus Infection
    Article Snippet: Quantitative Real-time PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen) and specific primers against VP1. .. The initial activation step for 10 min at 95 °C and a three-step cycle of denaturation of 10 s at 95 °C; the second step of annealing for 15 s at 60 °C and the step of extension for 20 s at 72 °C.

    Cell Culture:

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: Gene expression analysis Total RNA from cultured spermatogonia, testis, brain, and spinal cord was isolated using the RNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions. cDNA was transcribed using RevertAid H Minus M-MuLV reverse transcription (Fermentas) according to the manufacturer’s instructions. .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested.

    Generated:

    Article Title: Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death
    Article Snippet: Complementary DNA (cDNA) was generated from total RNA using random primer and MMLV reverse transcriptase (Invitrogen), using a final volume of 20 μl. .. Quantitative real-time PCR (qPCR) analysis was performed in triplicate using QuantiFast™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany).

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA). .. Three viable lines ( line 4 , line 52 , and line 53 ) were generated from independent founders.

    Polymerase Chain Reaction:

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: .. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen). .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Article Title: Agnoprotein Is an Essential Egress Factor during BK Polyomavirus Infection
    Article Snippet: .. Quantitative Real-time PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen) and specific primers against VP1. .. The PCR reaction was carried out on a Corbett Rotor-Gene 6000 (Qiagen) following three different steps.

    Article Title: Fetal microglial phenotype in vitro carries memory of prior in vivo exposure to inflammation
    Article Snippet: .. HMOX1 and FBP mRNA were quantified by qRT-PCR using a QuantiFast SYBR Green PCR Kit (Qiagen) with STRATAGENE 3000 P, mRNA relative expression was calculated by the 2−ΔΔCt method over housekeeping gene GAPDH compared to baseline (Livak and Schmittgen, ). .. Sheep specific HMOX1 primers were designed with primer3 (Untergasser et al., ) and FBP primers were designed using Integrated DNA Technologies online tool and listed in Table .

    Article Title: Expression of D-Amino Acid Oxidase (DAO/DAAO) and D-Amino Acid Oxidase Activator (DAOA/G72) during Development and Aging in the Human Post-mortem Brain
    Article Snippet: .. In a subset of samples, negative controls were prepared with RNA without reverse transcriptase enzyme. qRT-PCR was performed using cDNA, QuantiFast SYBR Green PCR kit (Qiagen, Switzerland), 1 μM forward and reverse DAO primers (Microsynth, Switzerland), and reference genes [β-actin (ACTB ) (QT01680476), aminolevulinate synthetase (ALAS1 ) (QT00073122), ribosomal protein L13a (RPL13A ) (QT00089915), alanyl-tRNA synthetase (AARS ) (QT00054747), glyceraldehyde-3-phosphate dehydrogenase (GAPDH ) (QT01192646), peptidylprolyl isomerase A (PPIA ) (QT00866137), ribosomal RNA (R18S ) (QT00019936), and X-prolyl aminopeptidase 1 (XPNPEP1 ) (QT00051471); all from Qiagen, Switzerland]. ..

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: .. Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit. .. QIAGEN QuantiTect Primer Assays were used to determine gene expression of Egr-1 (Hs_Egr1_2_SG), HO-1 (Hs_HMOX1_1_SG), and glyceraldehyde-3-phosphate dehydrogenase (Hs_GAPDH_2_SG), respectively.

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: .. For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction. .. The following primers (10 pmol/µL) were designed using Primer 3 software (23) and used for qRT-PCR: Agtr1 sense ( CCATCGTCCACCCAATGAAG ) and antisense ( GTGACTTTGGCCACCAGCAT ), Agtr2 sense ( AATTACCCGTGACCAAGTCTTG ) and antisense ( ATACCCATCCAGGTCAGAGCAT ), Prkca sense ( ATGCTCATGTTTCCAGTCTGC ) and antisense ( CTGATAGAGTGCCAGTGTGTGG ), Agtrap sense ( CAAAGAAGACAAGAAGCCCAAG ) and antisense ( AGCGCTCTACCACTGAGCTAAA ), Map2k4 sense ( GTGGACAGCTCGTGGACTCTAT ) and antisense ( TCATACCCTTGTCTTGATGCAC ), Hbegf sense ( GGAGAGTGCAGATACCTGAAGGA ) and antisense ( GTCAGCCCATGACACCTCTGT ), Ctgf sense ( AAGAAGACTCAGCCAGACC ) and antisense ( AGAGGAGGAGCACCAAGG ), Nlrp3 sense ( CAGACCTCCAAGACCACGACTG ) and antisense ( CATCCGCAGCCAATGAACAGAG ), Bcar1 sense ( GCACACAGCAAGTTTGTCATTC ) and antisense ( GCTGTAGTGGGTCACTTTGCTT ), Aqp2 sense ( CTGGTGCTGTGCATCTTTGC ) and antisense ( ATGGAGCAACCGGTGAAAT ), Lamb1 sense ( GCGTAAAGCTGCCCAGAACTCTG ) and antisense ( TCCTCCTGGCATCTGCTGACTC ), Vegfa sense ( GCCCATGAAGTGGTGAAGTT ) and antisense ( TATGTGCTGGCTTTGGTGAG ), and Gapdh sense ( GACATGCCGCCTGGAGAAAC ) and antisense ( AGCCCAGGATGCCCTTTAGT ), this last used as a housekeeping gene.

    Article Title: Effect of microRNA-133a-3p/matrix metalloproteinase-9 axis on the growth of atherosclerotic vascular smooth muscle cells
    Article Snippet: .. The temperature protocol for the reverse transcription reaction was as follows: 25°C for 5 min, 42°C for 60 min and 80°C for 2 min. PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen GmbH). ..

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested. ..

    Article Title: Preferential Targeting of Disseminated Liver Tumors Using a Recombinant Adeno-Associated Viral Vector
    Article Snippet: .. A qPCR assay SYBR Green (QuantiFast SYBR Green PCR Kit; Quiagen) was used to evaluate the biodistribution of rAAV8 vectors in genomic DNA using the following primers: HLP forward 5′-CAGGACGCTGTGGTTTCTG-3′ and reverse 5′-TGCCTGAAGCTGAGGAGAC-3′; GAPDH forward 5′-GGAGTCCACTGGCGTCTTCAC-3′ and reverse 5′-GAGGCATTGCTGATGATCTTGAGG-3′. .. Data analysis was performed using unpaired and one-sample t -test (GraphPad Software Inc.). p < 0.05 was considered statistically significant.

    Article Title: The N terminus of Ascl1 underlies differing proneural activity of mouse andXenopus Ascl1 proteins
    Article Snippet: .. Whole embryo RNA was extracted using the RNeasy® Mini kit (Qiagen) and template cDNAs synthesised with the QuantiTect® Reverse Transcription Kit (Qiagen). qPCR was performed using the Quantifast® SYBR Green PCR kit (Qiagen) in a LightCycler® ): Forward, TGGATTTGGAACCAGGCA; Reverse, GCTCAGCTCCTTCGGTGTA. .. For western blot analysis, 12 embryos were snap frozen at stage 12.5 and whole embryo protein was extracted as described in .

    Article Title: Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death
    Article Snippet: .. Quantitative real-time PCR (qPCR) analysis was performed in triplicate using QuantiFast™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany). .. All gene-specific mRNA expression values were compared to β-actin mRNA levels as a standard.

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: .. The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl. .. The reaction, with an amplification protocol of a 5-min hot start at 95°C followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s, was performed using the MX3000p thermocycler (Stratagene) and analyzed using MxPro software (Stratagene).

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: .. Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen). .. NKX2‐5 gene expression was normalized against the expression of the β‐actin gene or the TATA box binding protein, as indicated below.

    Article Title: Prognostic impact of MutT homolog‐1 expression on esophageal squamous cell carcinoma
    Article Snippet: .. Quantitative PCR was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and LightCycler 480 II (Roche Diagnostics, Basel, Switzerland). .. Relative expression of MTH1 mRNA was normalized to that of β‐actin mRNA.

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: .. Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA). .. Three viable lines ( line 4 , line 52 , and line 53 ) were generated from independent founders.

    Injection:

    Article Title: The N terminus of Ascl1 underlies differing proneural activity of mouse andXenopus Ascl1 proteins
    Article Snippet: GFP expression was used to confirm successful injection and samples of four embryos were snap frozen. .. Whole embryo RNA was extracted using the RNeasy® Mini kit (Qiagen) and template cDNAs synthesised with the QuantiTect® Reverse Transcription Kit (Qiagen). qPCR was performed using the Quantifast® SYBR Green PCR kit (Qiagen) in a LightCycler® ): Forward, TGGATTTGGAACCAGGCA; Reverse, GCTCAGCTCCTTCGGTGTA.

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: The cDNA encoding hemagglutinin (HA)-tagged wild-type rat mTOR was subcloned downstream of the murine α-myosin heavy chain (α-MHC) promoter (generous gift of Dr. Jeffrey Robbins, Cincinnati Children's Hospital Research Foundation) and used to generate transgenic mice through oocyte injection as performed previously ( ). .. Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA).

    Binding Assay:

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen). .. NKX2‐5 gene expression was normalized against the expression of the β‐actin gene or the TATA box binding protein, as indicated below.

    Cellular Antioxidant Activity Assay:

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit. .. For detection of Nrf2 gene expression the following primer pair was used: forward 5′-TAC TCC CAG GTT GCC CAC A-3′ and reverse 5′-CAT CTA CAA ACG GGA ATG TCT GC-3′.

    Isolation:

    Article Title: Expression of D-Amino Acid Oxidase (DAO/DAAO) and D-Amino Acid Oxidase Activator (DAOA/G72) during Development and Aging in the Human Post-mortem Brain
    Article Snippet: Quantification of DAO and DAOA mRNA Levels Using qRT-PCR RNA isolated from post-mortem human cerebellum (n = 44), brainstem (n = 40), amygdala (n = 39), striatum (n = 35), thalamus (n = 37), and frontal cortex (n = 36) were used for quantitative real-time reverse transcription-PCR (qRT-PCR). .. In a subset of samples, negative controls were prepared with RNA without reverse transcriptase enzyme. qRT-PCR was performed using cDNA, QuantiFast SYBR Green PCR kit (Qiagen, Switzerland), 1 μM forward and reverse DAO primers (Microsynth, Switzerland), and reference genes [β-actin (ACTB ) (QT01680476), aminolevulinate synthetase (ALAS1 ) (QT00073122), ribosomal protein L13a (RPL13A ) (QT00089915), alanyl-tRNA synthetase (AARS ) (QT00054747), glyceraldehyde-3-phosphate dehydrogenase (GAPDH ) (QT01192646), peptidylprolyl isomerase A (PPIA ) (QT00866137), ribosomal RNA (R18S ) (QT00019936), and X-prolyl aminopeptidase 1 (XPNPEP1 ) (QT00051471); all from Qiagen, Switzerland].

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: Paragraph title: RNA isolation and real-time RT-PCR ... Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit.

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: Gene expression analysis Total RNA from cultured spermatogonia, testis, brain, and spinal cord was isolated using the RNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions. cDNA was transcribed using RevertAid H Minus M-MuLV reverse transcription (Fermentas) according to the manufacturer’s instructions. .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested.

    Purification:

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: Reverse transcription reactions used 0.25 or 0.5 μg of purified total RNA in a final volume of 10 μl. .. The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: .. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen). .. Each reaction contained 10 ng of cDNA, 5 µl QuantiFast™ SYBR® Green PCR master mix and 1 µl of QuantiTect® Primer Assay (Qiagen), in a total volume of 10 µl.

    Mouse Assay:

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: Paragraph title: Generation of transgenic mice with cardiac overexpression of wild-type mTOR. ... Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA).

    SDS Page:

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: Cell lysates were subjected to SDS‐PAGE and Western blotting. .. Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen).

    Plasmid Preparation:

    Article Title: Preferential Targeting of Disseminated Liver Tumors Using a Recombinant Adeno-Associated Viral Vector
    Article Snippet: Paragraph title: Vector distribution ... A qPCR assay SYBR Green (QuantiFast SYBR Green PCR Kit; Quiagen) was used to evaluate the biodistribution of rAAV8 vectors in genomic DNA using the following primers: HLP forward 5′-CAGGACGCTGTGGTTTCTG-3′ and reverse 5′-TGCCTGAAGCTGAGGAGAC-3′; GAPDH forward 5′-GGAGTCCACTGGCGTCTTCAC-3′ and reverse 5′-GAGGCATTGCTGATGATCTTGAGG-3′.

    Software:

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction. .. The following primers (10 pmol/µL) were designed using Primer 3 software (23) and used for qRT-PCR: Agtr1 sense ( CCATCGTCCACCCAATGAAG ) and antisense ( GTGACTTTGGCCACCAGCAT ), Agtr2 sense ( AATTACCCGTGACCAAGTCTTG ) and antisense ( ATACCCATCCAGGTCAGAGCAT ), Prkca sense ( ATGCTCATGTTTCCAGTCTGC ) and antisense ( CTGATAGAGTGCCAGTGTGTGG ), Agtrap sense ( CAAAGAAGACAAGAAGCCCAAG ) and antisense ( AGCGCTCTACCACTGAGCTAAA ), Map2k4 sense ( GTGGACAGCTCGTGGACTCTAT ) and antisense ( TCATACCCTTGTCTTGATGCAC ), Hbegf sense ( GGAGAGTGCAGATACCTGAAGGA ) and antisense ( GTCAGCCCATGACACCTCTGT ), Ctgf sense ( AAGAAGACTCAGCCAGACC ) and antisense ( AGAGGAGGAGCACCAAGG ), Nlrp3 sense ( CAGACCTCCAAGACCACGACTG ) and antisense ( CATCCGCAGCCAATGAACAGAG ), Bcar1 sense ( GCACACAGCAAGTTTGTCATTC ) and antisense ( GCTGTAGTGGGTCACTTTGCTT ), Aqp2 sense ( CTGGTGCTGTGCATCTTTGC ) and antisense ( ATGGAGCAACCGGTGAAAT ), Lamb1 sense ( GCGTAAAGCTGCCCAGAACTCTG ) and antisense ( TCCTCCTGGCATCTGCTGACTC ), Vegfa sense ( GCCCATGAAGTGGTGAAGTT ) and antisense ( TATGTGCTGGCTTTGGTGAG ), and Gapdh sense ( GACATGCCGCCTGGAGAAAC ) and antisense ( AGCCCAGGATGCCCTTTAGT ), this last used as a housekeeping gene.

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl. .. The reaction, with an amplification protocol of a 5-min hot start at 95°C followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s, was performed using the MX3000p thermocycler (Stratagene) and analyzed using MxPro software (Stratagene).

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: Densitometry analysis was performed using ImageJ software . .. Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: Agnoprotein Is an Essential Egress Factor during BK Polyomavirus Infection
    Article Snippet: .. Quantitative Real-time PCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen) and specific primers against VP1. .. The PCR reaction was carried out on a Corbett Rotor-Gene 6000 (Qiagen) following three different steps.

    Article Title: Fetal microglial phenotype in vitro carries memory of prior in vivo exposure to inflammation
    Article Snippet: Paragraph title: Quantitative real-time PCR analysis ... HMOX1 and FBP mRNA were quantified by qRT-PCR using a QuantiFast SYBR Green PCR Kit (Qiagen) with STRATAGENE 3000 P, mRNA relative expression was calculated by the 2−ΔΔCt method over housekeeping gene GAPDH compared to baseline (Livak and Schmittgen, ).

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: .. Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit. .. QIAGEN QuantiTect Primer Assays were used to determine gene expression of Egr-1 (Hs_Egr1_2_SG), HO-1 (Hs_HMOX1_1_SG), and glyceraldehyde-3-phosphate dehydrogenase (Hs_GAPDH_2_SG), respectively.

    Article Title: Transcriptional Network Analysis Reveals that AT1 and AT2 Angiotensin II Receptors Are Both Involved in the Regulation of Genes Essential for Glioma Progression
    Article Snippet: For polymerase chain reaction (PCR) to amplify cDNA, QuantiFast SYBR Green PCR Kit (Qiagen) was used according to the manufacturer's instructions in a final volume of 25 µL per reaction. .. The amplification protocol design was: initial denaturation step at 95°C for 5 min followed by 40 cycles using Applied Biosystems 7300 Real-Time PCR System.

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested. ..

    Article Title: Preferential Targeting of Disseminated Liver Tumors Using a Recombinant Adeno-Associated Viral Vector
    Article Snippet: .. A qPCR assay SYBR Green (QuantiFast SYBR Green PCR Kit; Quiagen) was used to evaluate the biodistribution of rAAV8 vectors in genomic DNA using the following primers: HLP forward 5′-CAGGACGCTGTGGTTTCTG-3′ and reverse 5′-TGCCTGAAGCTGAGGAGAC-3′; GAPDH forward 5′-GGAGTCCACTGGCGTCTTCAC-3′ and reverse 5′-GAGGCATTGCTGATGATCTTGAGG-3′. .. Data analysis was performed using unpaired and one-sample t -test (GraphPad Software Inc.). p < 0.05 was considered statistically significant.

    Article Title: The N terminus of Ascl1 underlies differing proneural activity of mouse andXenopus Ascl1 proteins
    Article Snippet: .. Whole embryo RNA was extracted using the RNeasy® Mini kit (Qiagen) and template cDNAs synthesised with the QuantiTect® Reverse Transcription Kit (Qiagen). qPCR was performed using the Quantifast® SYBR Green PCR kit (Qiagen) in a LightCycler® ): Forward, TGGATTTGGAACCAGGCA; Reverse, GCTCAGCTCCTTCGGTGTA. .. For western blot analysis, 12 embryos were snap frozen at stage 12.5 and whole embryo protein was extracted as described in .

    Article Title: Transcription factor myocyte enhancer factor 2D regulates interleukin-10 production in microglia to protect neuronal cells from inflammation-induced death
    Article Snippet: .. Quantitative real-time PCR (qPCR) analysis was performed in triplicate using QuantiFast™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany). .. All gene-specific mRNA expression values were compared to β-actin mRNA levels as a standard.

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: The cDNA was subjected to real-time PCR using primers specific for the RL ORF (Fwd: 5′-ATCGGACCCAGGATTCTTTT-3′; Rev: 5′-ACTCGCTCAACGAACGATTT-3′), which amplified nucleotides 768–917 (amplicon length 150 nt), and primers specific for Gallus gallus β-actin (Fwd: 5′-AGCAACATGTGTGACGAGGA-3′; Rev: 5′-ACCCCACCCTGCTCACTGA-3′), which amplified nucleotides 7–339 (amplicon length 333 nt). .. The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl.

    Article Title: Molecular Basis for Dysregulated Activation of NKX2‐5 in the Vascular Remodeling of Systemic Sclerosis
    Article Snippet: .. Total RNA was extracted according to standard protocols using an RNeasy kit (Qiagen) and was then subjected to qPCR analysis using a QuantiFast SYBR Green PCR kit (Qiagen). .. NKX2‐5 gene expression was normalized against the expression of the β‐actin gene or the TATA box binding protein, as indicated below.

    Article Title: Prognostic impact of MutT homolog‐1 expression on esophageal squamous cell carcinoma
    Article Snippet: .. Quantitative PCR was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and LightCycler 480 II (Roche Diagnostics, Basel, Switzerland). .. Relative expression of MTH1 mRNA was normalized to that of β‐actin mRNA.

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: To genotype, we used the real-time quantitative PCR system. .. Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA).

    RNA Extraction:

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: Paragraph title: RNA extraction and qRT–PCR ... The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl.

    Agarose Gel Electrophoresis:

    Article Title: Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis
    Article Snippet: The quantity and quality of RNA was determined by measuring the absorbance at 260 and 280 nm (NanoDrop Technologies Inc., DE, USA) and agarose gel electrophoresis. .. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using a Rotor-Gene 3000 (Corbett Research) with the QuantiFast™ SYBR® Green PCR kit (Qiagen).

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: To confirm the anticipated size of the product, PCR products were visualized on an agarose gel via GelRed (VWR) staining. .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested.

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl. .. Melting curves, as well as separation of PCR products on a 1% Tris acetate-EDTA agarose gel, were used to ensure the formation of a single product of the appropriate size.

    Electrophoresis:

    Article Title: Expression of D-Amino Acid Oxidase (DAO/DAAO) and D-Amino Acid Oxidase Activator (DAOA/G72) during Development and Aging in the Human Post-mortem Brain
    Article Snippet: RNA integrity was analyzed using Experion automated electrophoresis system (Bio-Rad, Switzerland) in a subset of samples. .. In a subset of samples, negative controls were prepared with RNA without reverse transcriptase enzyme. qRT-PCR was performed using cDNA, QuantiFast SYBR Green PCR kit (Qiagen, Switzerland), 1 μM forward and reverse DAO primers (Microsynth, Switzerland), and reference genes [β-actin (ACTB ) (QT01680476), aminolevulinate synthetase (ALAS1 ) (QT00073122), ribosomal protein L13a (RPL13A ) (QT00089915), alanyl-tRNA synthetase (AARS ) (QT00054747), glyceraldehyde-3-phosphate dehydrogenase (GAPDH ) (QT01192646), peptidylprolyl isomerase A (PPIA ) (QT00866137), ribosomal RNA (R18S ) (QT00019936), and X-prolyl aminopeptidase 1 (XPNPEP1 ) (QT00051471); all from Qiagen, Switzerland].

    Transgenic Assay:

    Article Title: mTOR attenuates the inflammatory response in cardiomyocytes and prevents cardiac dysfunction in pathological hypertrophy
    Article Snippet: Paragraph title: Generation of transgenic mice with cardiac overexpression of wild-type mTOR. ... Genomic DNA was reacted with a TaqMan probe using the QuantiFast SYBR green PCR kit (Qiagen, Valencia, CA).

    Random Hexamer Labeling:

    Article Title: Hypochlorite-modified high-density lipoprotein promotes induction of HO-1 in endothelial cells via activation of p42/44 MAPK and zinc finger transcription factor Egr-1
    Article Snippet: One microgram of RNA was subjected to DNaseI digestion and reverse transcription (Invitrogen, Lofer, Austria) using random hexamer primers (Applied Biosystems Inc., Foster City, CA, USA). .. Gene expression was determined by quantitative Real-time PCR using the LightCycler 480 system (Roche Diagnostics, Vienna, Austria) and the QIAGEN QuantiFast SYBR Green PCR Kit.

    Spectrophotometry:

    Article Title: Expression of D-Amino Acid Oxidase (DAO/DAAO) and D-Amino Acid Oxidase Activator (DAOA/G72) during Development and Aging in the Human Post-mortem Brain
    Article Snippet: A spectrophotometer (NanoVue Plus, GE Healthcare Life Sciences) was used to measure RNA concentrations, A260/A280, and A260/A230 ratios. .. In a subset of samples, negative controls were prepared with RNA without reverse transcriptase enzyme. qRT-PCR was performed using cDNA, QuantiFast SYBR Green PCR kit (Qiagen, Switzerland), 1 μM forward and reverse DAO primers (Microsynth, Switzerland), and reference genes [β-actin (ACTB ) (QT01680476), aminolevulinate synthetase (ALAS1 ) (QT00073122), ribosomal protein L13a (RPL13A ) (QT00089915), alanyl-tRNA synthetase (AARS ) (QT00054747), glyceraldehyde-3-phosphate dehydrogenase (GAPDH ) (QT01192646), peptidylprolyl isomerase A (PPIA ) (QT00866137), ribosomal RNA (R18S ) (QT00019936), and X-prolyl aminopeptidase 1 (XPNPEP1 ) (QT00051471); all from Qiagen, Switzerland].

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: The RNA concentration was measured with a UV spectrophotometer (Eppendorf Biophotometer) at 260 nm and immediately used for cDNA production using Moloney murine leukemia virus reverse transcriptase and random hexamers. .. The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl.

    Concentration Assay:

    Article Title: Facilitated leaky scanning and atypical ribosome shunting direct downstream translation initiation on the tricistronic S1 mRNA of avian reovirus
    Article Snippet: The RNA concentration was measured with a UV spectrophotometer (Eppendorf Biophotometer) at 260 nm and immediately used for cDNA production using Moloney murine leukemia virus reverse transcriptase and random hexamers. .. The QuantiFast SYBR Green PCR kit (Qiagen) was used according to manufacturer’s specifications in a final reaction volume of 20 µl.

    Staining:

    Article Title: Distinct purinergic signaling pathways in prepubescent mouse spermatogonia
    Article Snippet: To confirm the anticipated size of the product, PCR products were visualized on an agarose gel via GelRed (VWR) staining. .. For qPCR, we used the QuantiFast SYBR Green PCR kit (QIAGEN) and an iQ5 thermal cycler (Bio-Rad Laboratories) according to the manufacturer’s instructions. α1A-tubulin was used to normalize the amount of target mRNA in the different cDNA populations tested.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen quantifast sybr green pcr kit
    Quantifast Sybr Green Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 389 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantifast sybr green pcr kit/product/Qiagen
    Average 90 stars, based on 389 article reviews
    Price from $9.99 to $1999.99
    quantifast sybr green pcr kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Qiagen rotor gene sybr green pcr kit
    Rotor Gene Sybr Green Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 262 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rotor gene sybr green pcr kit/product/Qiagen
    Average 90 stars, based on 262 article reviews
    Price from $9.99 to $1999.99
    rotor gene sybr green pcr kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results