recombinant human glycosylated ifnγ  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    Interferon Gamma Protein Human Recombinant
    Description:
    A DNA sequence encoding the human γ IFN NP 000610 2 Met 1 Gln 166 was expressed and purified
    Catalog Number:
    11725-HNAS
    Price:
    None
    Category:
    recombinant protein
    Product Aliases:
    IFG Protein Human, IFI Protein Human, IFN gamma Protein Human, Interferon Gamma Protein Human
    Host:
    CHO Stable Cells
    Buy from Supplier


    Structured Review

    Sino Biological recombinant human glycosylated ifnγ
    Scheme summarizing the main protumoral effects known for galectin-3 in the tumor microenvironment. Galectin-3 has been described to immobilize <t>glycosylated</t> proteins on the surface of T cells 28 , 30 , 31 , 32 , 33 , <t>IFNγ</t> receptor on human fibroblasts and B cells 53 , and VEGF receptor in human endothelial cells 27 . In addition, galectin-3 favors collagen deposition by macrophages 48 and tumor cell migration 54 . This figure does not intend to make an exhaustive review about all the effects published for galectin-3 but to highlight the ones that, in our opinion, can be working simultaneously in the tumor microenvironment
    A DNA sequence encoding the human γ IFN NP 000610 2 Met 1 Gln 166 was expressed and purified
    https://www.bioz.com/result/recombinant human glycosylated ifnγ/product/Sino Biological
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant human glycosylated ifnγ - by Bioz Stars, 2021-04
    93/100 stars

    Images

    1) Product Images from "Galectin-3 captures interferon-gamma in the tumor matrix reducing chemokine gradient production and T-cell tumor infiltration"

    Article Title: Galectin-3 captures interferon-gamma in the tumor matrix reducing chemokine gradient production and T-cell tumor infiltration

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00925-6

    Scheme summarizing the main protumoral effects known for galectin-3 in the tumor microenvironment. Galectin-3 has been described to immobilize glycosylated proteins on the surface of T cells 28 , 30 , 31 , 32 , 33 , IFNγ receptor on human fibroblasts and B cells 53 , and VEGF receptor in human endothelial cells 27 . In addition, galectin-3 favors collagen deposition by macrophages 48 and tumor cell migration 54 . This figure does not intend to make an exhaustive review about all the effects published for galectin-3 but to highlight the ones that, in our opinion, can be working simultaneously in the tumor microenvironment
    Figure Legend Snippet: Scheme summarizing the main protumoral effects known for galectin-3 in the tumor microenvironment. Galectin-3 has been described to immobilize glycosylated proteins on the surface of T cells 28 , 30 , 31 , 32 , 33 , IFNγ receptor on human fibroblasts and B cells 53 , and VEGF receptor in human endothelial cells 27 . In addition, galectin-3 favors collagen deposition by macrophages 48 and tumor cell migration 54 . This figure does not intend to make an exhaustive review about all the effects published for galectin-3 but to highlight the ones that, in our opinion, can be working simultaneously in the tumor microenvironment

    Techniques Used: Migration

    Binding of human glycosylated cytokines to galectin-3-coated beads. Ratio refers to molar ratio. a hIFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. The glycosylated IFNγ was produced in CHO cells and the unglycosylated IFNγ was produced in E. coli . Mean ± SD of one representative experiment of 8 (glycosylated IFNγ) or 2 (unglycosylated IFNγ), performed in duplicates. The dotted line stresses that more than 90% of the glycosylated IFNγ was retained when mixed with 10 times more galectin-3-coated beads. b Glycosylated IFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads and different galectin antagonists (LacNAc 5 mM, TetraLacNAc 30 μM, GM-CT-01 100 μg ml −1 ), anti-galectin-3 antibody or a control isotype (10 μg ml −1 ). Mean ± SD of one representative experiment of three. c Glycosylated hIL-12 measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Mean ± SD of one representative experiment of three, performed in duplicates. d Cytokines and chemokines measured in a human synovial fluid collected from a rheumatoid arthritis patient after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Note: glycosylated cytokines and chemokines were entirely glycosylated, containing no detectable unglycosylated fraction
    Figure Legend Snippet: Binding of human glycosylated cytokines to galectin-3-coated beads. Ratio refers to molar ratio. a hIFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. The glycosylated IFNγ was produced in CHO cells and the unglycosylated IFNγ was produced in E. coli . Mean ± SD of one representative experiment of 8 (glycosylated IFNγ) or 2 (unglycosylated IFNγ), performed in duplicates. The dotted line stresses that more than 90% of the glycosylated IFNγ was retained when mixed with 10 times more galectin-3-coated beads. b Glycosylated IFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads and different galectin antagonists (LacNAc 5 mM, TetraLacNAc 30 μM, GM-CT-01 100 μg ml −1 ), anti-galectin-3 antibody or a control isotype (10 μg ml −1 ). Mean ± SD of one representative experiment of three. c Glycosylated hIL-12 measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Mean ± SD of one representative experiment of three, performed in duplicates. d Cytokines and chemokines measured in a human synovial fluid collected from a rheumatoid arthritis patient after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Note: glycosylated cytokines and chemokines were entirely glycosylated, containing no detectable unglycosylated fraction

    Techniques Used: Binding Assay, Enzyme-linked Immunosorbent Assay, Incubation, Produced

    Reduced diffusion of glycosylated human IFNγ and IL-12 through galectin-3-loaded collagen matrices. a Schematic drawing of the protocol. Galectin-3 (1 μg per transwell), IFNγ (25 ng per transwell), IL-12 (7 ng per transwell), and LacNAc (1.2 mg per transwell). b IFNγ diffusion through collagen in 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.006; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test. c IL-12 diffusion through collagen after 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.032; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test
    Figure Legend Snippet: Reduced diffusion of glycosylated human IFNγ and IL-12 through galectin-3-loaded collagen matrices. a Schematic drawing of the protocol. Galectin-3 (1 μg per transwell), IFNγ (25 ng per transwell), IL-12 (7 ng per transwell), and LacNAc (1.2 mg per transwell). b IFNγ diffusion through collagen in 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.006; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test. c IL-12 diffusion through collagen after 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.032; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test

    Techniques Used: Diffusion-based Assay, Enzyme-linked Immunosorbent Assay

    2) Product Images from "Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes"

    Article Title: Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2020.568741

    CII-CAR-T display specific cytokine release when co-cultured by C28/I2 cell line.  (A)  Immunofluorescence staining images show the expression of CII (red) and merged images (with DAPI, blue) in C28/I2.  (B–E)  Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon with C28/I2 and assayed for IL-2, IL-6, TNF-α, and IFN- γ  release by CBA.  (F, G)  CII-CAR-T or Tcon cells (1 × 10 5 ) were labeled with Far Red, then co-cultured with C28/I2 cells in the absence of CD3/28 mAbs and IL-2 for 3 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T or T cells was analyzed by flow cytometry. *p
    Figure Legend Snippet: CII-CAR-T display specific cytokine release when co-cultured by C28/I2 cell line. (A) Immunofluorescence staining images show the expression of CII (red) and merged images (with DAPI, blue) in C28/I2. (B–E) Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon with C28/I2 and assayed for IL-2, IL-6, TNF-α, and IFN- γ release by CBA. (F, G) CII-CAR-T or Tcon cells (1 × 10 5 ) were labeled with Far Red, then co-cultured with C28/I2 cells in the absence of CD3/28 mAbs and IL-2 for 3 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T or T cells was analyzed by flow cytometry. *p

    Techniques Used: Cell Culture, Immunofluorescence, Staining, Expressing, Co-Culture Assay, Crocin Bleaching Assay, Labeling, Flow Cytometry

    CII-CAR-T cells display specific cytokine release and proliferative capacity when stimulated by CII.  (A–F)  Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon in the presence of type I (50 μg/ml) or II collagen (50 μg/ml) and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, IFN- γ  release by CBA. IL-2, TNF-α, and IFN- γ  release were significantly increased compared with control group. Data are represented as mean ± SE of three independent experiments, *p
    Figure Legend Snippet: CII-CAR-T cells display specific cytokine release and proliferative capacity when stimulated by CII. (A–F) Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon in the presence of type I (50 μg/ml) or II collagen (50 μg/ml) and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, IFN- γ release by CBA. IL-2, TNF-α, and IFN- γ release were significantly increased compared with control group. Data are represented as mean ± SE of three independent experiments, *p

    Techniques Used: Co-Culture Assay, Crocin Bleaching Assay

    Human fresh cartilage and C28/I2 produce IL-6 when stimulated by CAR-T supernatants or cytokines.  (A)  Schematic representation of human fresh or FT-cartilage and C28/I2 were stimulated by CAR-T supernatants or cytokines.  (B)  Fresh or FT-cartilage was treated with supernatants of CII-CAR-T cells (CAR-T sup) or T cells (T sup) for 24 h, and IL-6 release was assayed by CBA.  (C)  IL-6 release in pretreatment groups was assayed by CBA.  (D)  IL-6 level produced by fresh or FT-cartilage when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ  for 24 h.  (E)  IL-6 level produced by C28/I2 and 293T cells when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ  for 24 h. Spontaneous release of cytokines by cartilage or C28/I2 was used as control. *p
    Figure Legend Snippet: Human fresh cartilage and C28/I2 produce IL-6 when stimulated by CAR-T supernatants or cytokines. (A) Schematic representation of human fresh or FT-cartilage and C28/I2 were stimulated by CAR-T supernatants or cytokines. (B) Fresh or FT-cartilage was treated with supernatants of CII-CAR-T cells (CAR-T sup) or T cells (T sup) for 24 h, and IL-6 release was assayed by CBA. (C) IL-6 release in pretreatment groups was assayed by CBA. (D) IL-6 level produced by fresh or FT-cartilage when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ for 24 h. (E) IL-6 level produced by C28/I2 and 293T cells when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ for 24 h. Spontaneous release of cytokines by cartilage or C28/I2 was used as control. *p

    Techniques Used: Crocin Bleaching Assay, Produced

    CII-CAR-T cells display specific cytokine release when stimulated by human fresh or FT-cartilage.  (A–F) . Supernatants were collected after 24 h co-culture of CII-CAR-T cells or T con with fresh or FT-cartilage and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, and IFN- γ  release by CBA.  (G–H)  CII-CAR-T or T cells (1 × 10 5  cells) were labeled with Far Red, then co-cultured with fresh or FT-cartilage in the absence of CD3/28 mAbs and IL-2 for 4 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T cells or T cells was analyzed by flow cytometry. *p
    Figure Legend Snippet: CII-CAR-T cells display specific cytokine release when stimulated by human fresh or FT-cartilage. (A–F) . Supernatants were collected after 24 h co-culture of CII-CAR-T cells or T con with fresh or FT-cartilage and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, and IFN- γ release by CBA. (G–H) CII-CAR-T or T cells (1 × 10 5 cells) were labeled with Far Red, then co-cultured with fresh or FT-cartilage in the absence of CD3/28 mAbs and IL-2 for 4 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T cells or T cells was analyzed by flow cytometry. *p

    Techniques Used: Co-Culture Assay, Crocin Bleaching Assay, Labeling, Cell Culture, Flow Cytometry

    3) Product Images from "Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes"

    Article Title: Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2020.568741

    CII-CAR-T display specific cytokine release when co-cultured by C28/I2 cell line.  (A)  Immunofluorescence staining images show the expression of CII (red) and merged images (with DAPI, blue) in C28/I2.  (B–E)  Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon with C28/I2 and assayed for IL-2, IL-6, TNF-α, and IFN- γ  release by CBA.  (F, G)  CII-CAR-T or Tcon cells (1 × 10 5 ) were labeled with Far Red, then co-cultured with C28/I2 cells in the absence of CD3/28 mAbs and IL-2 for 3 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T or T cells was analyzed by flow cytometry. *p
    Figure Legend Snippet: CII-CAR-T display specific cytokine release when co-cultured by C28/I2 cell line. (A) Immunofluorescence staining images show the expression of CII (red) and merged images (with DAPI, blue) in C28/I2. (B–E) Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon with C28/I2 and assayed for IL-2, IL-6, TNF-α, and IFN- γ release by CBA. (F, G) CII-CAR-T or Tcon cells (1 × 10 5 ) were labeled with Far Red, then co-cultured with C28/I2 cells in the absence of CD3/28 mAbs and IL-2 for 3 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T or T cells was analyzed by flow cytometry. *p

    Techniques Used: Cell Culture, Immunofluorescence, Staining, Expressing, Co-Culture Assay, Crocin Bleaching Assay, Labeling, Flow Cytometry

    CII-CAR-T cells display specific cytokine release and proliferative capacity when stimulated by CII.  (A–F)  Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon in the presence of type I (50 μg/ml) or II collagen (50 μg/ml) and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, IFN- γ  release by CBA. IL-2, TNF-α, and IFN- γ  release were significantly increased compared with control group. Data are represented as mean ± SE of three independent experiments, *p
    Figure Legend Snippet: CII-CAR-T cells display specific cytokine release and proliferative capacity when stimulated by CII. (A–F) Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon in the presence of type I (50 μg/ml) or II collagen (50 μg/ml) and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, IFN- γ release by CBA. IL-2, TNF-α, and IFN- γ release were significantly increased compared with control group. Data are represented as mean ± SE of three independent experiments, *p

    Techniques Used: Co-Culture Assay, Crocin Bleaching Assay

    Human fresh cartilage and C28/I2 produce IL-6 when stimulated by CAR-T supernatants or cytokines.  (A)  Schematic representation of human fresh or FT-cartilage and C28/I2 were stimulated by CAR-T supernatants or cytokines.  (B)  Fresh or FT-cartilage was treated with supernatants of CII-CAR-T cells (CAR-T sup) or T cells (T sup) for 24 h, and IL-6 release was assayed by CBA.  (C)  IL-6 release in pretreatment groups was assayed by CBA.  (D)  IL-6 level produced by fresh or FT-cartilage when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ  for 24 h.  (E)  IL-6 level produced by C28/I2 and 293T cells when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ  for 24 h. Spontaneous release of cytokines by cartilage or C28/I2 was used as control. *p
    Figure Legend Snippet: Human fresh cartilage and C28/I2 produce IL-6 when stimulated by CAR-T supernatants or cytokines. (A) Schematic representation of human fresh or FT-cartilage and C28/I2 were stimulated by CAR-T supernatants or cytokines. (B) Fresh or FT-cartilage was treated with supernatants of CII-CAR-T cells (CAR-T sup) or T cells (T sup) for 24 h, and IL-6 release was assayed by CBA. (C) IL-6 release in pretreatment groups was assayed by CBA. (D) IL-6 level produced by fresh or FT-cartilage when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ for 24 h. (E) IL-6 level produced by C28/I2 and 293T cells when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ for 24 h. Spontaneous release of cytokines by cartilage or C28/I2 was used as control. *p

    Techniques Used: Crocin Bleaching Assay, Produced

    CII-CAR-T cells display specific cytokine release when stimulated by human fresh or FT-cartilage.  (A–F) . Supernatants were collected after 24 h co-culture of CII-CAR-T cells or T con with fresh or FT-cartilage and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, and IFN- γ  release by CBA.  (G–H)  CII-CAR-T or T cells (1 × 10 5  cells) were labeled with Far Red, then co-cultured with fresh or FT-cartilage in the absence of CD3/28 mAbs and IL-2 for 4 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T cells or T cells was analyzed by flow cytometry. *p
    Figure Legend Snippet: CII-CAR-T cells display specific cytokine release when stimulated by human fresh or FT-cartilage. (A–F) . Supernatants were collected after 24 h co-culture of CII-CAR-T cells or T con with fresh or FT-cartilage and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, and IFN- γ release by CBA. (G–H) CII-CAR-T or T cells (1 × 10 5 cells) were labeled with Far Red, then co-cultured with fresh or FT-cartilage in the absence of CD3/28 mAbs and IL-2 for 4 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T cells or T cells was analyzed by flow cytometry. *p

    Techniques Used: Co-Culture Assay, Crocin Bleaching Assay, Labeling, Cell Culture, Flow Cytometry

    Related Articles

    Recombinant:

    Article Title: Galectin-3 captures interferon-gamma in the tumor matrix reducing chemokine gradient production and T-cell tumor infiltration
    Article Snippet: .. Recombinant human glycosylated IFNγ was produced by CHO cells (SinoBiological Inc.; #11725-HNAS) or by HEK cells (BioVision; #7271). .. Its unglycosylated counterpart was produced by E. coli , (ThermoScientific; PHC4031).

    Article Title: Herpes Simplex Virus 1 MicroRNA miR-H28 Exported to Uninfected Cells in Exosomes Restricts Cell-to-Cell Virus Spread by Inducing Gamma Interferon mRNA
    Article Snippet: .. Recombinant human IFN-γ protein was purchased from Sino Biological (product no. 11725-HNAS). ..

    Produced:

    Article Title: Galectin-3 captures interferon-gamma in the tumor matrix reducing chemokine gradient production and T-cell tumor infiltration
    Article Snippet: .. Recombinant human glycosylated IFNγ was produced by CHO cells (SinoBiological Inc.; #11725-HNAS) or by HEK cells (BioVision; #7271). .. Its unglycosylated counterpart was produced by E. coli , (ThermoScientific; PHC4031).

    RNA Sequencing Assay:

    Article Title: A Tumor-Specific Super-Enhancer Drives Immune Evasion by Guiding Synchronous Expression of PD-L1 and PD-L2.
    Article Snippet: KEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-PD-L1 (PE conjugated) Elabscience E-AB-F1133D Anti-PD-L2 (APC conjugated) Elabscience E-AB-F1175E Anti-CD3 (PE conjugated) Elabscience E-AB-F1001D Anti-CD8a (FITC conjugated) Elabscience E-AB-F1110C Anti-PD-L1 Abcam ab213524 Anti-PD-L2 Abcam ab187662 Anti-GAPDH Santa Cruz sc-365062 Anti-CD3 Biolegend 300437 Anti-CD28 Biolegend 302933 Chemicals, Peptides, and Recombinant Proteins. .. JQ-1 APEXBIO A1910I-BET-762 APEXBIO B1498 Recombinant human IL-2 Biolegend 589102 Recombinant human IFNg Sino Biological 11725-HNAS Deposited Data RNA-seq (SUM-159 SgV and SgL1L2-SE) This Paper GSE135016 HBL-1 (H3K27Ac ChIP-seq) GEO GSM1254196 SUM-159 (BRD4 ChIP-seq) GEO GSM2330549 SUM-159 (H3K27Ac ChIP-seq) GEO GSE87424 SUM-159-JQ1 (RNA-seq) GEO GSE63584 SUM-159-DMSO (RNA-seq) GEO GSE87419 H3K27Ac ChIP-seq (13 cell lines) GEO GSE85158 RNA-seq (MCF7, MB231) GEO GSE75168 ATAC-seq (Breast cancer samples) TCGA TCGA-BRCA RNA-seq (Breast cancer samples) TCGA TCGA-BRCA Experimental Models: Cell Lines Human: SUM-159 sgVector This Paper N/A Human: SUM-159 sgPD-L1L2-SE-1 This Paper N/A Human: SUM-159 sgPD-L1L2-SE-2 This Paper N/A Human: MCF7 ATCC HTB-22 Human: MDA-MB-231 ATCC HTB-226 Mouse: B16-F10 ATCC CRL-6475 Human: HEK293T ATCC CRL-3216 Human: Raji ATCC CCL-86 Human: U266 ATCC TIB-196. .. SU-DHL-2 COBIOER CBP60274 SU-DHL-10 COBIOER CBP60560SUM-159 COBIOER CBP60393 Oligonucleotides Human-PD-L1-RT-PCR-F: CATAGCCACAGTGATAGCCCT This Paper N/A Human-PD-L1-RT-PCR-R: GGCTCCCAAGACCACAGGTTC This Paper N/A (Continued on next page) e1 Cell Reports 29, 3435–3447.e1–e4, December 10, 2019.

    ChIP-sequencing:

    Article Title: A Tumor-Specific Super-Enhancer Drives Immune Evasion by Guiding Synchronous Expression of PD-L1 and PD-L2.
    Article Snippet: KEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-PD-L1 (PE conjugated) Elabscience E-AB-F1133D Anti-PD-L2 (APC conjugated) Elabscience E-AB-F1175E Anti-CD3 (PE conjugated) Elabscience E-AB-F1001D Anti-CD8a (FITC conjugated) Elabscience E-AB-F1110C Anti-PD-L1 Abcam ab213524 Anti-PD-L2 Abcam ab187662 Anti-GAPDH Santa Cruz sc-365062 Anti-CD3 Biolegend 300437 Anti-CD28 Biolegend 302933 Chemicals, Peptides, and Recombinant Proteins. .. JQ-1 APEXBIO A1910I-BET-762 APEXBIO B1498 Recombinant human IL-2 Biolegend 589102 Recombinant human IFNg Sino Biological 11725-HNAS Deposited Data RNA-seq (SUM-159 SgV and SgL1L2-SE) This Paper GSE135016 HBL-1 (H3K27Ac ChIP-seq) GEO GSM1254196 SUM-159 (BRD4 ChIP-seq) GEO GSM2330549 SUM-159 (H3K27Ac ChIP-seq) GEO GSE87424 SUM-159-JQ1 (RNA-seq) GEO GSE63584 SUM-159-DMSO (RNA-seq) GEO GSE87419 H3K27Ac ChIP-seq (13 cell lines) GEO GSE85158 RNA-seq (MCF7, MB231) GEO GSE75168 ATAC-seq (Breast cancer samples) TCGA TCGA-BRCA RNA-seq (Breast cancer samples) TCGA TCGA-BRCA Experimental Models: Cell Lines Human: SUM-159 sgVector This Paper N/A Human: SUM-159 sgPD-L1L2-SE-1 This Paper N/A Human: SUM-159 sgPD-L1L2-SE-2 This Paper N/A Human: MCF7 ATCC HTB-22 Human: MDA-MB-231 ATCC HTB-226 Mouse: B16-F10 ATCC CRL-6475 Human: HEK293T ATCC CRL-3216 Human: Raji ATCC CCL-86 Human: U266 ATCC TIB-196. .. SU-DHL-2 COBIOER CBP60274 SU-DHL-10 COBIOER CBP60560SUM-159 COBIOER CBP60393 Oligonucleotides Human-PD-L1-RT-PCR-F: CATAGCCACAGTGATAGCCCT This Paper N/A Human-PD-L1-RT-PCR-R: GGCTCCCAAGACCACAGGTTC This Paper N/A (Continued on next page) e1 Cell Reports 29, 3435–3447.e1–e4, December 10, 2019.

    Multiple Displacement Amplification:

    Article Title: A Tumor-Specific Super-Enhancer Drives Immune Evasion by Guiding Synchronous Expression of PD-L1 and PD-L2.
    Article Snippet: KEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-PD-L1 (PE conjugated) Elabscience E-AB-F1133D Anti-PD-L2 (APC conjugated) Elabscience E-AB-F1175E Anti-CD3 (PE conjugated) Elabscience E-AB-F1001D Anti-CD8a (FITC conjugated) Elabscience E-AB-F1110C Anti-PD-L1 Abcam ab213524 Anti-PD-L2 Abcam ab187662 Anti-GAPDH Santa Cruz sc-365062 Anti-CD3 Biolegend 300437 Anti-CD28 Biolegend 302933 Chemicals, Peptides, and Recombinant Proteins. .. JQ-1 APEXBIO A1910I-BET-762 APEXBIO B1498 Recombinant human IL-2 Biolegend 589102 Recombinant human IFNg Sino Biological 11725-HNAS Deposited Data RNA-seq (SUM-159 SgV and SgL1L2-SE) This Paper GSE135016 HBL-1 (H3K27Ac ChIP-seq) GEO GSM1254196 SUM-159 (BRD4 ChIP-seq) GEO GSM2330549 SUM-159 (H3K27Ac ChIP-seq) GEO GSE87424 SUM-159-JQ1 (RNA-seq) GEO GSE63584 SUM-159-DMSO (RNA-seq) GEO GSE87419 H3K27Ac ChIP-seq (13 cell lines) GEO GSE85158 RNA-seq (MCF7, MB231) GEO GSE75168 ATAC-seq (Breast cancer samples) TCGA TCGA-BRCA RNA-seq (Breast cancer samples) TCGA TCGA-BRCA Experimental Models: Cell Lines Human: SUM-159 sgVector This Paper N/A Human: SUM-159 sgPD-L1L2-SE-1 This Paper N/A Human: SUM-159 sgPD-L1L2-SE-2 This Paper N/A Human: MCF7 ATCC HTB-22 Human: MDA-MB-231 ATCC HTB-226 Mouse: B16-F10 ATCC CRL-6475 Human: HEK293T ATCC CRL-3216 Human: Raji ATCC CCL-86 Human: U266 ATCC TIB-196. .. SU-DHL-2 COBIOER CBP60274 SU-DHL-10 COBIOER CBP60560SUM-159 COBIOER CBP60393 Oligonucleotides Human-PD-L1-RT-PCR-F: CATAGCCACAGTGATAGCCCT This Paper N/A Human-PD-L1-RT-PCR-R: GGCTCCCAAGACCACAGGTTC This Paper N/A (Continued on next page) e1 Cell Reports 29, 3435–3447.e1–e4, December 10, 2019.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Sino Biological recombinant human glycosylated ifnγ
    Scheme summarizing the main protumoral effects known for galectin-3 in the tumor microenvironment. Galectin-3 has been described to immobilize <t>glycosylated</t> proteins on the surface of T cells 28 , 30 , 31 , 32 , 33 , <t>IFNγ</t> receptor on human fibroblasts and B cells 53 , and VEGF receptor in human endothelial cells 27 . In addition, galectin-3 favors collagen deposition by macrophages 48 and tumor cell migration 54 . This figure does not intend to make an exhaustive review about all the effects published for galectin-3 but to highlight the ones that, in our opinion, can be working simultaneously in the tumor microenvironment
    Recombinant Human Glycosylated Ifnγ, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant human glycosylated ifnγ/product/Sino Biological
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant human glycosylated ifnγ - by Bioz Stars, 2021-04
    93/100 stars
      Buy from Supplier

    Image Search Results


    Scheme summarizing the main protumoral effects known for galectin-3 in the tumor microenvironment. Galectin-3 has been described to immobilize glycosylated proteins on the surface of T cells 28 , 30 , 31 , 32 , 33 , IFNγ receptor on human fibroblasts and B cells 53 , and VEGF receptor in human endothelial cells 27 . In addition, galectin-3 favors collagen deposition by macrophages 48 and tumor cell migration 54 . This figure does not intend to make an exhaustive review about all the effects published for galectin-3 but to highlight the ones that, in our opinion, can be working simultaneously in the tumor microenvironment

    Journal: Nature Communications

    Article Title: Galectin-3 captures interferon-gamma in the tumor matrix reducing chemokine gradient production and T-cell tumor infiltration

    doi: 10.1038/s41467-017-00925-6

    Figure Lengend Snippet: Scheme summarizing the main protumoral effects known for galectin-3 in the tumor microenvironment. Galectin-3 has been described to immobilize glycosylated proteins on the surface of T cells 28 , 30 , 31 , 32 , 33 , IFNγ receptor on human fibroblasts and B cells 53 , and VEGF receptor in human endothelial cells 27 . In addition, galectin-3 favors collagen deposition by macrophages 48 and tumor cell migration 54 . This figure does not intend to make an exhaustive review about all the effects published for galectin-3 but to highlight the ones that, in our opinion, can be working simultaneously in the tumor microenvironment

    Article Snippet: Recombinant human glycosylated IFNγ was produced by CHO cells (SinoBiological Inc.; #11725-HNAS) or by HEK cells (BioVision; #7271).

    Techniques: Migration

    Binding of human glycosylated cytokines to galectin-3-coated beads. Ratio refers to molar ratio. a hIFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. The glycosylated IFNγ was produced in CHO cells and the unglycosylated IFNγ was produced in E. coli . Mean ± SD of one representative experiment of 8 (glycosylated IFNγ) or 2 (unglycosylated IFNγ), performed in duplicates. The dotted line stresses that more than 90% of the glycosylated IFNγ was retained when mixed with 10 times more galectin-3-coated beads. b Glycosylated IFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads and different galectin antagonists (LacNAc 5 mM, TetraLacNAc 30 μM, GM-CT-01 100 μg ml −1 ), anti-galectin-3 antibody or a control isotype (10 μg ml −1 ). Mean ± SD of one representative experiment of three. c Glycosylated hIL-12 measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Mean ± SD of one representative experiment of three, performed in duplicates. d Cytokines and chemokines measured in a human synovial fluid collected from a rheumatoid arthritis patient after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Note: glycosylated cytokines and chemokines were entirely glycosylated, containing no detectable unglycosylated fraction

    Journal: Nature Communications

    Article Title: Galectin-3 captures interferon-gamma in the tumor matrix reducing chemokine gradient production and T-cell tumor infiltration

    doi: 10.1038/s41467-017-00925-6

    Figure Lengend Snippet: Binding of human glycosylated cytokines to galectin-3-coated beads. Ratio refers to molar ratio. a hIFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. The glycosylated IFNγ was produced in CHO cells and the unglycosylated IFNγ was produced in E. coli . Mean ± SD of one representative experiment of 8 (glycosylated IFNγ) or 2 (unglycosylated IFNγ), performed in duplicates. The dotted line stresses that more than 90% of the glycosylated IFNγ was retained when mixed with 10 times more galectin-3-coated beads. b Glycosylated IFNγ measured by ELISA in the supernatant after incubation with galectin-3-coated beads and different galectin antagonists (LacNAc 5 mM, TetraLacNAc 30 μM, GM-CT-01 100 μg ml −1 ), anti-galectin-3 antibody or a control isotype (10 μg ml −1 ). Mean ± SD of one representative experiment of three. c Glycosylated hIL-12 measured by ELISA in the supernatant after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Mean ± SD of one representative experiment of three, performed in duplicates. d Cytokines and chemokines measured in a human synovial fluid collected from a rheumatoid arthritis patient after incubation with galectin-3-coated beads in the presence or absence of 100 mM lactose. Note: glycosylated cytokines and chemokines were entirely glycosylated, containing no detectable unglycosylated fraction

    Article Snippet: Recombinant human glycosylated IFNγ was produced by CHO cells (SinoBiological Inc.; #11725-HNAS) or by HEK cells (BioVision; #7271).

    Techniques: Binding Assay, Enzyme-linked Immunosorbent Assay, Incubation, Produced

    Reduced diffusion of glycosylated human IFNγ and IL-12 through galectin-3-loaded collagen matrices. a Schematic drawing of the protocol. Galectin-3 (1 μg per transwell), IFNγ (25 ng per transwell), IL-12 (7 ng per transwell), and LacNAc (1.2 mg per transwell). b IFNγ diffusion through collagen in 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.006; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test. c IL-12 diffusion through collagen after 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.032; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test

    Journal: Nature Communications

    Article Title: Galectin-3 captures interferon-gamma in the tumor matrix reducing chemokine gradient production and T-cell tumor infiltration

    doi: 10.1038/s41467-017-00925-6

    Figure Lengend Snippet: Reduced diffusion of glycosylated human IFNγ and IL-12 through galectin-3-loaded collagen matrices. a Schematic drawing of the protocol. Galectin-3 (1 μg per transwell), IFNγ (25 ng per transwell), IL-12 (7 ng per transwell), and LacNAc (1.2 mg per transwell). b IFNγ diffusion through collagen in 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.006; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test. c IL-12 diffusion through collagen after 4 h was measured by ELISA. Mean ± SD of three experiments performed in duplicates. P = 0.032; Kruskal–Wallis test with Dunn’s Multiple Comparison Correction Test

    Article Snippet: Recombinant human glycosylated IFNγ was produced by CHO cells (SinoBiological Inc.; #11725-HNAS) or by HEK cells (BioVision; #7271).

    Techniques: Diffusion-based Assay, Enzyme-linked Immunosorbent Assay

    CII-CAR-T display specific cytokine release when co-cultured by C28/I2 cell line.  (A)  Immunofluorescence staining images show the expression of CII (red) and merged images (with DAPI, blue) in C28/I2.  (B–E)  Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon with C28/I2 and assayed for IL-2, IL-6, TNF-α, and IFN- γ  release by CBA.  (F, G)  CII-CAR-T or Tcon cells (1 × 10 5 ) were labeled with Far Red, then co-cultured with C28/I2 cells in the absence of CD3/28 mAbs and IL-2 for 3 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T or T cells was analyzed by flow cytometry. *p

    Journal: Frontiers in Immunology

    Article Title: Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes

    doi: 10.3389/fimmu.2020.568741

    Figure Lengend Snippet: CII-CAR-T display specific cytokine release when co-cultured by C28/I2 cell line. (A) Immunofluorescence staining images show the expression of CII (red) and merged images (with DAPI, blue) in C28/I2. (B–E) Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon with C28/I2 and assayed for IL-2, IL-6, TNF-α, and IFN- γ release by CBA. (F, G) CII-CAR-T or Tcon cells (1 × 10 5 ) were labeled with Far Red, then co-cultured with C28/I2 cells in the absence of CD3/28 mAbs and IL-2 for 3 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T or T cells was analyzed by flow cytometry. *p

    Article Snippet: To further explore the effects of TNF-α and IFN-γ on human fresh cartilage and C28/I2 cells, 5 ng/ml TNF-α or/and 10 ng/ml IFN-γ (sino biological) was added in culture medium for 24 h for detection.

    Techniques: Cell Culture, Immunofluorescence, Staining, Expressing, Co-Culture Assay, Crocin Bleaching Assay, Labeling, Flow Cytometry

    CII-CAR-T cells display specific cytokine release and proliferative capacity when stimulated by CII.  (A–F)  Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon in the presence of type I (50 μg/ml) or II collagen (50 μg/ml) and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, IFN- γ  release by CBA. IL-2, TNF-α, and IFN- γ  release were significantly increased compared with control group. Data are represented as mean ± SE of three independent experiments, *p

    Journal: Frontiers in Immunology

    Article Title: Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes

    doi: 10.3389/fimmu.2020.568741

    Figure Lengend Snippet: CII-CAR-T cells display specific cytokine release and proliferative capacity when stimulated by CII. (A–F) Supernatants were collected after 24 h co-culture of CII-CAR-T cells or Tcon in the presence of type I (50 μg/ml) or II collagen (50 μg/ml) and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, IFN- γ release by CBA. IL-2, TNF-α, and IFN- γ release were significantly increased compared with control group. Data are represented as mean ± SE of three independent experiments, *p

    Article Snippet: To further explore the effects of TNF-α and IFN-γ on human fresh cartilage and C28/I2 cells, 5 ng/ml TNF-α or/and 10 ng/ml IFN-γ (sino biological) was added in culture medium for 24 h for detection.

    Techniques: Co-Culture Assay, Crocin Bleaching Assay

    Human fresh cartilage and C28/I2 produce IL-6 when stimulated by CAR-T supernatants or cytokines.  (A)  Schematic representation of human fresh or FT-cartilage and C28/I2 were stimulated by CAR-T supernatants or cytokines.  (B)  Fresh or FT-cartilage was treated with supernatants of CII-CAR-T cells (CAR-T sup) or T cells (T sup) for 24 h, and IL-6 release was assayed by CBA.  (C)  IL-6 release in pretreatment groups was assayed by CBA.  (D)  IL-6 level produced by fresh or FT-cartilage when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ  for 24 h.  (E)  IL-6 level produced by C28/I2 and 293T cells when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ  for 24 h. Spontaneous release of cytokines by cartilage or C28/I2 was used as control. *p

    Journal: Frontiers in Immunology

    Article Title: Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes

    doi: 10.3389/fimmu.2020.568741

    Figure Lengend Snippet: Human fresh cartilage and C28/I2 produce IL-6 when stimulated by CAR-T supernatants or cytokines. (A) Schematic representation of human fresh or FT-cartilage and C28/I2 were stimulated by CAR-T supernatants or cytokines. (B) Fresh or FT-cartilage was treated with supernatants of CII-CAR-T cells (CAR-T sup) or T cells (T sup) for 24 h, and IL-6 release was assayed by CBA. (C) IL-6 release in pretreatment groups was assayed by CBA. (D) IL-6 level produced by fresh or FT-cartilage when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ for 24 h. (E) IL-6 level produced by C28/I2 and 293T cells when stimulated with 5 ng/ml TNF-α and/or 10 ng/ml IFN- γ for 24 h. Spontaneous release of cytokines by cartilage or C28/I2 was used as control. *p

    Article Snippet: To further explore the effects of TNF-α and IFN-γ on human fresh cartilage and C28/I2 cells, 5 ng/ml TNF-α or/and 10 ng/ml IFN-γ (sino biological) was added in culture medium for 24 h for detection.

    Techniques: Crocin Bleaching Assay, Produced

    CII-CAR-T cells display specific cytokine release when stimulated by human fresh or FT-cartilage.  (A–F) . Supernatants were collected after 24 h co-culture of CII-CAR-T cells or T con with fresh or FT-cartilage and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, and IFN- γ  release by CBA.  (G–H)  CII-CAR-T or T cells (1 × 10 5  cells) were labeled with Far Red, then co-cultured with fresh or FT-cartilage in the absence of CD3/28 mAbs and IL-2 for 4 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T cells or T cells was analyzed by flow cytometry. *p

    Journal: Frontiers in Immunology

    Article Title: Construction of CII-Specific CAR-T to Explore the Cytokine Cascades Between Cartilage-Reactive T Cells and Chondrocytes

    doi: 10.3389/fimmu.2020.568741

    Figure Lengend Snippet: CII-CAR-T cells display specific cytokine release when stimulated by human fresh or FT-cartilage. (A–F) . Supernatants were collected after 24 h co-culture of CII-CAR-T cells or T con with fresh or FT-cartilage and assayed for IL-2, IL-4, IL-6, IL-10, TNF-α, and IFN- γ release by CBA. (G–H) CII-CAR-T or T cells (1 × 10 5 cells) were labeled with Far Red, then co-cultured with fresh or FT-cartilage in the absence of CD3/28 mAbs and IL-2 for 4 days. CII-CAR-T or T cells alone were used as control. The Far Red intensity in CII-CAR-T cells or T cells was analyzed by flow cytometry. *p

    Article Snippet: To further explore the effects of TNF-α and IFN-γ on human fresh cartilage and C28/I2 cells, 5 ng/ml TNF-α or/and 10 ng/ml IFN-γ (sino biological) was added in culture medium for 24 h for detection.

    Techniques: Co-Culture Assay, Crocin Bleaching Assay, Labeling, Cell Culture, Flow Cytometry