1×phi29 polymerase buffer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Buffer B 10X
    Description:
    Thermo Scientific 10X Buffer B ensures the optimum reaction conditions for specific restriction enzymes and is premixed with BSA for enhanced stability It is part of Thermo Scientific Five Buffer System which ensures the optimum reaction conditions for each restriction enzyme The system consists of 10X B blue G green O orange R red and Tango yellow buffers All restriction enzymes are supplied in color coded tubes to indicate the recommended reaction buffer The recommended buffer and or the universal Tango buffer are supplied with each enzyme To ensure consistent enzyme performance Thermo Scientific restriction enzyme buffers contain BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Multiple freeze thaw cycles of the buffers will not cause BSA precipitation Thermo Scientific restriction enzymes exhibit 100 of their certified activity in the recommended buffer However some enzymes require additives to achieve 100 activity For example AjuI AlfI BdaI BplI BseMII FaqI Eco57I Eco57MI Hin4I and TsoI require S adenosylmethionine which is supplied with the enzyme AarI and BveI require an oligonucleotide also supplied with the enzyme and Esp3I requires DTT
    Catalog Number:
    bb5
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Category:
    Lab Reagents and Chemicals
    Buy from Supplier


    Structured Review

    Thermo Fisher 1×phi29 polymerase buffer
    Thermo Scientific 10X Buffer B ensures the optimum reaction conditions for specific restriction enzymes and is premixed with BSA for enhanced stability It is part of Thermo Scientific Five Buffer System which ensures the optimum reaction conditions for each restriction enzyme The system consists of 10X B blue G green O orange R red and Tango yellow buffers All restriction enzymes are supplied in color coded tubes to indicate the recommended reaction buffer The recommended buffer and or the universal Tango buffer are supplied with each enzyme To ensure consistent enzyme performance Thermo Scientific restriction enzyme buffers contain BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Multiple freeze thaw cycles of the buffers will not cause BSA precipitation Thermo Scientific restriction enzymes exhibit 100 of their certified activity in the recommended buffer However some enzymes require additives to achieve 100 activity For example AjuI AlfI BdaI BplI BseMII FaqI Eco57I Eco57MI Hin4I and TsoI require S adenosylmethionine which is supplied with the enzyme AarI and BveI require an oligonucleotide also supplied with the enzyme and Esp3I requires DTT
    https://www.bioz.com/result/1×phi29 polymerase buffer/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    1×phi29 polymerase buffer - by Bioz Stars, 2020-11
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo
    Article Snippet: .. Briefly, PCR reaction was performed after mixing 0.5 μl of miR-138 specific primers (10 μM), 2.5 μl of PCR buffer (10μl), 0.75 μl of MgCl2 (50 mM), 0.5 μl of dNTPs (10 mM, Invitrogen, Carlsbad, CA, USA), 0.2 μl of Taq Platinum DNA polymerase (5 U/μl, Invitrogen, Carlsbad, CA, USA) and 2 μl of RT product in a PCR thermal cycler (Eppendorf mastercycler gradient). .. The cycling protocol consisted of an initial 10 min denaturation step at 95°C, followed by 35 cycles of PCR amplification of the transcripts using a program (denaturation at 95°C for 15 s, and annealing at 52 °C for 30 s, and 72°C extension for 30 s), and final extension at 72°C for 7 min.

    Article Title: Viral Studies in Burkitt Lymphoma
    Article Snippet: .. In each 25-µL PCR reaction, 100 ng of DNA, 0.3 µmol/L of 5′ and 3′ oligonucleotide primers (KS330 forward AGCCGAAAGGATTCCACCAT and reverse TCCGTGTTGTCTACGTCCAG), 0.2 mmol/L of deoxynucleoside triphosphate (dNTP), 2.5 µL of 10× PCR buffer, 1.25 U of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), and 3.0 mmol/L of magnesium chloride were used. .. PCR was initiated by 1 cycle at 95°C for 2 minutes, followed by 35 cycles of 30 seconds at 93°C, 25 seconds at 60°C, and 30 seconds at 72°C and further followed by a 5-minute extension at 72°C, according to Pak et al. Subtyping for EBV, by PCR amplification of the EBNA2 region, was performed in 131 cases.

    Article Title: Oral Colonization, Phenotypic, and Genotypic Profiles of Candida Species in Irradiated, Dentate, Xerostomic Nasopharyngeal Carcinoma Survivors
    Article Snippet: .. A 50-μl volume of the PCR master mix contained approximately 200 ng of yeast DNA template, 5 μl of PCR buffer (10× PCR buffer is 0.5 M KCl–0.2 M Tris (pH 8.4), a 200 μM concentration of each dNTP, 25 mM MgCl2 , a 1 μM concentration of primer, and 1.5 U of Taq polymarase (Life Technologies, Frederick, Md.). .. The first five cycles of PCR protocol included 30 s of denaturation at 94°C and 2 min of annealing at 27°C (primer NA) or 52°C (primers JWF R and JWF F ); this was followed first by 2 min of primer extension and then by 45 cycles of 30 s of denaturation at 94°C, 2 min of annealing at 32°C (primer NA) or at 57°C (primers JWF R and JWF F ), and 2 min of primer extension at 72°C.

    Article Title: Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits
    Article Snippet: .. The PCR 50 µL reaction consisted of 100 ng DNA or cDNA template, 5 µL 10x PCR buffer, 4 µL 2.5 mM dNTP mix, 1 µL sense primer (100 ng/µL), 1 µL antisense primer (100 ng/µL), 0.5 µL 5 U r-Taq DNA polymerase (Fermentas, Vilnius, Lithuania) and sterile water. .. The PCR amplification was initiated with a 5-minute denaturation at 95°C and continued with the following parameters (35 cycles): 30 sec at 95°C (denaturation), 30 sec at Tm specific for primer (annealing) and 30 sec at 72°C (elongation), followed by 5 min at 72°C (elongation), and stored at 4°C until analysis.

    Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex
    Article Snippet: .. K8 RT-PCR was performed as follows: 5 μl of the same cDNA as for K6 were mixed with 5 μl of 10× PCR buffer, 3 μl of 25 mM MgCl2 , 2 μl of 5 mM dNTPs, 25 pmol of each primer, and 1.5 U of Taq polymerase (MBI Fermentas) and filled up to 50 μl total volume. .. Total proteins from skin of newborn mice were extracted by homogenization in 1× SDS sample buffer ( ).

    Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40
    Article Snippet: .. Briefly, 1 μ g of DNA in 40 μ L was digested with either 10 units of methylation-sensitive restriction enzyme Hpa II (Fermentas) or 10 units of methylation-insensitive isoschizomer Msp I (Fermentas) at 37°C for 16 h. Aliquot of restriction-digested DNA (4 μ L) was amplified in a final volume of 50 μ L containing 1x PCR buffer, 50 pmol of a single primer MLG2 (5′-AACCCTCACCCTAACCCCGG-3′), 200 μ M of each dNTP, 2 mM of MgCl2 , and 1.25 units of Taq DNA polymerase (Fermentas). .. The reactions were carried out in a thermal cycler (Applied Biosystems 2720) for five cycles under low stringency (94°C for 30 s, 40°C for 60 s, and 72°C for 90 s) followed by 30 cycles under high stringency (95°C for 15 s, 55°C for 15 s, and 72°C for 60 s).

    Article Title: Vibrio parahaemolyticus Disruption of Epithelial Cell Tight Junctions Occurs Independently of Toxin Production
    Article Snippet: .. The tdh and tlh PCR mixtures (final volume, 25 μl) contained 10× PCR buffer (50 mM KCl, 10 mM Tris [pH 8.5], 0.1% gelatin, 1.5% MgCl2 ), each deoxynucleoside triphosphate (Invitrogen Life Technologies, Burlington, Ontario, Canada) at a concentration of 0.25 mM, Taq polymerase (1.25 U; New England Biolabs Ltd., Mississauga, Ontario, Canada), and nuclease-free water (Gibco). .. We used touchdown PCR to amplify the TDH and TLH genes.

    Article Title: A Simple and Rapid Genotyping Assay for Simultaneous Detection of Two ADRB2 Allelic Variants Using Fluorescence Resonance Energy Transfer Probes and Melting Curve Analysis
    Article Snippet: .. PCR was performed on a 96-well GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA) using 10 μl (ranging from 1 to 25 ng/μl) of genomic DNA in 40 μl of a PCR buffer containing 1 μmol/L each of the forward and reverse primers, 0.8 mmol/L deoxynucleoside-5′-triphosphates, 1.5 mmol/L Mg2 Cl, and 1.25 U of AmpliTaq gold DNA polymerase (Applied Biosystems). .. PCR conditions were as follow: initial denaturation at 95°C for 10 minutes followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and elongation at 72°C for 1 minute, with a final extension at 72°C for 7 minutes.

    Concentration Assay:

    Article Title: Oral Colonization, Phenotypic, and Genotypic Profiles of Candida Species in Irradiated, Dentate, Xerostomic Nasopharyngeal Carcinoma Survivors
    Article Snippet: .. A 50-μl volume of the PCR master mix contained approximately 200 ng of yeast DNA template, 5 μl of PCR buffer (10× PCR buffer is 0.5 M KCl–0.2 M Tris (pH 8.4), a 200 μM concentration of each dNTP, 25 mM MgCl2 , a 1 μM concentration of primer, and 1.5 U of Taq polymarase (Life Technologies, Frederick, Md.). .. The first five cycles of PCR protocol included 30 s of denaturation at 94°C and 2 min of annealing at 27°C (primer NA) or 52°C (primers JWF R and JWF F ); this was followed first by 2 min of primer extension and then by 45 cycles of 30 s of denaturation at 94°C, 2 min of annealing at 32°C (primer NA) or at 57°C (primers JWF R and JWF F ), and 2 min of primer extension at 72°C.

    Article Title: Vibrio parahaemolyticus Disruption of Epithelial Cell Tight Junctions Occurs Independently of Toxin Production
    Article Snippet: .. The tdh and tlh PCR mixtures (final volume, 25 μl) contained 10× PCR buffer (50 mM KCl, 10 mM Tris [pH 8.5], 0.1% gelatin, 1.5% MgCl2 ), each deoxynucleoside triphosphate (Invitrogen Life Technologies, Burlington, Ontario, Canada) at a concentration of 0.25 mM, Taq polymerase (1.25 U; New England Biolabs Ltd., Mississauga, Ontario, Canada), and nuclease-free water (Gibco). .. We used touchdown PCR to amplify the TDH and TLH genes.

    Amplification:

    Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40
    Article Snippet: .. Briefly, 1 μ g of DNA in 40 μ L was digested with either 10 units of methylation-sensitive restriction enzyme Hpa II (Fermentas) or 10 units of methylation-insensitive isoschizomer Msp I (Fermentas) at 37°C for 16 h. Aliquot of restriction-digested DNA (4 μ L) was amplified in a final volume of 50 μ L containing 1x PCR buffer, 50 pmol of a single primer MLG2 (5′-AACCCTCACCCTAACCCCGG-3′), 200 μ M of each dNTP, 2 mM of MgCl2 , and 1.25 units of Taq DNA polymerase (Fermentas). .. The reactions were carried out in a thermal cycler (Applied Biosystems 2720) for five cycles under low stringency (94°C for 30 s, 40°C for 60 s, and 72°C for 90 s) followed by 30 cycles under high stringency (95°C for 15 s, 55°C for 15 s, and 72°C for 60 s).

    Methylation:

    Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40
    Article Snippet: .. Briefly, 1 μ g of DNA in 40 μ L was digested with either 10 units of methylation-sensitive restriction enzyme Hpa II (Fermentas) or 10 units of methylation-insensitive isoschizomer Msp I (Fermentas) at 37°C for 16 h. Aliquot of restriction-digested DNA (4 μ L) was amplified in a final volume of 50 μ L containing 1x PCR buffer, 50 pmol of a single primer MLG2 (5′-AACCCTCACCCTAACCCCGG-3′), 200 μ M of each dNTP, 2 mM of MgCl2 , and 1.25 units of Taq DNA polymerase (Fermentas). .. The reactions were carried out in a thermal cycler (Applied Biosystems 2720) for five cycles under low stringency (94°C for 30 s, 40°C for 60 s, and 72°C for 90 s) followed by 30 cycles under high stringency (95°C for 15 s, 55°C for 15 s, and 72°C for 60 s).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex
    Article Snippet: .. K8 RT-PCR was performed as follows: 5 μl of the same cDNA as for K6 were mixed with 5 μl of 10× PCR buffer, 3 μl of 25 mM MgCl2 , 2 μl of 5 mM dNTPs, 25 pmol of each primer, and 1.5 U of Taq polymerase (MBI Fermentas) and filled up to 50 μl total volume. .. Total proteins from skin of newborn mice were extracted by homogenization in 1× SDS sample buffer ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher phi29 dna polymerase buffer
    Phi29 Dna Polymerase Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phi29 dna polymerase buffer/product/Thermo Fisher
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    phi29 dna polymerase buffer - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher transcriptase reaction
    Transcriptase Reaction, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcriptase reaction/product/Thermo Fisher
    Average 98 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    transcriptase reaction - by Bioz Stars, 2020-11
    98/100 stars
      Buy from Supplier

    Image Search Results