1x polymerase chain reaction pcr buffer  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    PCR Buffer
    Description:
    Composition of the 10x PCR Buffer II 100 mM Tris HCl pH 8 3 at 25C 500 mM KCl 0 01 gelatin
    Catalog Number:
    pcrii
    Price:
    None
    Applications:
    The PCR Buffer, diluted to 1x, provides the recommended pH and ionic strength. The MgCl2 can be used to optimize the Mg2+ concentration for PCR with any template/primer set.
    Buy from Supplier


    Structured Review

    Millipore 1x polymerase chain reaction pcr buffer
    Composition of the 10x PCR Buffer II 100 mM Tris HCl pH 8 3 at 25C 500 mM KCl 0 01 gelatin
    https://www.bioz.com/result/1x polymerase chain reaction pcr buffer/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1x polymerase chain reaction pcr buffer - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Optimization of experimental design parameters for high-throughput chromatin immunoprecipitation studies
    Article Snippet: .. Each 12 µl quantitative PCR reaction was composed of the following: 2 µl of the DNA isolated in the ChIP, 1x PCR Buffer, 2.5 mM MgCl2 , 0.17 mM dNTP mix, sterile water, 0.25× SYBR Green (Sigma S9430), 0.2 µl Rox reference dye (Invitrogen 12223-012) and 0.05 µl Platinum Taq DNA polymerase (Invitrogen 10966-034) and was performed in triplicate in a 384-well plate. .. The reactions began at 50°C for 2 min and then were activated at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Human male genomic DNA (Novagen 70572) was used as standard real-time Q-PCR was conducted in triplicates for each of the three independent biological replicates.

    Amplification:

    Article Title: Assessment of genetic variations among highly endangered medicinal plant Bacopa monnieri (L.) from Central India using RAPD and ISSR analysis
    Article Snippet: .. Each sample was amplified in a reaction mixture containing 50 ng genomic DNA, Taq polymerase 1 unit (Sigma Co., USA), 10× PCR buffer with 2.5 mM MgCl2 and 200 μM of each dNTP mixture (Sigma Co., USA), 15 pmol of 10-mer RAPD and ISSR primers (Operon Technologies, USA; Table ). .. Cycling parameters for ISSR were adjusted to 5 min at 94 °C for pre-denaturation, 39 cycles each of 1 min at 94 °C for denaturation, 1 min for annealing at 45/50/55 °C, 2 min at 72 °C for extension and a final extension at 72 °C for 5 min. For RAPD marker analysis, the PCR reaction mix and program profile were similar to ISSR markers analysis except the annealing temperature which was adjusted to 37 °C.

    Article Title: Immunodominant Major Outer Membrane Proteins of Ehrlichia chaffeensis Are Encoded by a Polymorphic Multigene Family
    Article Snippet: .. The 0.8-kb p28 gene was excised from the clone pCRII p28 by Eco RI- Not I double digestion, ligated into Eco RI- Not I sites of a pET 29a expression vector, and amplified in Escherichia coli BL21(DE3)pLysS (Novagen, Inc., Madison, Wis.). .. The clone (designated pET29 p28 ) produced a fusion protein with a 35-amino-acid sequence carried from the vector at the N terminus.

    Article Title: DNA barcoding of authentic and substitute samples of herb of the family Asparagaceae and Asclepiadaceae based on the ITS2 region
    Article Snippet: .. [ ] PCR amplification was performed in 25 μl reaction mixtures containing approximately 40 ng template DNA, 1 X PCR buffer, 1.5 mM MgCl2 , 0.2 mM of each dNTP, 0.1 μM of each primers (Sigma Proligo and Sigma Life Science, India), and 1.0 U Taq DNA Polymerase (Invitrogen) in a thermal cycler (Eppendorf, Germany). .. The primer sequences and PCR reaction conditions used for PCR amplification are listed in .

    Isolation:

    Article Title: Optimization of experimental design parameters for high-throughput chromatin immunoprecipitation studies
    Article Snippet: .. Each 12 µl quantitative PCR reaction was composed of the following: 2 µl of the DNA isolated in the ChIP, 1x PCR Buffer, 2.5 mM MgCl2 , 0.17 mM dNTP mix, sterile water, 0.25× SYBR Green (Sigma S9430), 0.2 µl Rox reference dye (Invitrogen 12223-012) and 0.05 µl Platinum Taq DNA polymerase (Invitrogen 10966-034) and was performed in triplicate in a 384-well plate. .. The reactions began at 50°C for 2 min and then were activated at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Human male genomic DNA (Novagen 70572) was used as standard real-time Q-PCR was conducted in triplicates for each of the three independent biological replicates.

    SYBR Green Assay:

    Article Title: Optimization of experimental design parameters for high-throughput chromatin immunoprecipitation studies
    Article Snippet: .. Each 12 µl quantitative PCR reaction was composed of the following: 2 µl of the DNA isolated in the ChIP, 1x PCR Buffer, 2.5 mM MgCl2 , 0.17 mM dNTP mix, sterile water, 0.25× SYBR Green (Sigma S9430), 0.2 µl Rox reference dye (Invitrogen 12223-012) and 0.05 µl Platinum Taq DNA polymerase (Invitrogen 10966-034) and was performed in triplicate in a 384-well plate. .. The reactions began at 50°C for 2 min and then were activated at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Human male genomic DNA (Novagen 70572) was used as standard real-time Q-PCR was conducted in triplicates for each of the three independent biological replicates.

    Positron Emission Tomography:

    Article Title: Immunodominant Major Outer Membrane Proteins of Ehrlichia chaffeensis Are Encoded by a Polymorphic Multigene Family
    Article Snippet: .. The 0.8-kb p28 gene was excised from the clone pCRII p28 by Eco RI- Not I double digestion, ligated into Eco RI- Not I sites of a pET 29a expression vector, and amplified in Escherichia coli BL21(DE3)pLysS (Novagen, Inc., Madison, Wis.). .. The clone (designated pET29 p28 ) produced a fusion protein with a 35-amino-acid sequence carried from the vector at the N terminus.

    Expressing:

    Article Title: Immunodominant Major Outer Membrane Proteins of Ehrlichia chaffeensis Are Encoded by a Polymorphic Multigene Family
    Article Snippet: .. The 0.8-kb p28 gene was excised from the clone pCRII p28 by Eco RI- Not I double digestion, ligated into Eco RI- Not I sites of a pET 29a expression vector, and amplified in Escherichia coli BL21(DE3)pLysS (Novagen, Inc., Madison, Wis.). .. The clone (designated pET29 p28 ) produced a fusion protein with a 35-amino-acid sequence carried from the vector at the N terminus.

    Polymerase Chain Reaction:

    Article Title: Assessment of genetic variations among highly endangered medicinal plant Bacopa monnieri (L.) from Central India using RAPD and ISSR analysis
    Article Snippet: .. Each sample was amplified in a reaction mixture containing 50 ng genomic DNA, Taq polymerase 1 unit (Sigma Co., USA), 10× PCR buffer with 2.5 mM MgCl2 and 200 μM of each dNTP mixture (Sigma Co., USA), 15 pmol of 10-mer RAPD and ISSR primers (Operon Technologies, USA; Table ). .. Cycling parameters for ISSR were adjusted to 5 min at 94 °C for pre-denaturation, 39 cycles each of 1 min at 94 °C for denaturation, 1 min for annealing at 45/50/55 °C, 2 min at 72 °C for extension and a final extension at 72 °C for 5 min. For RAPD marker analysis, the PCR reaction mix and program profile were similar to ISSR markers analysis except the annealing temperature which was adjusted to 37 °C.

    Article Title: Chromosomal reinsertion of broken RSS ends during T cell development
    Article Snippet: .. Plugs were rinsed with TE (10 mM Tris-HCl, pH 8.0, and 0.1mM EDTA) and digested genomic DNA was mixed with 1× PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , and 0.001% gelatin), 0.2 mM dNTPs, 175 pmol of a 5′-biotinylated oligonucleotide (Table S1, available at http://www.jem.org/cgi/content/full/jem.20070583/DC1 ), and 20 U of a hot-start Taq polymerase (JumpStart; Sigma-Aldrich) in a final volume of 800 μl. .. The mixture was denatured at 95°C and the primer extension reaction was incubated at 68°C for 1 h, and then terminated by the addition of 2.5 μl of 500 mM EDTA, pH 8.0, and chilled on ice for 10 min.

    Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
    Article Snippet: .. PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA). .. The PCR tubes with all the components were transferred to thermal cycler (Eppendorf Master Cycler, Germany).

    Article Title: Insulin-like Growth Factor Binding Protein-3 Expression in the Human Corneal Epithelium
    Article Snippet: .. A 50 μl PCR reaction was performed as follows: 5 μmol/l each primer, 0.20 mM dNTPs, 5 μl of 10× PCR buffer (Sigma, St. Louis, MO), 7.5 mM MgCl2 (Sigma, St. Louis, MO), 1.0 μl Taq DNA Polymerase (5U/μl, Sigma, St. Louis, MO), and 2 μl cDNA. .. Gene specific primers were used to amplify the full length IGFBP3 coding sequence: forward 5′ ATGCAGCGGGCGCGAC 3′ and reverse 5′ CTACTTGCTCTGCATGCTGTAGCA 3′ with melting temperatures of 62.9°C and 59.2°C, respectively.

    Article Title: DNA barcoding of authentic and substitute samples of herb of the family Asparagaceae and Asclepiadaceae based on the ITS2 region
    Article Snippet: .. [ ] PCR amplification was performed in 25 μl reaction mixtures containing approximately 40 ng template DNA, 1 X PCR buffer, 1.5 mM MgCl2 , 0.2 mM of each dNTP, 0.1 μM of each primers (Sigma Proligo and Sigma Life Science, India), and 1.0 U Taq DNA Polymerase (Invitrogen) in a thermal cycler (Eppendorf, Germany). .. The primer sequences and PCR reaction conditions used for PCR amplification are listed in .

    Article Title: Optimization of experimental design parameters for high-throughput chromatin immunoprecipitation studies
    Article Snippet: .. Each 12 µl quantitative PCR reaction was composed of the following: 2 µl of the DNA isolated in the ChIP, 1x PCR Buffer, 2.5 mM MgCl2 , 0.17 mM dNTP mix, sterile water, 0.25× SYBR Green (Sigma S9430), 0.2 µl Rox reference dye (Invitrogen 12223-012) and 0.05 µl Platinum Taq DNA polymerase (Invitrogen 10966-034) and was performed in triplicate in a 384-well plate. .. The reactions began at 50°C for 2 min and then were activated at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Human male genomic DNA (Novagen 70572) was used as standard real-time Q-PCR was conducted in triplicates for each of the three independent biological replicates.

    Article Title: Preliminary data on the presence of an alternate vanadium nitrogenase in a culturable cyanobiont of Azolla pinnata R. Brown: Implications on Chronic Kidney Disease of an unknown etiology (CKDu)
    Article Snippet: .. The PCR reaction mixture was prepared using template DNA, 10× PCR buffer (SIGMA-ALDRICH, containing 15 mM Mgcl2), dNTPs, Forward and reverse primers, Taq DNA polymerase and sterile nuclease free water as given in the table below. .. Each PCR amplification consisted of an initial denaturation step at 94 °C for 1 min followed by a process of 35 cycles consisted of three steps namely, a denaturation step at 94 °C for 30 s, annealing step at 43.4 °C for 30 s and extension step at 72 °C for 2 min. At the end of the final cycle, final extension was carried out at a temperature of 72 °C for 10 min, with subsequent holding temperature at 4 °C.

    Chromatin Immunoprecipitation:

    Article Title: Optimization of experimental design parameters for high-throughput chromatin immunoprecipitation studies
    Article Snippet: .. Each 12 µl quantitative PCR reaction was composed of the following: 2 µl of the DNA isolated in the ChIP, 1x PCR Buffer, 2.5 mM MgCl2 , 0.17 mM dNTP mix, sterile water, 0.25× SYBR Green (Sigma S9430), 0.2 µl Rox reference dye (Invitrogen 12223-012) and 0.05 µl Platinum Taq DNA polymerase (Invitrogen 10966-034) and was performed in triplicate in a 384-well plate. .. The reactions began at 50°C for 2 min and then were activated at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Human male genomic DNA (Novagen 70572) was used as standard real-time Q-PCR was conducted in triplicates for each of the three independent biological replicates.

    Plasmid Preparation:

    Article Title: Immunodominant Major Outer Membrane Proteins of Ehrlichia chaffeensis Are Encoded by a Polymorphic Multigene Family
    Article Snippet: .. The 0.8-kb p28 gene was excised from the clone pCRII p28 by Eco RI- Not I double digestion, ligated into Eco RI- Not I sites of a pET 29a expression vector, and amplified in Escherichia coli BL21(DE3)pLysS (Novagen, Inc., Madison, Wis.). .. The clone (designated pET29 p28 ) produced a fusion protein with a 35-amino-acid sequence carried from the vector at the N terminus.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore pcr
    Pcr, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 11795 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr/product/Millipore
    Average 99 stars, based on 11795 article reviews
    Price from $9.99 to $1999.99
    pcr - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Millipore 1x kod xl dna polymerase buffer
    1x Kod Xl Dna Polymerase Buffer, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x kod xl dna polymerase buffer/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1x kod xl dna polymerase buffer - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results