mercaptoethanol  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    2 Mercaptoethanol
    Description:

    Catalog Number:
    m7154
    Price:
    None
    Applications:
    BME is suitable for reducing protein disulfide bonds prior to polyacrylamide gel electrophoresis and is usually included in a sample buffer for SDS-PAGE at a concentration of 5%. Cleaving intermolecular (between subunits) disulfide bonds allows the subunits of a protein to separate independently on SDS-PAGE. Cleaving intramolecular (within subunit) disulfide bonds allows the subunits to become completely denatured so that each peptide migrates according to its chain length with no influence due to secondary structure.
    Buy from Supplier


    Structured Review

    Millipore mercaptoethanol
    2 Mercaptoethanol

    https://www.bioz.com/result/mercaptoethanol/product/Millipore
    Average 95 stars, based on 105 article reviews
    Price from $9.99 to $1999.99
    mercaptoethanol - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Elucidation of IP6 and Heparin Interaction Sites and Conformational Changes in Arrestin-1 by Solution NMR †"

    Article Title: Elucidation of IP6 and Heparin Interaction Sites and Conformational Changes in Arrestin-1 by Solution NMR †

    Journal: Biochemistry

    doi: 10.1021/bi101596g

    2D 1 H- 15 N TROSY spectrum of 0.2mM selectively 15 N-isoleucine-labeled arrestin-1 in 25 mM Bis-Tris, 150mM NaCl and 5mM mercaptoethanol, pH=6.5 at 308 K using a Bruker Avance 800MHz spectrometer. 11 out of 20 isoleucine residue peaks were assigned, as labeled
    Figure Legend Snippet: 2D 1 H- 15 N TROSY spectrum of 0.2mM selectively 15 N-isoleucine-labeled arrestin-1 in 25 mM Bis-Tris, 150mM NaCl and 5mM mercaptoethanol, pH=6.5 at 308 K using a Bruker Avance 800MHz spectrometer. 11 out of 20 isoleucine residue peaks were assigned, as labeled

    Techniques Used: Labeling

    2-D 1 H- 15 N TROSY spectrum of 0.2mM U- 2 H, 15 N-arrestin-1 in 25 mM Bis-Tris, 150 mM NaCl, 5 mM mercaptoethanol, pH=6.5 acquired at 308 K using a Bruker Avance 800MHz spectrometer. 152 assigned residues are labeled.
    Figure Legend Snippet: 2-D 1 H- 15 N TROSY spectrum of 0.2mM U- 2 H, 15 N-arrestin-1 in 25 mM Bis-Tris, 150 mM NaCl, 5 mM mercaptoethanol, pH=6.5 acquired at 308 K using a Bruker Avance 800MHz spectrometer. 152 assigned residues are labeled.

    Techniques Used: Labeling

    Related Articles

    Transduction:

    Article Title: Transcripts involved in calcium signaling and telencephalic neuronal fate are altered in induced pluripotent stem cells from bipolar disorder patients
    Article Snippet: iPSC derivation Fibroblasts at passage 5–6 were plated at 5 × 104 cells in 35-mm tissue culture dishes in fibroblast medium and transduced with retroviral constructs expressing the pluripotency factors OCT4 , SOX2 , KLF4 and c-MYC . .. On day 7, forming iPSC were trypsinized and passaged to mouse embryonic fibroblast (MEF) feeders for expansion in hESC medium compromising DMEM/F12 (Invitrogen, 11320–032), 20% KOSR (Invitrogen, 10828–028), 4 ng ml−1 FGF2 (EMD Millipore GF003), 1% NEAA, 2 mM glutamax and 0.1 mM β-mercaptoethanol (Sigma-Aldrich, St Louis, MO, USA, M3148).

    Centrifugation:

    Article Title: Lamellipodin promotes actin assembly by clustering Ena/VASP proteins and tethering them to actin filaments
    Article Snippet: Cells were lysed into buffer containing 50 mM Na2 PO4 [pH 8], 400 mM NaCl, 0.4 mM BME (Sigma, Cat# M3148-100ML), 1 mM phenylmethanesulfonyl fluoride (Sigma, Cat# P7626-5G), and DNase (Sigma, Cat# DN25-1G) using a microfluidizer. .. Lysate was clarified by centrifugation in a Beckman JA-17 rotor for 60 min, 16,000 rpm (35,000 rcf).

    Mass Spectrometry:

    Article Title: A transcriptomic atlas of aged human microglia
    Article Snippet: Following a wash with staining buffer the CD11b+ cells were isolated on a Miltenyi MS column while the CD11b− fraction was cryopreserved using FBS containing 10% DMSO. .. Cells were sorted in A1 well of a 96 well PCR plate (Eppendorf, 951020401) containing 25 μl of TCL buffer (Qiagen, 1031576) with 1% beta mercaptoethanol (Sigma, M3148).

    Quantitative RT-PCR:

    Article Title: Electrotaxis of Glioblastoma and Medulloblastoma Spheroidal Aggregates
    Article Snippet: Paragraph title: qRT-PCR: cell culture and preparation ... Pools were centrifuged for 5 min at 800xg and resuspended in 75 μL 1% ß-mercaptoethanol (Sigma M3148)/Buffer RLT (Qiagen 79216), vortexed for 1 min, and stored at −80 °C.

    Incubation:

    Article Title: Differentiation of adipose-derived stem cells into Schwann cell-like cells through intermittent induction: potential advantage of cellular transient memory function
    Article Snippet: The experimental grouping and specific induction methods were as follows (Fig. ): (i) uASCs: undifferentiated ASCs (uASCs) at passage 2 were used; (ii–v) ASCs at passage 2 were pre-induced for 24 h with pre-induction medium I consisting of serum-free Dulbecco’s modified Eagle’s medium (DMEM) containing 1 mM β-mercaptoethanol (β-ME) (M3148; Sigma). .. Pre-induction medium I was replaced with pre-induction medium II consisting of DMEM, 10% FBS, and 35 ng/ml all trans -retinoic acid (RA) (R2625; Sigma) and incubated for 72 h. The resulting differentiated ASCs were divided into four groups according to subsequent processing: (ii) sustaining dASCs 4d: Differentiated ASCs (dASCs) were induced for 4 days with complete induction medium consisting of DMEM, 10% FBS, 5 μM forskolin (F6886; Sigma), 200 ng/ml recombinant human heregulin-β1 (HRG) (100–03; PeproTech), 10 ng/ml basic fibroblast growth factor (bFGF) (3339-FB: R & D Systems), and 5 ng/ml recombinant rat platelet-derived growth factor (PDGF)-AB (1115-AB; R & D Systems); (iii) sustaining dASCs 7d: dASCs were induced for 7 days with complete induction medium; (iv) sustaining dASCs 10d: dASCs were induced for 10 days with complete induction medium; (v) intermittent dASCs: dASCs were induced for 4 days with complete induction medium, after which complete induction medium was replaced with incomplete induction medium consisting of DMEM, 10% FBS, 5 μM forskolin, and 200 ng/ml HRG for induction for 3 days.

    Article Title: Microtubules soften due to cross-sectional flattening
    Article Snippet: .. We prepared NEM-modified tubulin by incubation of unmodified dimers at a concentration of 13 mg/ml with 1 mM NEM (N-Ethylmaleimide, Sigma, E3876) and 0.5 mM GMPCPP (Jena Bioscience, NU-405S) on ice for 10 min and then quenching the reaction with 8 mM beta-mercapthoethanol (Sigma, M6250) for another 10 mins ( ). .. All labeled and unlabeled tubulin monomers were stored at −80 ∘ C.

    Article Title: ArhGEF37 assists dynamin 2 during clathrin-mediated endocytosis
    Article Snippet: .. SDS/PAGE and western blots Brain tissue lysates (PK-AB718-1403-0/7/14, Promo Kine) and other protein samples were diluted 1:1 with 2×Laemmli buffer containing 125 mM Tris-HCl, 0.005% Brilliant Blue (19598.1, Carl Roth), 20% glycerol, 4% SDS (20765.3, Serva) and 5% β-mercaptoethanol (M-7154, Sigma), incubated for 2 min at 92°C and loaded onto 12% polyacrylamide gel ( http://www.poissonboltzmann.org/ ). .. Primary antibodies used were anti-ArhGEF37 (1:500, HPA043885, Atlas Antibodies), anti-α-tubulin (1:500, 302-211, Synaptic Systems) and anti-HIS6 tag (1:500, 18184, Abcam), incubated overnight at 4°C.

    Article Title: Electrotaxis of Glioblastoma and Medulloblastoma Spheroidal Aggregates
    Article Snippet: Aggrewells were incubated for 24 h and then spheroids were transferred to electrotaxis chamber and embedded in 1:1 cell culture medium to reduced-growth-factor Matrigel (Corning 354230) and allow to acclimate for 24 h before stimulation. .. Pools were centrifuged for 5 min at 800xg and resuspended in 75 μL 1% ß-mercaptoethanol (Sigma M3148)/Buffer RLT (Qiagen 79216), vortexed for 1 min, and stored at −80 °C.

    Article Title: Assessment of BOLD and GenBank – Their accuracy and reliability for the identification of biological materials
    Article Snippet: Immediately prior to extraction, 0.04 g/mL polyvinylpyrrolidone (PVP; molecular weight of 360,000; Sigma-Aldrich [P5288]), 0.4% Proteinase K (20 mg/mL; VWR International [E195]), and 0.5% β-mercaptoethanol (Sigma-Aldrich [M3148]) was added to the CTAB lysis buffer, which was subsequently placed in a 56°C water bath for ~15 min to facilitate the dissolution of PVP. .. A total of 500 μL of the CTAB lysis buffer was added to the finely ground tissue and incubated in a 65°C shaking water bath for 1 hr.

    Article Title: A transcriptomic atlas of aged human microglia
    Article Snippet: The CD11b positive fraction was than incubated with anti-CD11b AlexaFluor488 (BioLegend, 301318, clone ICRF44) and anti-CD45 AlexaFluor647 (BioLegend, 304018, clone HI30) antibodies as well as 7AAD (BD Pharmingen, 559925) for 20 min on ice. .. Cells were sorted in A1 well of a 96 well PCR plate (Eppendorf, 951020401) containing 25 μl of TCL buffer (Qiagen, 1031576) with 1% beta mercaptoethanol (Sigma, M3148).

    Activity Assay:

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% ( v / v ) glycerol, 2% ( w / v ) SDS, 0.05% ( v / v ) β-mercaptoethanol (M-7154, Sigma), 0.05% ( w / v ) bromophenol blue (035730, BDH)] and stored at −20°C until use. .. The remaining BBMV were either diluted 1:100 in buffer 3 and stored at −20°C for enzyme activity determination or were used immediately for glucose uptake studies.

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% (v /v ) glycerol, 2% (w /v ) SDS, 0.05% (v /v ) β-mercaptoethanol (M-7154, Sigma), 0.05% (w /v ) bromophenol blue (035730, BDH)] and stored at −20°C until use. .. The remaining BBMV were either diluted 1:100 in buffer 3 and stored at −20°C for enzyme activity determination or were used immediately for glucose uptake studies.

    Knock-Out:

    Article Title: 4D cell biology: big data image analytics and lattice light-sheet imaging reveal dynamics of clathrin-mediated endocytosis in stem cell–derived intestinal organoids
    Article Snippet: .. Briefly, hESCs were maintained on a layer of inactivated mouse embryonic fibroblast (MEFs) in hESC medium (DMEM/F12 (Lifetech)) supplemented with 20% KnockOut Serum Replace­ment (Gibco 10828028), 1 mM glutamine (Gibco 25030-081), 1% nonessential amino acids (Gibco 11140076), 0.1 mM β-mercaptoethanol (Sigma-Aldrich M6250), 1000 U/ml penicillin/streptomycin (Gibco15140122), and 4 ng/ml FGF-Basic full (Invitrogen PHG0263). .. Cultures were passaged every 7 d with 1.5 mg/ml collagenase type IV (Gibco 17104019) and gravitational sedimentation by washing three times in wash media (DMEM/F12 [Gibco 11320- 033]) supplemented with 5% fetal bovine serum (Gibco 10437028) and 1000 U/ml penicillin/streptomycin (Gibco 15140122).

    Article Title: KHDC3L mutation causes recurrent pregnancy loss by inducing genomic instability of human early embryonic cells
    Article Snippet: .. hESC culture hESCs (H9, a gift from Dr. Shaorong Gao) were cultured on mitomycin C–treated mouse embryonic fibroblasts (MEFs) in knockout serum replacement (KSR) medium containing 80% DMEM/F12 (DF12, Gibco, 12500–062), 20% KSR (Gibco, A31815-02), 2 mM L-Glutamine (Sigma, G8540-100G), 0.1 mM nonessential aa (NEAA, Gibco, 11140–050), 0.1 mM β-mercaptoethanol (Sigma, M3148-100ML), and 5 ng/mL bFGF (Millipore, GF003). .. KHDC3L gene editing in hESCs via CRISPR/Cas9 The PX330 plasmid was constructed and single-guide RNAs (sgRNAs) were designed as previously reported ( http://crispr.mit.edu/ ) [ ]. sgRNA AGGCGGTTTCCGACGCTCGT was designed to target exon 1 of KHDC3L . sgRNA was cloned into PX330. hESCs were dissociated into single cells using accutase (Gibco, A1110501) following 2 h preincubation with 10 μM Y-27632 (ROCK inhibitor, Selleck, S1049).

    Expressing:

    Article Title: Transcripts involved in calcium signaling and telencephalic neuronal fate are altered in induced pluripotent stem cells from bipolar disorder patients
    Article Snippet: iPSC derivation Fibroblasts at passage 5–6 were plated at 5 × 104 cells in 35-mm tissue culture dishes in fibroblast medium and transduced with retroviral constructs expressing the pluripotency factors OCT4 , SOX2 , KLF4 and c-MYC . .. On day 7, forming iPSC were trypsinized and passaged to mouse embryonic fibroblast (MEF) feeders for expansion in hESC medium compromising DMEM/F12 (Invitrogen, 11320–032), 20% KOSR (Invitrogen, 10828–028), 4 ng ml−1 FGF2 (EMD Millipore GF003), 1% NEAA, 2 mM glutamax and 0.1 mM β-mercaptoethanol (Sigma-Aldrich, St Louis, MO, USA, M3148).

    Article Title: Lamellipodin promotes actin assembly by clustering Ena/VASP proteins and tethering them to actin filaments
    Article Snippet: Paragraph title: Protein expression and purification ... Cells were lysed into buffer containing 50 mM Na2 PO4 [pH 8], 400 mM NaCl, 0.4 mM BME (Sigma, Cat# M3148-100ML), 1 mM phenylmethanesulfonyl fluoride (Sigma, Cat# P7626-5G), and DNase (Sigma, Cat# DN25-1G) using a microfluidizer.

    Modification:

    Article Title: Differentiation of adipose-derived stem cells into Schwann cell-like cells through intermittent induction: potential advantage of cellular transient memory function
    Article Snippet: .. The experimental grouping and specific induction methods were as follows (Fig. ): (i) uASCs: undifferentiated ASCs (uASCs) at passage 2 were used; (ii–v) ASCs at passage 2 were pre-induced for 24 h with pre-induction medium I consisting of serum-free Dulbecco’s modified Eagle’s medium (DMEM) containing 1 mM β-mercaptoethanol (β-ME) (M3148; Sigma). .. Pre-induction medium I was replaced with pre-induction medium II consisting of DMEM, 10% FBS, and 35 ng/ml all trans -retinoic acid (RA) (R2625; Sigma) and incubated for 72 h. The resulting differentiated ASCs were divided into four groups according to subsequent processing: (ii) sustaining dASCs 4d: Differentiated ASCs (dASCs) were induced for 4 days with complete induction medium consisting of DMEM, 10% FBS, 5 μM forskolin (F6886; Sigma), 200 ng/ml recombinant human heregulin-β1 (HRG) (100–03; PeproTech), 10 ng/ml basic fibroblast growth factor (bFGF) (3339-FB: R & D Systems), and 5 ng/ml recombinant rat platelet-derived growth factor (PDGF)-AB (1115-AB; R & D Systems); (iii) sustaining dASCs 7d: dASCs were induced for 7 days with complete induction medium; (iv) sustaining dASCs 10d: dASCs were induced for 10 days with complete induction medium; (v) intermittent dASCs: dASCs were induced for 4 days with complete induction medium, after which complete induction medium was replaced with incomplete induction medium consisting of DMEM, 10% FBS, 5 μM forskolin, and 200 ng/ml HRG for induction for 3 days.

    Article Title: Flatbed epi relief-contrast cellular monitoring system for stable cell culture
    Article Snippet: .. Mouse pancreatic β cell lines (Min6 and Min6-m9 , kind gifts from Prof. J. Miyazaki at Osaka University and Prof. O. Seino at Kobe University, respectively) were maintained in Dulbecco’s modified Eagle medium supplemented with 10% FBS, 1% penicillin-streptomycin, and 6.3 mM β-mercaptoethanol (Sigma-Aldrich, M6250). ..

    Western Blot:

    Article Title: ArhGEF37 assists dynamin 2 during clathrin-mediated endocytosis
    Article Snippet: .. SDS/PAGE and western blots Brain tissue lysates (PK-AB718-1403-0/7/14, Promo Kine) and other protein samples were diluted 1:1 with 2×Laemmli buffer containing 125 mM Tris-HCl, 0.005% Brilliant Blue (19598.1, Carl Roth), 20% glycerol, 4% SDS (20765.3, Serva) and 5% β-mercaptoethanol (M-7154, Sigma), incubated for 2 min at 92°C and loaded onto 12% polyacrylamide gel ( http://www.poissonboltzmann.org/ ). .. Primary antibodies used were anti-ArhGEF37 (1:500, HPA043885, Atlas Antibodies), anti-α-tubulin (1:500, 302-211, Synaptic Systems) and anti-HIS6 tag (1:500, 18184, Abcam), incubated overnight at 4°C.

    Article Title: Intracellular sorting and transcytosis of the rat transferrin receptor antibody OX26 across the blood–brain barrier in vitro is dependent on its binding affinity
    Article Snippet: Paragraph title: Western blot analyses ... For quantification, blots were stripped using 1 M Tris pH 6.8 (0497, Amresco, Solon, OH, USA), 2% SDS (L4509, Sigma Aldrich, St‐Louis, MO, USA), and 0.7% β‐mercaptoethanol (M7154, Sigma Aldrich, St‐Louis, MO, USA), and were re‐probed with β‐actin‐horseradish peroxidase antibodies (A3854, RRID:AB_262011,Sigma, Oakville, ON, USA).

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: .. In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% ( v / v ) glycerol, 2% ( w / v ) SDS, 0.05% ( v / v ) β-mercaptoethanol (M-7154, Sigma), 0.05% ( w / v ) bromophenol blue (035730, BDH)] and stored at −20°C until use. .. The remaining BBMV were either diluted 1:100 in buffer 3 and stored at −20°C for enzyme activity determination or were used immediately for glucose uptake studies.

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: .. In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% (v /v ) glycerol, 2% (w /v ) SDS, 0.05% (v /v ) β-mercaptoethanol (M-7154, Sigma), 0.05% (w /v ) bromophenol blue (035730, BDH)] and stored at −20°C until use. .. The remaining BBMV were either diluted 1:100 in buffer 3 and stored at −20°C for enzyme activity determination or were used immediately for glucose uptake studies.

    Transformation Assay:

    Article Title: Lamellipodin promotes actin assembly by clustering Ena/VASP proteins and tethering them to actin filaments
    Article Snippet: Protein expression and purification BL21 (DE3) Star pRARE bacteria (chloramphenicol resistant) were transformed with his10 -TEV-EGFP(A207K)-Lpd (850–1250aa, wild-type and mutants) or his6 -Z-tag-TEV-EGFP(A207K)-LZ-Lpd850−1250aa and plated on LB agar containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol. .. Cells were lysed into buffer containing 50 mM Na2 PO4 [pH 8], 400 mM NaCl, 0.4 mM BME (Sigma, Cat# M3148-100ML), 1 mM phenylmethanesulfonyl fluoride (Sigma, Cat# P7626-5G), and DNase (Sigma, Cat# DN25-1G) using a microfluidizer.

    Derivative Assay:

    Article Title: Transcripts involved in calcium signaling and telencephalic neuronal fate are altered in induced pluripotent stem cells from bipolar disorder patients
    Article Snippet: On day 7, forming iPSC were trypsinized and passaged to mouse embryonic fibroblast (MEF) feeders for expansion in hESC medium compromising DMEM/F12 (Invitrogen, 11320–032), 20% KOSR (Invitrogen, 10828–028), 4 ng ml−1 FGF2 (EMD Millipore GF003), 1% NEAA, 2 mM glutamax and 0.1 mM β-mercaptoethanol (Sigma-Aldrich, St Louis, MO, USA, M3148). .. From each fibroblast line, 5–10 colonies were selected for expansion to iPSC lines; a minimum of 5–6 iPSC lines were derived from each fibroblast (patient) sample.

    Protease Inhibitor:

    Article Title: Intracellular sorting and transcytosis of the rat transferrin receptor antibody OX26 across the blood–brain barrier in vitro is dependent on its binding affinity
    Article Snippet: Cell lysates of SV‐ARBEC were prepared in RIPA buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM ethylenediaminetetraacetic acid (EDTA), 0.1% sodium dodecyl sulfate (SDS), 1% Deoxycholate, 1% triton X‐100) containing protease inhibitor cocktail (11697498001, Roche, Laval, QC, USA). .. For quantification, blots were stripped using 1 M Tris pH 6.8 (0497, Amresco, Solon, OH, USA), 2% SDS (L4509, Sigma Aldrich, St‐Louis, MO, USA), and 0.7% β‐mercaptoethanol (M7154, Sigma Aldrich, St‐Louis, MO, USA), and were re‐probed with β‐actin‐horseradish peroxidase antibodies (A3854, RRID:AB_262011,Sigma, Oakville, ON, USA).

    Cell Culture:

    Article Title: 4D cell biology: big data image analytics and lattice light-sheet imaging reveal dynamics of clathrin-mediated endocytosis in stem cell–derived intestinal organoids
    Article Snippet: Paragraph title: Cell culture. ... Briefly, hESCs were maintained on a layer of inactivated mouse embryonic fibroblast (MEFs) in hESC medium (DMEM/F12 (Lifetech)) supplemented with 20% KnockOut Serum Replace­ment (Gibco 10828028), 1 mM glutamine (Gibco 25030-081), 1% nonessential amino acids (Gibco 11140076), 0.1 mM β-mercaptoethanol (Sigma-Aldrich M6250), 1000 U/ml penicillin/streptomycin (Gibco15140122), and 4 ng/ml FGF-Basic full (Invitrogen PHG0263).

    Article Title: Electrotaxis of Glioblastoma and Medulloblastoma Spheroidal Aggregates
    Article Snippet: Paragraph title: qRT-PCR: cell culture and preparation ... Pools were centrifuged for 5 min at 800xg and resuspended in 75 μL 1% ß-mercaptoethanol (Sigma M3148)/Buffer RLT (Qiagen 79216), vortexed for 1 min, and stored at −80 °C.

    Article Title: Flatbed epi relief-contrast cellular monitoring system for stable cell culture
    Article Snippet: Paragraph title: Cell culture ... Mouse pancreatic β cell lines (Min6 and Min6-m9 , kind gifts from Prof. J. Miyazaki at Osaka University and Prof. O. Seino at Kobe University, respectively) were maintained in Dulbecco’s modified Eagle medium supplemented with 10% FBS, 1% penicillin-streptomycin, and 6.3 mM β-mercaptoethanol (Sigma-Aldrich, M6250).

    Article Title: KHDC3L mutation causes recurrent pregnancy loss by inducing genomic instability of human early embryonic cells
    Article Snippet: .. hESC culture hESCs (H9, a gift from Dr. Shaorong Gao) were cultured on mitomycin C–treated mouse embryonic fibroblasts (MEFs) in knockout serum replacement (KSR) medium containing 80% DMEM/F12 (DF12, Gibco, 12500–062), 20% KSR (Gibco, A31815-02), 2 mM L-Glutamine (Sigma, G8540-100G), 0.1 mM nonessential aa (NEAA, Gibco, 11140–050), 0.1 mM β-mercaptoethanol (Sigma, M3148-100ML), and 5 ng/mL bFGF (Millipore, GF003). .. KHDC3L gene editing in hESCs via CRISPR/Cas9 The PX330 plasmid was constructed and single-guide RNAs (sgRNAs) were designed as previously reported ( http://crispr.mit.edu/ ) [ ]. sgRNA AGGCGGTTTCCGACGCTCGT was designed to target exon 1 of KHDC3L . sgRNA was cloned into PX330. hESCs were dissociated into single cells using accutase (Gibco, A1110501) following 2 h preincubation with 10 μM Y-27632 (ROCK inhibitor, Selleck, S1049).

    Sedimentation:

    Article Title: 4D cell biology: big data image analytics and lattice light-sheet imaging reveal dynamics of clathrin-mediated endocytosis in stem cell–derived intestinal organoids
    Article Snippet: Briefly, hESCs were maintained on a layer of inactivated mouse embryonic fibroblast (MEFs) in hESC medium (DMEM/F12 (Lifetech)) supplemented with 20% KnockOut Serum Replace­ment (Gibco 10828028), 1 mM glutamine (Gibco 25030-081), 1% nonessential amino acids (Gibco 11140076), 0.1 mM β-mercaptoethanol (Sigma-Aldrich M6250), 1000 U/ml penicillin/streptomycin (Gibco15140122), and 4 ng/ml FGF-Basic full (Invitrogen PHG0263). .. Cultures were passaged every 7 d with 1.5 mg/ml collagenase type IV (Gibco 17104019) and gravitational sedimentation by washing three times in wash media (DMEM/F12 [Gibco 11320- 033]) supplemented with 5% fetal bovine serum (Gibco 10437028) and 1000 U/ml penicillin/streptomycin (Gibco 15140122).

    Protein Concentration:

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: The protein concentration in the BBMV was estimated by its ability to bind Coomassie blue according to the Bio-Rad assay technique (Bio-Rad, Hemel Hempstead, UK). .. In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% ( v / v ) glycerol, 2% ( w / v ) SDS, 0.05% ( v / v ) β-mercaptoethanol (M-7154, Sigma), 0.05% ( w / v ) bromophenol blue (035730, BDH)] and stored at −20°C until use.

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: The protein concentration in the BBMV was estimated by its ability to bind Coomassie blue according to the Bio-Rad assay technique (Bio-Rad, Hemel Hempstead, UK). .. In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% (v /v ) glycerol, 2% (w /v ) SDS, 0.05% (v /v ) β-mercaptoethanol (M-7154, Sigma), 0.05% (w /v ) bromophenol blue (035730, BDH)] and stored at −20°C until use.

    Polymerase Chain Reaction:

    Article Title: A transcriptomic atlas of aged human microglia
    Article Snippet: .. Cells were sorted in A1 well of a 96 well PCR plate (Eppendorf, 951020401) containing 25 μl of TCL buffer (Qiagen, 1031576) with 1% beta mercaptoethanol (Sigma, M3148). ..

    Recombinant:

    Article Title: Differentiation of adipose-derived stem cells into Schwann cell-like cells through intermittent induction: potential advantage of cellular transient memory function
    Article Snippet: The experimental grouping and specific induction methods were as follows (Fig. ): (i) uASCs: undifferentiated ASCs (uASCs) at passage 2 were used; (ii–v) ASCs at passage 2 were pre-induced for 24 h with pre-induction medium I consisting of serum-free Dulbecco’s modified Eagle’s medium (DMEM) containing 1 mM β-mercaptoethanol (β-ME) (M3148; Sigma). .. Pre-induction medium I was replaced with pre-induction medium II consisting of DMEM, 10% FBS, and 35 ng/ml all trans -retinoic acid (RA) (R2625; Sigma) and incubated for 72 h. The resulting differentiated ASCs were divided into four groups according to subsequent processing: (ii) sustaining dASCs 4d: Differentiated ASCs (dASCs) were induced for 4 days with complete induction medium consisting of DMEM, 10% FBS, 5 μM forskolin (F6886; Sigma), 200 ng/ml recombinant human heregulin-β1 (HRG) (100–03; PeproTech), 10 ng/ml basic fibroblast growth factor (bFGF) (3339-FB: R & D Systems), and 5 ng/ml recombinant rat platelet-derived growth factor (PDGF)-AB (1115-AB; R & D Systems); (iii) sustaining dASCs 7d: dASCs were induced for 7 days with complete induction medium; (iv) sustaining dASCs 10d: dASCs were induced for 10 days with complete induction medium; (v) intermittent dASCs: dASCs were induced for 4 days with complete induction medium, after which complete induction medium was replaced with incomplete induction medium consisting of DMEM, 10% FBS, 5 μM forskolin, and 200 ng/ml HRG for induction for 3 days.

    Molecular Weight:

    Article Title: Assessment of BOLD and GenBank – Their accuracy and reliability for the identification of biological materials
    Article Snippet: .. Immediately prior to extraction, 0.04 g/mL polyvinylpyrrolidone (PVP; molecular weight of 360,000; Sigma-Aldrich [P5288]), 0.4% Proteinase K (20 mg/mL; VWR International [E195]), and 0.5% β-mercaptoethanol (Sigma-Aldrich [M3148]) was added to the CTAB lysis buffer, which was subsequently placed in a 56°C water bath for ~15 min to facilitate the dissolution of PVP. .. A total of 500 μL of the CTAB lysis buffer was added to the finely ground tissue and incubated in a 65°C shaking water bath for 1 hr.

    Magnetic Beads:

    Article Title: A transcriptomic atlas of aged human microglia
    Article Snippet: The cell suspension was spun down and incubated with anti-CD11b magnetic beads (Miltenyi, 130-049-601, clone M1/70) for 15 min. .. Cells were sorted in A1 well of a 96 well PCR plate (Eppendorf, 951020401) containing 25 μl of TCL buffer (Qiagen, 1031576) with 1% beta mercaptoethanol (Sigma, M3148).

    Isolation:

    Article Title: A transcriptomic atlas of aged human microglia
    Article Snippet: Paragraph title: Microglia isolation and sorting ... Cells were sorted in A1 well of a 96 well PCR plate (Eppendorf, 951020401) containing 25 μl of TCL buffer (Qiagen, 1031576) with 1% beta mercaptoethanol (Sigma, M3148).

    Labeling:

    Article Title: Microtubules soften due to cross-sectional flattening
    Article Snippet: We prepared NEM-modified tubulin by incubation of unmodified dimers at a concentration of 13 mg/ml with 1 mM NEM (N-Ethylmaleimide, Sigma, E3876) and 0.5 mM GMPCPP (Jena Bioscience, NU-405S) on ice for 10 min and then quenching the reaction with 8 mM beta-mercapthoethanol (Sigma, M6250) for another 10 mins ( ). .. All labeled and unlabeled tubulin monomers were stored at −80 ∘ C.

    Purification:

    Article Title: Microtubules soften due to cross-sectional flattening
    Article Snippet: Tubulin and microtubule polymerization Tubulin was purified from bovine brain tissue according to the established protocol ( ). .. We prepared NEM-modified tubulin by incubation of unmodified dimers at a concentration of 13 mg/ml with 1 mM NEM (N-Ethylmaleimide, Sigma, E3876) and 0.5 mM GMPCPP (Jena Bioscience, NU-405S) on ice for 10 min and then quenching the reaction with 8 mM beta-mercapthoethanol (Sigma, M6250) for another 10 mins ( ).

    Article Title: Lamellipodin promotes actin assembly by clustering Ena/VASP proteins and tethering them to actin filaments
    Article Snippet: Paragraph title: Protein expression and purification ... Cells were lysed into buffer containing 50 mM Na2 PO4 [pH 8], 400 mM NaCl, 0.4 mM BME (Sigma, Cat# M3148-100ML), 1 mM phenylmethanesulfonyl fluoride (Sigma, Cat# P7626-5G), and DNase (Sigma, Cat# DN25-1G) using a microfluidizer.

    Construct:

    Article Title: Transcripts involved in calcium signaling and telencephalic neuronal fate are altered in induced pluripotent stem cells from bipolar disorder patients
    Article Snippet: iPSC derivation Fibroblasts at passage 5–6 were plated at 5 × 104 cells in 35-mm tissue culture dishes in fibroblast medium and transduced with retroviral constructs expressing the pluripotency factors OCT4 , SOX2 , KLF4 and c-MYC . .. On day 7, forming iPSC were trypsinized and passaged to mouse embryonic fibroblast (MEF) feeders for expansion in hESC medium compromising DMEM/F12 (Invitrogen, 11320–032), 20% KOSR (Invitrogen, 10828–028), 4 ng ml−1 FGF2 (EMD Millipore GF003), 1% NEAA, 2 mM glutamax and 0.1 mM β-mercaptoethanol (Sigma-Aldrich, St Louis, MO, USA, M3148).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Intracellular sorting and transcytosis of the rat transferrin receptor antibody OX26 across the blood–brain barrier in vitro is dependent on its binding affinity
    Article Snippet: Proteins were separated by 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred to nitrocellulose (162‐0115, Bio‐Rad, Mississauga, ON, USA), and probed with human‐rat‐cross reactive anti‐Transferrin Receptor antibody (13‐6800, RRID:AB_86623, Thermofisher Scientific, Nepean, ON, USA), followed by the horseradish peroxidase‐conjugated anti‐mouse secondary antibodies (315‐035‐045, RRID:AB_2340066, Jackson ImmunoResearch, West Grove, PA, USA). .. For quantification, blots were stripped using 1 M Tris pH 6.8 (0497, Amresco, Solon, OH, USA), 2% SDS (L4509, Sigma Aldrich, St‐Louis, MO, USA), and 0.7% β‐mercaptoethanol (M7154, Sigma Aldrich, St‐Louis, MO, USA), and were re‐probed with β‐actin‐horseradish peroxidase antibodies (A3854, RRID:AB_262011,Sigma, Oakville, ON, USA).

    Staining:

    Article Title: A transcriptomic atlas of aged human microglia
    Article Snippet: Subsequently the cell suspension is washed twice with staining buffer, filtered through a 70 μm filter and the CD11b+/CD45+/7AAD− cells (Supplementary Figure ) were sorted on a BD FACS Aria II sorter. .. Cells were sorted in A1 well of a 96 well PCR plate (Eppendorf, 951020401) containing 25 μl of TCL buffer (Qiagen, 1031576) with 1% beta mercaptoethanol (Sigma, M3148).

    SDS Page:

    Article Title: ArhGEF37 assists dynamin 2 during clathrin-mediated endocytosis
    Article Snippet: .. SDS/PAGE and western blots Brain tissue lysates (PK-AB718-1403-0/7/14, Promo Kine) and other protein samples were diluted 1:1 with 2×Laemmli buffer containing 125 mM Tris-HCl, 0.005% Brilliant Blue (19598.1, Carl Roth), 20% glycerol, 4% SDS (20765.3, Serva) and 5% β-mercaptoethanol (M-7154, Sigma), incubated for 2 min at 92°C and loaded onto 12% polyacrylamide gel ( http://www.poissonboltzmann.org/ ). .. Primary antibodies used were anti-ArhGEF37 (1:500, HPA043885, Atlas Antibodies), anti-α-tubulin (1:500, 302-211, Synaptic Systems) and anti-HIS6 tag (1:500, 18184, Abcam), incubated overnight at 4°C.

    RNA Extraction:

    Article Title: Maternal High-Fat Diet-Induced Loss of Fetal Oocytes Is Associated with Compromised Follicle Growth in Adult Rat Offspring 1
    Article Snippet: Paragraph title: RNA extraction and reverse transcription. ... Total RNA was extracted from ∼5 mg of frozen, ground ovarian tissue, using the RNeasy mini kit (product 74104; Qiagen) with 350 μl of RLT buffer (1:100 dilution [v:v]; β-mercaptoethanol; product M3148; Sigma-Aldrich) using the manufacturer's instructions.

    Spectrophotometry:

    Article Title: Maternal High-Fat Diet-Induced Loss of Fetal Oocytes Is Associated with Compromised Follicle Growth in Adult Rat Offspring 1
    Article Snippet: Total RNA was extracted from ∼5 mg of frozen, ground ovarian tissue, using the RNeasy mini kit (product 74104; Qiagen) with 350 μl of RLT buffer (1:100 dilution [v:v]; β-mercaptoethanol; product M3148; Sigma-Aldrich) using the manufacturer's instructions. .. RNA quantity and purity were analyzed using a NanoDrop 2000 spectrophotometer; Thermo Scientific).

    Concentration Assay:

    Article Title: Microtubules soften due to cross-sectional flattening
    Article Snippet: .. We prepared NEM-modified tubulin by incubation of unmodified dimers at a concentration of 13 mg/ml with 1 mM NEM (N-Ethylmaleimide, Sigma, E3876) and 0.5 mM GMPCPP (Jena Bioscience, NU-405S) on ice for 10 min and then quenching the reaction with 8 mM beta-mercapthoethanol (Sigma, M6250) for another 10 mins ( ). .. All labeled and unlabeled tubulin monomers were stored at −80 ∘ C.

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: Next, MgCl2 was added to the resulting homogenate to a final concentration of 10 mM and the solution stirred on ice for 20 min. .. In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% ( v / v ) glycerol, 2% ( w / v ) SDS, 0.05% ( v / v ) β-mercaptoethanol (M-7154, Sigma), 0.05% ( w / v ) bromophenol blue (035730, BDH)] and stored at −20°C until use.

    Article Title: Glucagon-Like Peptide-2 and the Enteric Nervous System Are Components of Cell-Cell Communication Pathway Regulating Intestinal Na+/Glucose Co-transport
    Article Snippet: Next, MgCl2 was added to the resulting homogenate to a final concentration of 10 mM and the solution stirred on ice for 20 min. .. In preparation for western blot analysis, aliquots of freshly prepared BBMV were diluted with sample buffer [62.5 mM Tris/HCl pH 6.8, 10% (v /v ) glycerol, 2% (w /v ) SDS, 0.05% (v /v ) β-mercaptoethanol (M-7154, Sigma), 0.05% (w /v ) bromophenol blue (035730, BDH)] and stored at −20°C until use.

    Lysis:

    Article Title: Lamellipodin promotes actin assembly by clustering Ena/VASP proteins and tethering them to actin filaments
    Article Snippet: Cells were lysed into buffer containing 50 mM Na2 PO4 [pH 8], 400 mM NaCl, 0.4 mM BME (Sigma, Cat# M3148-100ML), 1 mM phenylmethanesulfonyl fluoride (Sigma, Cat# P7626-5G), and DNase (Sigma, Cat# DN25-1G) using a microfluidizer. .. High speed supernatant was recirculated over a 5 ml HiTrap chelating column (GE Healthcare, Cat# 17-0409-03) that was charged with 100 mM CoCl2 (Sigma, Cat# 255599), washed with water, and then equilibrated with lysis buffer lacking protease inhibitors and DNase.

    Article Title: Assessment of BOLD and GenBank – Their accuracy and reliability for the identification of biological materials
    Article Snippet: .. Immediately prior to extraction, 0.04 g/mL polyvinylpyrrolidone (PVP; molecular weight of 360,000; Sigma-Aldrich [P5288]), 0.4% Proteinase K (20 mg/mL; VWR International [E195]), and 0.5% β-mercaptoethanol (Sigma-Aldrich [M3148]) was added to the CTAB lysis buffer, which was subsequently placed in a 56°C water bath for ~15 min to facilitate the dissolution of PVP. .. A total of 500 μL of the CTAB lysis buffer was added to the finely ground tissue and incubated in a 65°C shaking water bath for 1 hr.

    FACS:

    Article Title: A transcriptomic atlas of aged human microglia
    Article Snippet: Subsequently the cell suspension is washed twice with staining buffer, filtered through a 70 μm filter and the CD11b+/CD45+/7AAD− cells (Supplementary Figure ) were sorted on a BD FACS Aria II sorter. .. Cells were sorted in A1 well of a 96 well PCR plate (Eppendorf, 951020401) containing 25 μl of TCL buffer (Qiagen, 1031576) with 1% beta mercaptoethanol (Sigma, M3148).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Millipore buffer a
    Kinetic analysis of editing of HNV by ThrRS at 37 °C and pH 8. All reactions were performed using HNV as the substrate. Panel (A), linear rate of AMP formation in the presence (open circles) and absence (filled circles) of tRNA Thr . Panel (B), enzyme-independent hydrolysis of HNV-AMP in Buffer A. Panels (C) and (D), rate of deacylation of HNV-[ 32 P] tRNA Thr  in the presence and absence of wild type ThrRS, respectively.
    Buffer A, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/buffer a/product/Millipore
    Average 95 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    buffer a - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    79
    Millipore noc 7
    Depletion of kinesin-5 reduces the distance of axonal retraction. (A and B) DIC images of control axons (A) and kinesin-5–depleted axons (B) before and 30 min after treatment with 0.3 mM <t>noc-7.</t> (B) Kinesin-5–depleted axons continue to elongate even in the presence of noc-7. Arrows demarcate the distal tips of growth cones before and after noc-7 treatment. (C) Quantitative analysis of noc-7–induced axonal retraction revealed a statistically significant reduction in mean distance retracted in neurons depleted of kinesin-5 (mean ± SEM; control, n = 54; kinesin-5 siRNA, n = 55; *, P = 0.011). Bar, 20 μm.
    Noc 7, supplied by Millipore, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/noc 7/product/Millipore
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    noc 7 - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    94
    Millipore ksr medium
    LCD shows direct differentiation outcomes of <t>H9</t> cells seeded at different densities A-D , Undifferentiated H9 cells with localized high cell density were subjected to IF using anti-PAX6 (A and D) and anti-OCT4 (B and D) antibodies. E-L , H9 cells seeded at low density (8×10 3 cells/ cm 2 ) (E-H) and high density (1×10 4 cells/ cm 2 ) (I-L) were treated with <t>KSR</t> and N2 medium supplemented with noggin and SB431542 for 5 days. The cells were then subjected to the IF assay using anti-PAX6 antibody (green, E, H, I and L) and anti-OCT4 antibody (red, F, H, J and L) in the H9-derived cells. M, The areas of the signals in the OCT4, PAX6 and DAPI channels were calculated using Image J software. The ratios of the OCT4 and PAX6 area to DAPI area are shown (X±SD, n=8; *, P
    Ksr Medium, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ksr medium/product/Millipore
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ksr medium - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    98
    Millipore laemmli buffer
    Immunoreactivity of antibody against rat SGLT2 (rSGLT2-Ab) in kidneys and small intestine of female rats. A : optimal conditions for Western blots with total cell membranes (TCM) from rat kidney cortex. For SDS-PAGE, isolated TCM were prepared in <t>Laemmli</t>
    Laemmli Buffer, supplied by Millipore, used in various techniques. Bioz Stars score: 98/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/laemmli buffer/product/Millipore
    Average 98 stars, based on 92 article reviews
    Price from $9.99 to $1999.99
    laemmli buffer - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    Image Search Results


    Kinetic analysis of editing of HNV by ThrRS at 37 °C and pH 8. All reactions were performed using HNV as the substrate. Panel (A), linear rate of AMP formation in the presence (open circles) and absence (filled circles) of tRNA Thr . Panel (B), enzyme-independent hydrolysis of HNV-AMP in Buffer A. Panels (C) and (D), rate of deacylation of HNV-[ 32 P] tRNA Thr  in the presence and absence of wild type ThrRS, respectively.

    Journal: Biochemistry

    Article Title: Fidelity escape by the unnatural amino acid ?-hydroxynorvaline: an efficient substrate for Escherichia coli threonyl-tRNA synthetase with toxic effects on growth †

    doi: 10.1021/bi101360a

    Figure Lengend Snippet: Kinetic analysis of editing of HNV by ThrRS at 37 °C and pH 8. All reactions were performed using HNV as the substrate. Panel (A), linear rate of AMP formation in the presence (open circles) and absence (filled circles) of tRNA Thr . Panel (B), enzyme-independent hydrolysis of HNV-AMP in Buffer A. Panels (C) and (D), rate of deacylation of HNV-[ 32 P] tRNA Thr in the presence and absence of wild type ThrRS, respectively.

    Article Snippet: For both proteins, the final fractions were pooled, dialyzed against Buffer A (10 mM Tris pH 8.0, 100 mM KCl, 10 mM MgCl2 , 3 mM β-mercaptoethanol), and then concentrated under low speed centrifugation using Millipore concentrators, prior to storage in 50% glycerol at −20 °C.

    Techniques:

    Depletion of kinesin-5 reduces the distance of axonal retraction. (A and B) DIC images of control axons (A) and kinesin-5–depleted axons (B) before and 30 min after treatment with 0.3 mM noc-7. (B) Kinesin-5–depleted axons continue to elongate even in the presence of noc-7. Arrows demarcate the distal tips of growth cones before and after noc-7 treatment. (C) Quantitative analysis of noc-7–induced axonal retraction revealed a statistically significant reduction in mean distance retracted in neurons depleted of kinesin-5 (mean ± SEM; control, n = 54; kinesin-5 siRNA, n = 55; *, P = 0.011). Bar, 20 μm.

    Journal: The Journal of Cell Biology

    Article Title: Kinesin-5 regulates the growth of the axon by acting as a brake on its microtubule array

    doi: 10.1083/jcb.200702074

    Figure Lengend Snippet: Depletion of kinesin-5 reduces the distance of axonal retraction. (A and B) DIC images of control axons (A) and kinesin-5–depleted axons (B) before and 30 min after treatment with 0.3 mM noc-7. (B) Kinesin-5–depleted axons continue to elongate even in the presence of noc-7. Arrows demarcate the distal tips of growth cones before and after noc-7 treatment. (C) Quantitative analysis of noc-7–induced axonal retraction revealed a statistically significant reduction in mean distance retracted in neurons depleted of kinesin-5 (mean ± SEM; control, n = 54; kinesin-5 siRNA, n = 55; *, P = 0.011). Bar, 20 μm.

    Article Snippet: DIC images of axons were recorded before and 30 min after addition of noc-7.

    Techniques:

    LCD shows direct differentiation outcomes of H9 cells seeded at different densities A-D , Undifferentiated H9 cells with localized high cell density were subjected to IF using anti-PAX6 (A and D) and anti-OCT4 (B and D) antibodies. E-L , H9 cells seeded at low density (8×10 3 cells/ cm 2 ) (E-H) and high density (1×10 4 cells/ cm 2 ) (I-L) were treated with KSR and N2 medium supplemented with noggin and SB431542 for 5 days. The cells were then subjected to the IF assay using anti-PAX6 antibody (green, E, H, I and L) and anti-OCT4 antibody (red, F, H, J and L) in the H9-derived cells. M, The areas of the signals in the OCT4, PAX6 and DAPI channels were calculated using Image J software. The ratios of the OCT4 and PAX6 area to DAPI area are shown (X±SD, n=8; *, P

    Journal: Biochemical and biophysical research communications

    Article Title: Synergistic contribution of SMAD signaling blockade and high localized cell density in the differentiation of neuroectoderm from H9 cells

    doi: 10.1016/j.bbrc.2014.08.137

    Figure Lengend Snippet: LCD shows direct differentiation outcomes of H9 cells seeded at different densities A-D , Undifferentiated H9 cells with localized high cell density were subjected to IF using anti-PAX6 (A and D) and anti-OCT4 (B and D) antibodies. E-L , H9 cells seeded at low density (8×10 3 cells/ cm 2 ) (E-H) and high density (1×10 4 cells/ cm 2 ) (I-L) were treated with KSR and N2 medium supplemented with noggin and SB431542 for 5 days. The cells were then subjected to the IF assay using anti-PAX6 antibody (green, E, H, I and L) and anti-OCT4 antibody (red, F, H, J and L) in the H9-derived cells. M, The areas of the signals in the OCT4, PAX6 and DAPI channels were calculated using Image J software. The ratios of the OCT4 and PAX6 area to DAPI area are shown (X±SD, n=8; *, P

    Article Snippet: Briefly, H9 cells were cultured on MEFs in KSR medium (DMEM/F12, 20 % KSR, 0.1 mM β-mercaptoethanol, 10 ng/ml of FGF-2) and disaggregated using accutase (Millipore, Billerica, MA, USA) for 20 min, washed with KSR medium and pre-plated on gelatin-coated 6-well plates for 1 h at 37 °C in the presence of the ROCK inhibitor (Y-27632) to remove MEFs.

    Techniques: Derivative Assay, Software

    Synergistic contribution of SMAD signaling blockers and localized high cell density in NE differentiation A-F, Five days after the cell-clump-based differentiation of NE in KSR and N2 medium with (D-F) or without (A-C) SMAD signaling blockers, H9-derived cells were subjected to the IF assay using anti-PAX6 antibody (green, A-D). The nuclei were stained using DAPI (blue, C and D). The micrographs were divided into 20 (5×4) squares as indicated (C and D). E-F , The number of total cells and PAX6-positive cells in each square was quantified using Image J software. The ratio of PAX6-positive cells to total cells in each square was determined. The squares with equivalent ratios were binned together. The ratios of PAX6-positive cells to total cells in each bin are shown (F, X±SD, **P

    Journal: Biochemical and biophysical research communications

    Article Title: Synergistic contribution of SMAD signaling blockade and high localized cell density in the differentiation of neuroectoderm from H9 cells

    doi: 10.1016/j.bbrc.2014.08.137

    Figure Lengend Snippet: Synergistic contribution of SMAD signaling blockers and localized high cell density in NE differentiation A-F, Five days after the cell-clump-based differentiation of NE in KSR and N2 medium with (D-F) or without (A-C) SMAD signaling blockers, H9-derived cells were subjected to the IF assay using anti-PAX6 antibody (green, A-D). The nuclei were stained using DAPI (blue, C and D). The micrographs were divided into 20 (5×4) squares as indicated (C and D). E-F , The number of total cells and PAX6-positive cells in each square was quantified using Image J software. The ratio of PAX6-positive cells to total cells in each square was determined. The squares with equivalent ratios were binned together. The ratios of PAX6-positive cells to total cells in each bin are shown (F, X±SD, **P

    Article Snippet: Briefly, H9 cells were cultured on MEFs in KSR medium (DMEM/F12, 20 % KSR, 0.1 mM β-mercaptoethanol, 10 ng/ml of FGF-2) and disaggregated using accutase (Millipore, Billerica, MA, USA) for 20 min, washed with KSR medium and pre-plated on gelatin-coated 6-well plates for 1 h at 37 °C in the presence of the ROCK inhibitor (Y-27632) to remove MEFs.

    Techniques: Derivative Assay, Staining, Software

    Immunoreactivity of antibody against rat SGLT2 (rSGLT2-Ab) in kidneys and small intestine of female rats. A : optimal conditions for Western blots with total cell membranes (TCM) from rat kidney cortex. For SDS-PAGE, isolated TCM were prepared in Laemmli

    Journal: American Journal of Physiology - Cell Physiology

    Article Title: Expression of Na+-d-glucose cotransporter SGLT2 in rodents is kidney-specific and exhibits sex and species differences

    doi: 10.1152/ajpcell.00450.2011

    Figure Lengend Snippet: Immunoreactivity of antibody against rat SGLT2 (rSGLT2-Ab) in kidneys and small intestine of female rats. A : optimal conditions for Western blots with total cell membranes (TCM) from rat kidney cortex. For SDS-PAGE, isolated TCM were prepared in Laemmli

    Article Snippet: Denaturation of membrane samples in Laemmli buffer [±β-mercaptoethanol (β-ME)] and heating at different temperatures (37°C for 30 min, 65°C for 15 min, 95°C for 5 min), separation of the proteins through 10% SDS-PAGE minigels, as well as electrophoretic wet transfer to an Immobilon membrane (Millipore, Bedford, MA) were performed as described previously ( , ).

    Techniques: Western Blot, SDS Page, Isolation